Literature DB >> 29187793

A new species of Phrynopus (Amphibia, Anura, Craugastoridae) from upper montane forests and high Andean grasslands of the Pui Pui Protected Forest in central Peru.

Edgar Lehr1, Rudolf von May2,3, Jiří Moravec4, Juan Carlos Cusi5.   

Abstract

We describe a new species of Phrynopus from the upper montane forests and high Andean grasslands (puna) of the Pui Pui Protected Forest and its close surroundings (Región Junín, central Peru) and compare it morphologically and genetically with other species of Phrynopus. Phrynopus intisp. n. is known from four localities outside and two localities inside the Pui Pui Protected Forest between 3350 and 3890 m a.s.l. Studied specimens of the new species are characterized by a snout-vent length of 27.2-35.2 mm in males (n = 6), and 40.4 mm in a single female, by having the skin on dorsum and flanks smooth with scattered tubercles, venter smooth, by lacking a tympanum, and males without vocal slits and nuptial pads. In life, the dorsum is pale grayish brown with or without dark brown blotches, or dorsum blackish brown with small yellow flecks, throat, chest and venter are pale grayish brown with salmon mottling, groin is pale grayish brown with salmon colored flecks, and the iris is golden orange with fine dark brown reticulations. The new species is morphologically most similar to Phrynopus kauneorum and P. juninensis. For the latter we describe the coloration in life for a specimen obtained at the type locality. A molecular phylogenetic analysis based on mitochondrial and nuclear DNA sequences inferred that the new species is most closely related to Phrynopus kauneorum, P. miroslawae, P. tautzorum, and an undescribed species distributed at high elevation in Región Pasco, central Peru.

Entities:  

Keywords:  Andes; DNA barcoding; Phrynopus inti; bosque montano; códigos de barras de ADN; especie nueva; filogenia molecular; frogs; molecular phylogeny; montane forest; new species; puna; ranas

Year:  2017        PMID: 29187793      PMCID: PMC5704321          DOI: 10.3897/zookeys.713.20776

Source DB:  PubMed          Journal:  Zookeys        ISSN: 1313-2970            Impact factor:   1.546


Introduction

The Pui Pui Protected Forest (Bosque de Protección Pui Pui, hereafter PPPF; Figs 1, 2) is located in the Selva Central of Peru and covers 60,000 hectares (30% montane forest, 70% puna habitats) between 1700 and 4500 m a.s.l. (SERNANP 2010). We surveyed the herpetofauna of the PPPF in upper montane forests and high Andean grasslands (puna) between 2012 and 2013 in order to document the amphibian and reptile species richness and to evaluate their conservation status. Among the new amphibians were five new species of ( Hedges, Duellman, and Heinicke, 2008) ( Lehr & Moravec, 2017; Lehr & von May, 2017; Lehr, von May, Moravec, & Cusi, 2017; Lehr, von May, Moravec, & Cusi, 2017; and Lehr, von May, Moravec, & Cusi, 2017) and a new species of Peters, 1873. A phylogenetic analysis allowed us to examine the relationships among species of , including the new species, and to justify our generic assignment. currently contains 34 species (AmphibiaWeb 2017) distributed PageBreakin montane forests and puna habitats between 2600 and 4490 m a.s.l. in northern and central Peru (Rodríguez and Catenazzi 2017, Duellman and Lehr 2009). Herein we name and describe this new species of , supported by morphological and phylogenetic evidence, from upper montane forests and puna habitats.
Figure 1.

Map of Peru with the Pui Pui Protected Forest indicated in red. Map by J.C. Cusi.

Figure 2.

Pui Pui Protected Forest indicated in red outline with collecting sites (1–6) of sp. n., star indicating type locality, and the estimated distributional area of 101.3 km2 in blue. 1 = Toldopampa valley, 3670 m a.s.l., 2 = Satipo-Toldopampa Road at km 134, 3350 m a.s.l., 3 = Quebrada Tasta, 3609 m a.s.l., 4 = forest patch near trail from Tasta to Tarhuish, 3886 m a.s.l., 5 = Antuyo, 3700 m a.s.l., 6 = close to Laguna Sinchon, 3890 m a.s.l. Map by J.C. Cusi.

Map of Peru with the Pui Pui Protected Forest indicated in red. Map by J.C. Cusi.

