Literature DB >> 29192255

The mitochondrial genome of the wolfberry fruit fly, Neoceratitis asiatica (Becker) (Diptera: Tephritidae) and the phylogeny of Neoceratitis Hendel genus.

Yun Su1, Yue Zhang1, Shiqian Feng1, Jia He2, Zihua Zhao1, Zhenzhen Bai1, Lijun Liu3, Rong Zhang4, Zhihong Li5.   

Abstract

Neoceratitis asiatica (Becker) (Diptera: Tephritidae) is one of the most important fruit pestsof wolfberry which is a traditional Chinese medicinal herb. We characterized the complete mitochondrial genome of N. asiatica and described its organization in this study. This mitogenome had a total length of 15,481 bp, consisting of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The overall base composition of N. asiatica in descending order was 40.6% A, 8.5% G, 38.4% T and 12.6% C. The phylogenetic relationships shows that Ceratitis capitata and N. asiatica may be sister taxa. This is the first report of the complete mitochondrial genome of a member of the Neoceratitis Genus and the complete mitochondrial genome sequence may provide useful information for phylogenetic analysis and studies between the genera Ceratitis and Neoceratitis.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29192255      PMCID: PMC5709374          DOI: 10.1038/s41598-017-16929-7

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

The genus Neoceratitis Hendel is a predominantly afrotropical group with one species in Asia[1], which partly distribute in Northwest China (Ningxia, Qinghai, Xinjiang and Inner Mongolia), Kazakhstan and Turkmenistan[2]. Neoceratitis asiatica (Becker) (Diptera:Tephritidae) is one of the most economically important fruit pests damaged the fruit of the Lycium turcomanicum Turcy (Solanaceae)[2]. The majority host plant, wolfberry, is a traditional Chinese medicinal herb and local cash crop[3]. The female adults only lay one egg in an unripe fruit, which exacerbates the destructive power of N. asiatica. The larvae feed on the wolfberry and develop with the ripening of wolfberry fruit. Once be damaged, the damaged maggot fruits cannot be used as a commodity, so maggot fruits rate can represent the loss rate. Wolfberries damage rate will reach 22–55% if not controlled by using pesticide[4]. In view of the seriousness of the damage to wolfberry, the research on N. asiatica (Becker) should be increasingly extensive and in-depth. However, the research on the genus Neoceratitis Hendel is very limited. Mitochondrial genomes of insects have been very extensively studied. They have been applied particularly to studies regarding phylogeny and evolution[5-7]. To date there are fifty-seven complete mitogenomes of 23 Tephritidae species in GenBank (Supplementary Table S1). Currently, studies on the mitochondrial genome of the genus Neoceratitis are mainly limited on the species N. cyanescens by fragments of four mitochondrial genes and one nuclear gene (COI, 16S, tRNA , ND6, period)[8-10], while another important species N. asiatica (for this study) have not been published yet. Based on the research of N. cyanescens, we found that the genus Ceratitis has a close relationship to the genus Neoceratitis [8-10], but the phylogenetic status of the two genera cannot be explained very well. In this study, we reported the first complete mitogenome of Neoceratitis species-N. asiatica and compared the mitogenome data with other tephritid species, aiming to providing more data to study the molecular phylogeny of Ceratitidinain particular.

Results

Mitochondrial genome sequencing and assembly

An Illumina library of N. asiatica was sequenced on a run of Hiseq 2500. After excluding the low quality value reads (lower than Q20), 466,428 read-pairs were generated finally. Through “map to reference” strategy to map all cleaned NGS reads to part of cox1 gene by Geneious R10.0., 58,875 reads were assembled to get the target sequence. After generating all assembled reads, a consensus sequence length 16,074 bp was generated. Then we manually examined for repeats at the beginning and end of the sequence to form a circle to gain the complete mitochondrial genome sequence of N. asiatica which was 15,481 bp.

Mitogenome features

The complete mitogenome of N. asiatica was 15,481 bp in length. The gene content was typical of other ancestral insect mitochondrial genomes (Fig. 1 and Table 1): 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, two ribosomal RNA (rRNA) genes and a non-coding region (A + T-rich control region). Nine PCGs (ND2, COI, COII, COIII, ATP6, ATP8, ND3, ND6 and CYTB), 14 tRNAs (tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA and tRNA ) and the control region were located on the major strand (J-strand). Four PCGs (ND5, ND4, ND4L and ND1), eight tRNAs (tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tRNA and tRNA ) and two rRNAs (lrRNA and srRNA) were located on the minor strand (N-strand).
Figure 1

Mitochondrial genome map of Neoceratitis asiatica.

Table 1

Characteristics of the mitochondrial genome of Neoceratitis asiatica (Becker).

GeneStrandLocationSize (bp)AnticodonCodonIntergenic Sequence
StartStop
tRNA Ile J1–6868GAT
tRNA Gln N112–18069TTG43
tRNA Met J200–26869CAT19
ND2 J269–12911023ATTTAA0
tRNA Trp J1298–136568TCA6
tRNA Cys N1358–142770GCA−8
tRNA Tyr N1482–154867GTA54
COI J1547–30821536TCGTAA−2
tRNA Leu(UUR) J3091–315666TAA8
COII J3171–3857687ATGTAA14
tRNA Lys J3865–393470CTT7
tRNA Asp J3935–400268GTC0
ATP8 J4003–4164162ATTTAA0
ATP6 J4158–4835678ATGTAA−7
COIII J4835–5623789ATGTAA−1
tRNA Gly J5634–570168TCC10
ND3 J5702–6055354ATATAA0
tRNA Ala J6058–612265TGC2
tRNA Arg J6145–620864TCG22
tRNA Asn J6250–631768GTT41
tRNA Ser(AGN) J6318–638568GCT0
tRNA Glu J6386–645368TTC0
tRNA Phe N6472–653968GAA18
ND5 N6538–82591722ATTTAT−2
tRNA His N8278–834366GTG18
ND4 N8350–96901341ATGTAA6
ND4L N9690–9980291ATGTAA−1
tRNA Thr J9983–1004664TGT2
tRNA Pro N10047–1011367TGG0
ND6 J10116–10640525ATTTAA2
CYTB J10640–117761137ATGTAG−1
tRNA Ser(UCN) J11775–1184167TGA−2
ND1 N11857–12796940ATAT-15
tRNA Leu(CUN) N12807–1287165TAG10
lrRNA N12840–141981359−32
tRNA Val N14224–1429572TAC25
srRNA N14295–15084790−1
A + T rich-regionJ15085–154813970
Mitochondrial genome map of Neoceratitis asiatica. Characteristics of the mitochondrial genome of Neoceratitis asiatica (Becker). Spacing sequences in 19 regions ranged from 2 to 54 bp, the longest located between tRNA and tRNA . The overlapping sequences ranged from 1 to 32 bp in 10 regions, the longest was between tRNA and lrRNA. Contrary to other insect mitogenomes[11], the nucleotide composition of N. asiatica was negative AT skews in the control region, while the rest was all AT biased and positive AT skews and negative GC skews in the whole mitochondrial genome, PCGs, rRNAs, tRNAs and the control region (Table 2). The A + T content of the non-coding control region was 88.2%.
Table 2

Nucleotide composition of the mitochondrial genome of Neoceratitis asiatica (Becker).