Materials and methods

Fieldwork. The puna of the PPPF was reached by walking 1.5 days along a trail from Toldopama (, 3670 m a.s.l., two hours by car from Satipo) to Tarhuish (, 3783 m a.s.l.; Fig. 2) with the help of local guides. Fieldwork was conducted in puna and upper montane forests in 2012 between May 8 and 21 by EL and RvM, and in 2013 between June 21 and July 8 by EL, JM, and JCC. Collected specimens were preserved in 96% ethanol and stored in 70% ethanol. Pui Pui Protected Forest indicated in red outline with collecting sites (1–6) of sp. n., star indicating type locality, and the estimated distributional area of 101.3 km2 in blue. 1 = Toldopampa valley, 3670 m a.s.l., 2 = Satipo-Toldopampa Road at km 134, 3350 m a.s.l., 3 = Quebrada Tasta, 3609 m a.s.l., 4 = forest patch near trail from Tasta to Tarhuish, 3886 m a.s.l., 5 = Antuyo, 3700 m a.s.l., 6 = close to Laguna Sinchon, 3890 m a.s.l. Map by J.C. Cusi. Morphological characters. The format for the description follows Lynch and Duellman (1997), except that the term dentigerous processes of vomers is used instead of vomerine odontophores (Duellman et al. 2006), and diagnostic characters are those of Duellman and Lehr (2009). Taxonomic classification follows Hedges et al. (2008), except that we followed Pyron and Wiens (2011) for family placement. Sex and maturity of specimens were identified by observing gonads through dissections. The senior author measured the following variables to the nearest 0.1 mm with digital calipers under a stereomicroscope: snout-vent length (SVL), tibia length (TL, distance from the knee to the distal end of the tibia), foot length (FL, distance from proximal margin of inner metatarsal tubercle to tip of Toe IV), head length (HL, from angle of jaw to tip of snout), head width (HW, at level of angle of jaw), horizontal eye diameter (ED), interorbital distance (IOD), upper eyelid width (EW), internarial distance (IND), eye-nostril distance (E-N, straight line distance between anterior corner of orbit and posterior margin of external nares), and egg diameter. Fingers and toes are numbered preaxially to postaxially from I–IV and I–V, respectively. We compared the lengths of toes III and V by adpressing both toes against Toe IV; lengths of fingers I and II were compared by adpressing these fingers against each other. All drawings were made using a stereomicroscope and a camera lucida. Photographs of live specimens were used for descriptions of coloration in life and for evaluation of morphological characters that might have been impacted by the preservation process. Information on species for comparative diagnoses was obtained from Duellman and Lehr (2009) and from original species descriptions. For specimens examined see Appendix I. Codes of collections are: – Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru; – National Museum, Prague, Czech Republic; – University of Michigan Museum of Zoology, Ann Arbor, USA. Field number code is: – Illinois Wesleyan University, Bloomington, USA. Threat status was evaluated using the IUCN criteria (IUCN Standards an Petitions Subcommittee 2016). Maps. Maps were made with ArcGIS 10.0 (ESRI 2011). The estimated area was calculated by a minimum convex polygon using known sites of occurrence of the species as defined by IUCN (2012). Molecular phylogenetic analysis. Our analysis included DNA sequence data from species that were available in GenBank (as of 1 August 2017; Table 1) as well as sequences from other closely related genera (, ) and more distantly related ones (, , and ) as outgroups PageBreakfollowing the results of Padial et al. (2014). Newly produced sequences include those obtained from seven specimens of the new species and one specimen of collected near Hacienda Cascas, Junín, the type locality of this species (Table 1). Our analysis also included sequences from three mitochondrial and two nuclear genes for several species of included in a recent study (De la Riva et al. 2017). The mitochondrial genes were a section of the 16S rRNA gene, a section of the 12S rRNA gene, and the protein-coding gene cytochrome c oxidase subunit I (COI). The nuclear genes were the recombination-activating protein 1 (RAG1) and Tyrosinase precursor (Tyr).
Table 1.

GenBank accession numbers for the taxa and genes sampled in this study. Bold font indicates new sequences generated for this study. Taxonomy follows Padial et al. (2014).