RegionA%C%G%T%A + T%G + C%AT skewGC skew
Whole mtDNA40.612.68.538.479.021.10.028−0.194
PCGs39.913.19.137.977.822.20.026−0.180
tRNAs39.912.59.638.077.922.10.024−0.131
rRNAs42.712.06.538.881.518.50.048−0.297
CR42.19.32.546.188.211.8−0.045−0.576
Nucleotide composition of the mitochondrial genome of Neoceratitis asiatica (Becker). The commonest start codon was ATG (in 6 PCGs –COII, ATP6, COIII, ND4, ND4L, CYTB), followed by four for ATT (ND2, ATP8, ND5 and ND6), followed by two for ATA (ND1 and ND3) and one for TCG (COI). Ten PCGs (ND1, COI, COII, ATP8, ATP6, COIII, ND3, ND4, ND4L and ND6) had TAA stop codon, one PCG (ND3) had TAT, one PCG (CYTB) had TAG, while ND1 had incomplete stop codons T. The size of 22 tRNAs ranged from 64 bp (tRNA and tRNA ) to 72 bp (tRNA ). Most tRNAs could be folded into the cloverleaf structure except for tRNA , which lacked the D-loop(Fig. 2). The number of base pairs in the DHU-stem ranged from 3 to 4 (Fig. 2). Most of the TΨ C-stems had 5 base pairs while 7 tRNAs (tRNA , tRNA , tRNA , tRNA , tRNA , tRNA , tR NA ) had 4 bp in the TΨ C-stems. The number of bases in the D-loop and TΨ C-loop was variable.
Figure 2

Putative secondary structures of tRNAs found in the mitochondrial genome of Neoceratitis asiatica.

Putative secondary structures of tRNAs found in the mitochondrial genome of Neoceratitis asiatica. The two genes encoding the small and the large ribosomal subunits were located between tRNA and tRNA , and between tRNA and the control region. The lrRNA was 1,359 bp long with an A + T content of 82.6%, and the srRNA was 790 bp long with an A + T content of 79.5%. The control region (397 bp) was flanked by srRNA and tRNA and was highly enriched in AT (88.2%).

Phylogenetic relationships

Six datasets were used to build phylogenetic trees: 1) PCG123: 13 protein-coding genes (all three codon positions included) with 11,048 nucleotides; 2) PCG123 + rRNA: 13 protein-coding genes and 2 rRNA genes with 12,834 nucleotides. 3) PCG123 + rRNA + tRNA: 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes with 14,186 nucleotides. 4) PCG12: 13 protein-coding genes (first two codon positions included) with 7,342 nucleotides; 5) PCG12 + rRNA: 13 protein-coding genes and 2 rRNA genes with 9,117 nucleotides. 6) PCG12 + rRNA + tRNA: 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes with 10,473 nucleotides. Based on the datasets, the topology structures conducted from Bayesian and ML analyses were very similar (Fig. 3). From our results, the genera Ceratitis and Neoceratitis are sister groups in the trees with high posterior probabilities (1.0) and ML bootstraps (100).
Figure 3

Phylogenetic tree of Tephritidae family based on mitochondrial genomes.

Phylogenetic tree of Tephritidae family based on mitochondrial genomes.

Discussion

In this study, we are reporting the first complete mitochondrial genome of Neoceratitis species –N. asiatica (Becker) in Tephritidae. The mitochondrial genome of N. asiatica is a closed circular molecule of 15,481 bp, which is the shortest one among the other 22 tephritid mitogenomes available with the size ranging from 15,687 bp in B. tau to 16,253 bp in D. longicornis. The control region of N. asiatica mitogenome is 397 bp in length, which is also the shortest one in the other published tephritid mitogenomes with the size ranging from 801 bp in B. tau to 1,343 bp in D. longicornis (Supplementary Table S2). The A + T contents of the whole mitogenome, PCGs, tRNAs, rRNAs and CR in N. asiatica are 79.0%, 77.8%, 77.9%, 81.5% and 88.2%, well in the range of amongst all reported tephritid mitogenomes, which range from 67.28% (B. minax) to 80.83% (P. utilis) in the whole mitogenome, from 64.30% (B. minax) to 78.90% (P. utilis) in PCGs, from 72.31% (B. minax) to 80.61% (P. utilis) in tRNAs, from 73.71% (B. minax) to 85.69% (P. utilis) in rRNAs and from 77.65% (B. minax) to 91.14% (C. capitata) in CR (Supplementary Table S2). The AT skews and GC skews of N. asiatica in the whole mitogenome, PCGs, tRNAs, rRNAs and CR are0.028 (from 0.021 in C. capitata to 0.131 in B. minax) and −0.194 (from −0.175 in P. utilis to −0.316 in B. minax), 0.026 (from 0.019 in C. capitata to 0.148 in B. minax) and −0.180 (from −0.170 in P. utilis to −0.319 in B. minax), 0.024 (from 0.005 in P. utilis to 0.055 in B. minax) and −0.131 (from −0.074 in B. cucurbitae to −0.182 in B. minax), 0.048 (minimum) and −0.297 (from −0.263 in C. capitata to −0.356in B. minax), −0.045(minimum) and −0.576 (from −0.354 in D. longicornis to 0.04 in B. cucurbitae), respectively. The rRNAs and CR of N.asiatica shows the most marked AT skews compared with the other tephritid mitogenomes, which are significant parallels with the feature in C. capitata and C. fasciventris. The CR of N. asiatica, C. capitata and C. fasciventris all show negative AT skews, while that of the other tephritid mitogenomes show positive AT skews (Supplementary Table S2). Seven PCGs in all Tephritidae species have the same start codons (ATG in ATP6, COII, CYTB, ND4 and ND4L, ATT in ND2, TCG in COI), and five PCGs (ATP6, ATP8, COIII, ND4L and ND6) have the same stop TAA codons (Table 3). In ND5, the TAT stop codon of N. asiatica is different from all the other Tephritidae species with TAA or T stop codon.
Table 3

Usage of start and stop codons in mitochondrial genome of Tephritidae.

SpeciesATP6ATP8COICOIICOIIICYTBND1
startstopstartstopstartstopstartstopstartstopstartstopstartstop
N. asiatica (Becker)ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAGATAT
A. fraterculus ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAGACATAA
B. arecae ATGTAAGTGTAATCGTAATGTAAATGTAAATGTAAATAT
B. carambolae ATGTAAGTGTAATCGTAATGTAAATGTAAATGTATAT
B. correcta ATGTAAGTGTAATCGTAATGTAAATGTAAATGTAGATAT
B. depressa ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAAATATAA
B. dorsalis ATGTAAGTGTAATCGTAATGTAAATGTAAATGTAGATAT
B. latifrons ATGTAAGTGTAATCGTAATGTAAATGTAAATGTAAATAT
B. melastomatos ATGTAAGTGTAATCGTAATGTAAATGTAAATGTATAT
B. tryoni ATGTAAGTGTAATCGTAATGTAAATGTAAATGTAGATAT
B. umbrosa ATGTAAATGTAATCGTAATGTAAATGTAAATGTATAT
B. zonata ATGTAAGTGTAATCGTAATGTAAATGTAAATGTAGATAT
B. oleae ATGTAAATGTAATCGTAATGTAAATGTAAATGTAGATGT
B. minax ATGTAAATTTAATCGTAATGTAAATGTAAATGTAGATAT
B. caudate ATGTAAATTTAATCGTAAATGTAAATGTAAATGTATAT
B. cucurbitae ATGTAAATTTAATCGTAAATGTAAATGTAAATGTATAT
B. diaphora ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAGATAT
B. scutellata ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAGATAT
B. tau ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAGATAT
C. capitata ATGTAAATTTAATCGTAAATGTAAATGTAAATGTATTT
Cfasciventris ATGTAAATTTAATCGTAAATGTAAATGTAAATGTAGATTTAA
D. longicornis ATGTAAATCTAATCGTAAATGTAAATGTAAATGTATGT
P. utilis ATGTAAATTTAATCGTAAATGTATATAAATGTAAATATAG
Species ND2 ND3 ND4 ND4L ND5 ND6
start stop start stop start stop start stop start stop start stop
N. asiatica (Becker)ATTTAAATATAAATGTAAATGTAAATTTATATTTAA
A.  fraterculus ATTTAGATTTAAATGTAAATGTAAATTTAAATTTAA
B. arecae ATTTAAATTTATGTAGATGTAAATCTATTTAA
B. carambolae ATTTAAATTTAGATGTAGATGTAAATTTATTTAA
B. correcta ATTTAAATTTAGATGTAGATGTAAATTTATTTAA
B. depressa ATTTAGATCTAGATGTAAATGTAAATTTAAATTTAA
B. dorsalis ATTTAAATTTATGTAGATGTAAATTTATTTAA
B. latifrons ATTTAAATTTATGTAGATGTAAATTTATTTAA
B. melastomatos ATTTAAATCTATGTAGATGTAAATTTATTTAA
B. tryoni ATTTAAATTTATGTAGATGTAAATTTATCTAA
B. umbrosa ATTTAAATTTATGTAGATGTAAATTTATTTAA
B. zonata ATTTAAATTTATGTAGATGTAAATTTATTTAA
B. oleae ATTTAAATCTAGATGTAAATGTAAATTTAAATCTAA
B. minax ATTTAGATCTATGTAAATGTAAATTTAAATGTAA
B. caudata ATTTAAATCTAGATGTAAATGTAAATTTATTTAA
B. cucurbitae ATTTAAATCTAGATGTAAATGTAAATTTATTTAA
B. diaphora ATTTAAATCTATGTAAATGTAAATTTATTTAA
B. scutellata ATTTAAATCTAGATGTAAATGTAAATTTATTTAA
B. tau ATTTAAATCTAAATGTAAATGTAAATTTATTTAA
C. capitata ATTTAAATATAAATGTAAATGTAAATTTATTTAA
C.  fasciventris ATTTAAATATAAATGTAAATGTAAATTTAAATTTAA
D. longicornis ATTTAGATATAGATGTAGATGTAAATTTATCTAA
P. utilis ATTTAAATTTAAATGTAAATGTAAATTTATATAA
Usage of start and stop codons in mitochondrial genome of Tephritidae. Phylogenetic relationship of Tephritid fruit flies based on molecular data has been reported by several researchers and there exist some arguments for a long period. The relationship between subgenus Zegodacus and other subgenus of Bactrocera is questionable. White suggested that subgenera Zeugodacus should split from Bactrocera to combine with Dacus genus to form a new genus—Zeugodacus from morphological evidence[8]. Latter, a lot of studies support the view from molecular level. Segura et al. reported the phylogenetic relationships among 23 tephritid species using the utilizing sequence of CYTB, tRNA and ND1 genes. The result indicated Bactrocera cucurbitae is close to genus Dacus rather than other subgenus of Bactrocera [9]. Krosch et al. rebuilt the phylogenetic tree of 125 species based on 16S rRNA, COI, COII and white eye genes to figure out the Tribe Dacini relationship and similarly the tree showed that Zeugodacus