Taxon16S12SCOIRAG1TyrVoucher_Nbr
Hypodactylus brunneus EF493357EF493357naEF493422EF493484KU178258
Hypodactylus dolops EF493394EF493394naEF493414EF493483na
Ischnocnema guentheri EF493533EF493533naEF493407EF493510na
Lynchius flavomaculatus EU186667EU186667naEU186745EU186766KU218210
Lynchius nebulanastes EU186704EU186704nananaKU181408
Lynchius oblitus AM039639AM039707nananaMTD45954
Lynchius oblitus AM039640AM039708nananaMHSNM19914
Lynchius parkeri EU186705EU186705nananaKU181307
Lynchius simmonsi JF810004JF809940naJF809915JF809894QZ41639
Oreobates amarakaeri JF809996JF809934naJF809913JF809891MHNC6975
Oreobates ayacucho JF809970JF809933naJF809912JF809890MNCN_IDlR5024
Oreobates cruralis EU186666EU186666naEU186743EU186764KU215462
Oreobates gemcare JF809960JF809930naJF809909naMHNC6687
Oreobates granulosus EU368897JF809929naJF809908JF809887MHNC3396
Phrynopus auriculatus EF493708EF493708nananaKU291634
Phrynopus auriculatus MF186348MF186290MF186466naMF186582MUBI 6471
Phrynopus barthlenae AM039653AM039721nananaSMF81720
Phrynopus barthlenae MF186350MF186292MF186464nanaMHNSM20609
Phrynopus bracki EF493709EF493709naEF493421naUSNM286919
Phrynopus bufoides AM039645AM039713nananaMHNSM19860
Phrynopus heimorum AM039635AM039703MF186462MF186545MF186580MTD45621
Phrynopus heimorum AM039636AM039704nananaMTD45622
Phrynopus horstpauli AM039647AM039715nananaMTD44334
Phrynopus horstpauli AM039651AM039719nananaMTD44333
Phrynopus horstpauli MF186364MF186303nanaMF186584MTD44335
Phrynopus inti sp. n. MF651901 nana MF651916 naMUSM31203
Phrynopus inti sp. n. MF651902 MF651909 na MF651917 naMUSM31968
Phrynopus inti sp. n. MF651903 MF651910 nananaMUSM31976
Phrynopus inti sp. n. MF651904 MF651911 nananaMUSM31984
Phrynopus inti sp. n. MF651905 MF651912 nananaNMP6V75584
Phrynopus inti sp. n. MF651906 MF651913 na MF651918 MF651921 UMMZ_245218
Phrynopus inti sp. n. MF651907 MF651914 na MF651919 naUMMZ_245219
Phrynopus juninensis MF651908 MF651915 na MF651920 naMUSM33258
Phrynopus kauneorum AM039650AM039718nananaMTD44332
Phrynopus kauneorum AM039655AM039723nananaMHNSM20595
Phrynopus miroslawae MF186393MF186312MF186463MF186542MF186585MUBI 6469
Phrynopus nicoleae MF186394MF186313MF186468MF186546MF186577MUBI 6441
Phrynopus pesantesi AM039656AM039724nananaMTD45072
Phrynopus sp.AM039657AM039725nananaMTD45075
Phrynopus sp.AM039660AM039728nananaMTD44759
Phrynopus tautzorum AM039652AM039720nananaMHNSM20613
Phrynopus tribulosus EU186725EU186707nananaKU291630
Phrynopus tribulosus MF186423MF186329MF186469naMF186578MUBI 6451
Phrynopus tribulosus MF186424MF186330MF186467MF186547MF186579MUBI 7166
GenBank accession numbers for the taxa and genes sampled in this study. Bold font indicates new sequences generated for this study. Taxonomy follows Padial et al. (2014). Extraction, amplification, and sequencing of DNA followed protocols previously used for Neotropical terrestrial breeding frogs (Lehr et al. 2005, Hedges et al. 2008). Primers used are listed in Appendix II. We employed the following thermocycling conditions to amplify DNA from each gene using the polymerase chain reaction (PCR). For 16S, we used: 1 cycle of 96 °C/3 min; 35 cycles of 95 °C/30 s, 55 °C/45 PageBreakPageBreaks, 72°C/1.5 min; 1 cycle 72°C/7 min. For 12S, we used: 1 cycle of 94°C/1.5 min; 35 cycles of 94°C/45 s, 50°C/1 min., 74°C/2 min; 1 cycle 72°C/10 min. For RAG1, we used: 1 cycle of 96°C/2 min; 40 cycles of 94°C/30 s, 52°C/30 s, 72°C/1.5 min; 1 cycle 72°C/7 min. For Tyr, we used: 1 cycle of 94°C/5 min; 40 cycles of 94°C/30 s, 54°C/30 s, 72°C/1 min; 1 cycle 72°C/7 min. We completed the cycle sequencing reactions by using the corresponding PCR primers and the BigDye Terminator 3.1 (Applied Biosystems), and obtained sequence data by running the purified reaction products in an ABI 3730 Sequence Analyzer (Applied Biosystems). We deposited the newly obtained sequences in GenBank (Table 1). We used Geneious R6, version 6.1.8 (Biomatters 2013; http://www.geneious.com/) to align the sequences with the built-in multiple alignment program. Prior to conducting phylogenetic analysis, we used PartitionFinder, version 1.1.1 (Lanfear et al. 2012) to select the appropriate models of nucleotide evolution and used the Bayesian information criterion (BIC) to determine the best partitioning scheme and substitution model for each gene. The best partitioning scheme included five subsets (BIC value: 27719.16). The first partition subset included both the 12S and 16S sequences and the best fitting substitution model was GTR+I+G. The remaining four subsets were partitioned according to codon positions as follows (substitution model in parenthesis): one set including the 1st codon position of COI and the 3rd codon position of both RAG1 and Tyr (K80+G); one set with only the 2nd codon position of COI (HKY); one set with only the 3rd codon position of COI (HKY); one set including the 1st and 2nd codon position of RAG1 and the 1st and 2nd codon position of Tyr (HKY+I). We employed a Bayesian approach using MrBayes, version 3.2.0 (Ronquist and Huelsenbeck 2003) to infer a molecular phylogeny. Our analysis included 44 terminals and a 2684-bp concatenated partitioned dataset. We performed an MCMC Bayesian analysis that consisted of two simultaneous runs of 8 million generations, and we set the sampling rate to be once every 1000 generations. Each run had three heated chains and one “cold” chain, and the burn-in was set to discard the first 25% samples from the cold chain. At the end of the run, the average standard deviation of split frequencies was 0.002257. Following the completion of the analysis, we used Tracer 1.6 (Rambaut and Drummond 2003) to verify convergence. Subsequently, we used FigTree (http://tree.bio.ed.ac.uk/software/figtree/) to visualize the majority-rule consensus tree and the posterior probability values to assess node support. Additionally, we used the R package ‘APE’ (Paradis et al. 2004) to estimate uncorrected p-distances (i.e., the proportion of nucleotide sites at which any two sequences are different).

Results

Molecular phylogenetic analysis. Placement of the new species in the genus was strongly supported by this analysis. We recovered a well-supported tree (Figure 3) that was generally congruent with previous trees (Padial et al. 2014) and supPageBreakported the unique history of divergence of the new species from other closely related taxa including Lehr, Aguilar, & Köhler, 2002a, Chaparro, Padial, & De la Riva, 2008, Lehr & Aguilar, 2002, and an undescribed species. Based on the available data, the new species is most closely related to an undescribed species of distributed at high elevation (3600–3850 m a.s.l., Lehr et al. 2005) in Región Pasco. This newly identified cryptic species was previously recognized as Shreve, 1938 given their similar morphology and coloration (Lehr et al. 2005, Padial et al. 2014) and will be formally named and described in a future paper. The uncorrected p-distances between the new species and all other species of ranged between 4.5 and 14.1% (Table 2). The shortest distance occurs between the new species and the undescribed species (uncorrected p-distance 1.5–2.8%) while the uncorrected p-distances between and the new species vary between 3.7 to 4.8% (Table 2). Our analysis also suggests that Chaparro, Padial, & De la Riva, 2008 and Duellman & Hedges, 2008 might represent one species.
Figure 3.

Bayesian maximum clade-credibility tree for species included in this study based on a 2684-bp concatenated partitioned dataset (16S, 12S, COI, RAG1, Tyr) analyzed in MrBayes (posterior probabilities are indicated at each node).

Table 2.

Uncorrected p-distances of the 16S mitochondrial rRNA gene for 30 specimens of , including the new species.