is the sister group to Dacus not Bactrocera. They suggested Zeugodacus should raise up to genus level[10]. Virgilio et al. also came to the result through the phylogenetic tree using two datasets. Dataset 1 was an alignment of 2,338 bp consisted of COI, 16S rRNA, tRNA , ND6 and period included 98 vouchers and dataset 2 was an alignment of 1,200 bp consisted of COI and 16 S rRNA included 159 vouchers[11]. In this study, we confirmed that subgenera Zeugodacus are closer to genus Dacus but distinct from other subgenera (Bactrocera, Daculus and Tetradacus) of Bactrocera genus from mitochondrial genome data level. Han and Ro reconstructed the phylogeny of the family Tephritidae by mitochondrial 12 S, 16 S, and COII gene fragments using 79 tephritid species. Phylogenetic trees suggested that Dacini and Ceratitidini are sister group which both of them belong to Dacinae and have distance to Anastrepha which belong to Toxotrypanini[12]. While Krosch et al. found Anastrepha ludens which belongs to Trypetinae subfamily was closer to Dacini (Dacinae subfamily) than to C. capitata based on 16S rRNA, COI, COII and white eye genes[10]. Fernández et al. constructed the phylogenetic tree using the neighbour-joining method based on COII gene representing six genera (Ceratitis, Rhagoletis, Dacus, Bactrocera, Anastrepha and Toxotrypan) of the family. The result also showed that Anastrepha and Bactrocera cluster in one branch while Ceratitis formed another branch individually[13]. Nakahara and Murajiuse used a 1.3 kb portion of mitochondrial DNA containing the tRNA and flanking COI and COII regions for phylogenetic analyses. The result also shows that Dacini seems more closely related to Anastrepha than to the Ceratitidini[14]. Our research also drew the same conclusion that Anastrepha fraterculus is closer to Dacini rather than to C. capitata using the published mitochondrial genome data (5 of 6 datasets posterior probabilities are 1.00 and ML bootstraps are 100 for Bayesian and ML analyses separately) which implicates that we should reconsider the phylogenetic relationships between Dacinae and Trypetinae according to the molecular evidence. There is also an argument about the phylogenetic status of the genus Neoceratitis, most of which are sequenced by four mitochondrial and one nuclear gene fragment (COI, 16 S, tRNA , ND6, period). Barr and McPheron investigated phylogenetic relationships within Ceratitidina and showed that Neoceratitis might be sister taxa to Ceratitis along with Carpophthoromyia and Capparimyia [15]. Based on the gene fragments (COI, 16S, tRNA , ND6, period), the study of  Virgilio et al. strongly supported that the genera Ceratitis and Neoceratitis were sister taxa using Bayesian approach and maximum likelihood (ML) (Bayesian PP = 1.00, ML bootstrap support = 91)[11]. So far, various studies, all of which expounding with the sample Neoceratitis cyanescens, have shown the close relationship between the two genera, Ceratitis and Neoceratitis [9]. Based on the previous studies mentioned above, the phylogenetic position between the genera Ceratitis and Neoceratitis was not well resolved. Thus we expected that the complete mitochondrial genome sequence of N. asiatica could make some contributions towards the phylogeny reconstruction of subtribe Ceratitidina. In this study, the Bayesian and ML reconstructions place the two genera Ceratitis (C. capitata) and Neoceratitis (N. asiatica) together, which means they may be sister taxa. Limited to the data of complete mitochondrial genome in different Tephritidae species, exploring the relationship between the two genera Ceratitis and Neoceratitis still needs more researches.

Materials and Methods

Sample collection and DNA extraction

The N. asiatica samples were collected in Ningxia province, China and preserved in 100% ethanol. They were identified based on morphological characteristics. Genomic DNA was extracted from individual N. asiatica adult using the DNeasy DNA Extraction kit (QIAGEN).

Mitogenome sequencing and annotation

Genomic DNA library preparation and sequencing were carried out by Berry Genomics sequencing company (Beijing, China). Genomic DNA was fragmented with Bioruptor to an average insert size of 250 bp and sequenced on Illumina Hiseq 2500. Part of cox1 gene was sequenced as the “anchor” to reconstruct the mitochondrial genome of N. asiatica using a general insect primer pairLCO1490/HCO2198[16]. We picked up the mitochondrial genome sequence with “map to reference” strategy and mapped all cleaned NGS reads to the “anchor” by Geneious R10.0[17]. The parameters we set for assembly were: 1) minimum overlap identity 95%, 2) minimum overlap 50 bp, 3) maximum 5% gaps per read, and 4) maximum gap size 20 bp. Thirteen protein-coding genes and two rRNA genes were identified by BLAST searches in NCBI (http://www.ncbi.nlm.nih.gov/) and then confirmed by alignment with homologous genes from other 22 Tephritid species available in GenBank. The tRNA genes were identified using the tRNAscan-SE[18] and MITOS WebServer[19]. The circular map of N. asiatica complete mitochondrial genome was generated and annotated using Geneious. The start/stop codon usages were analysed by DNAMAN 8.0. The composition of skew was calculated manually based on the formula: AT skew = (A − T)/(A + T) and GC skew = (G − C)/(G + C)[20]. The sequin file was edited and submitted to NCBI (NCBI GenBank accession number MF434829).

Phylogenetic analysis

A total of 25species of Diptera species were used in phylogenetic analysis, including 23Tephritidae and 2 outgroups species from Drosophilidae. Six datasets were used to build phylogenetic trees: 1) PCG123: 13 protein-coding genes (all three codon positions included); 2) PCG123 + rRNA: 13 protein-coding genes and 2 rRNA genes; 3) PCG123 + rRNA + tRNA: 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes; 4) PCG12: 13 protein-coding genes (first two codon positions included) with; 5) PCG12 + rRNA: 13 protein-coding genes and 2 rRNA genes; 6) PCG12 + rRNA + tRNA: 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes. MrBayes v.3.2.5[21] and a PHYML[22] online web server were used to analyze the six datasets under GTR + I + G model. The model was selected using Jmodeltest 2.1.7[23]. In Bayesian analysis, two simultaneous runs of 1,000,000 generations were conducted for the matrix. Each one was sampled every 200 generations with a burn-in of 25%. Trees inferred prior to stationarity were discarded as burn-in, and the remaining were used to construct a 50% majority rule consensus tree. The ML analysis was conducted with 1,000 bootstraps. Phylogenetic trees were viewed and edited by FigTree v.1.4.3[24]. Sequences were aligned using ClustalW with the default parameters implemented in MEGA 5.0[25]. The ambiguous positions in the genes alignment were filtered with Gblocks v0.91b[26]. The aligned sequences of each gene were concatenated using SequenceMatrix v1.7[27]. Supplementary Information
  19 in total

1.  Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis.

Authors:  J Castresana
Journal:  Mol Biol Evol       Date:  2000-04       Impact factor: 16.240

2.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

3.  jModelTest: phylogenetic model averaging.

Authors:  David Posada
Journal:  Mol Biol Evol       Date:  2008-04-08       Impact factor: 16.240

4.  [Risk assessment and control strategies of pests in Lycium barbarum fields under different managements].

Authors:  Zi-Hua Zhao; Rong Zhang; Da-Han He; Fang Wang; Ting-Ting Zhang; Zong-Shan Zhang
Journal:  Ying Yong Sheng Tai Xue Bao       Date:  2009-04

5.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

6.  tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.

Authors:  T M Lowe; S R Eddy
Journal:  Nucleic Acids Res       Date:  1997-03-01       Impact factor: 16.971

7.  Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes.

Authors:  N T Perna; T D Kocher
Journal:  J Mol Evol       Date:  1995-09       Impact factor: 2.395

8.  MITOS: improved de novo metazoan mitochondrial genome annotation.

Authors:  Matthias Bernt; Alexander Donath; Frank Jühling; Fabian Externbrink; Catherine Florentz; Guido Fritzsch; Joern Pütz; Martin Middendorf; Peter F Stadler
Journal:  Mol Phylogenet Evol       Date:  2012-09-07       Impact factor: 4.286

9.  DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

Authors:  O Folmer; M Black; W Hoeh; R Lutz; R Vrijenhoek
Journal:  Mol Mar Biol Biotechnol       Date:  1994-10

10.  Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.

Authors:  Matthew Kearse; Richard Moir; Amy Wilson; Steven Stones-Havas; Matthew Cheung; Shane Sturrock; Simon Buxton; Alex Cooper; Sidney Markowitz; Chris Duran; Tobias Thierer; Bruce Ashton; Peter Meintjes; Alexei Drummond
Journal:  Bioinformatics       Date:  2012-04-27       Impact factor: 6.937

View more
  1 in total

1.  Τhe Complete Mitochondrial Genome of Bactrocera carambolae (Diptera: Tephritidae): Genome Description and Phylogenetic Implications.

Authors:  Elena Drosopoulou; Alexandros Syllas; Panagiota Goutakoli; Georgios-Alkis Zisiadis; Theodora Konstantinou; Dimitra Pangea; George Sentis; Alies van Sauers-Muller; Suk-Ling Wee; Antonios A Augustinos; Antigone Zacharopoulou; Kostas Bourtzis
Journal:  Insects       Date:  2019-11-28       Impact factor: 2.769

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.