1 2 3 4 5 6 7
1 Phrynopus auriculatus KU2916340.000
2 Phrynopus auriculatus MUBI 64710.0020.000
3 Phrynopus barthlenae MHNSM206090.1380.1350.000
4 Phrynopus barthlenae SMF817200.1180.1150.0000.000
5 Phrynopus horstpauli MTD443330.1140.1120.0400.0390.000
6 Phrynopus horstpauli MTD443340.1140.1120.0400.0390.0000.000
7 Phrynopus horstpauli MTD443350.1150.1120.0400.0390.0000.0000.000
8 Phrynopus pesantesi MTD450720.1050.1030.0400.0370.0350.0350.035
9 Phrynopus bufoides MHNSM198600.1210.1190.0730.0640.0600.0600.060
10 Phrynopus tautzorum MHNSM206130.1190.1160.0770.0700.0660.0660.066
11 Phrynopus miroslawae MUBI 64690.1320.1300.0840.0720.0740.0740.074
12 Phrynopus inti MUSM31203 0.1250.1230.0800.0700.0720.0720.073
13 Phrynopus intiUMMZ 245218 0.1250.1230.0800.0700.0720.0720.073
14 Phrynopus intiUMMZ 245219 0.1250.1230.0800.0700.0720.0720.073
15 Phrynopus inti MUSM31968 0.1250.1230.0800.0700.0720.0720.073
16 Phrynopus inti NMP6V75584 0.1280.1260.0820.0720.0750.0750.075
17 Phrynopus inti MUSM31976 0.1230.1210.0700.0640.0680.0680.069
18 Phrynopus inti MUSM31984 0.1310.1280.0700.0640.0660.0660.067
19 Phrynopus sp. MTD450750.1140.1120.0690.0620.0560.0560.056
20 Phrynopus sp. MTD447590.1190.1170.0640.0590.0530.0530.053
21 Phrynopus kauneorum MHNSM205950.1280.1250.0880.0790.0810.0810.082
22 Phrynopus kauneorum MTD443320.1280.1250.0880.0790.0810.0810.082
23 Phrynopus bracki USNM2869190.1100.1080.0820.0740.0740.0740.075
24 Phrynopus juninensis MUSM332580.1410.1380.1260.1090.1140.1140.115
25 Phrynopus heimorum MTD456210.1460.1430.1370.1240.1240.1240.125
26 Phrynopus heimorum MTD456220.1460.1430.1370.1240.1240.1240.125
27 Phrynopus nicoleae MUBI 64410.1370.1350.1240.1080.1110.1110.112
28 Phrynopus tribulosus KU2916300.1370.1340.1240.1080.1110.1110.112
29 Phrynopus tribulosus MUBI 64510.1360.1340.1240.1100.1100.1100.111
30 Phrynopus tribulosus MUBI 71660.1360.1340.1240.1100.1100.1100.111
8 9 10 11 12 13 14
1 Phrynopus auriculatus KU291634
2 Phrynopus auriculatus MUBI 6471
3 Phrynopus barthlenae MHNSM20609
4 Phrynopus barthlenae SMF81720
5 Phrynopus horstpauli MTD44333
6 Phrynopus horstpauli MTD44334
7 Phrynopus horstpauli MTD44335
8 Phrynopus pesantesi MTD450720.000
9 Phrynopus bufoides MHNSM198600.0510.000
10 Phrynopus tautzorum MHNSM206130.0580.0640.000
11 Phrynopus miroslawae MUBI 64690.0680.0820.0490.000
12 Phrynopus inti MUSM31203 0.0540.0630.0660.0680.000
13 Phrynopus intiUMMZ 245218 0.0540.0630.0660.0680.0000.000
14 Phrynopus intiUMMZ 245219 0.0540.0630.0660.0680.0000.0000.000
15 Phrynopus inti MUSM31968 0.0540.0630.0660.0680.0000.0000.000
16 Phrynopus inti NMP6V75584 0.0540.0630.0700.0720.0000.0000.000
17 Phrynopus inti MUSM31976 0.0480.0540.0620.0640.0170.0170.017
18 Phrynopus inti MUSM31984 0.0490.0540.0670.0730.0230.0230.023
19 Phrynopus sp. MTD450750.0390.0510.0490.0620.0230.0230.023
20 Phrynopus sp. MTD447590.0420.0550.0530.0650.0280.0280.028
21 Phrynopus kauneorum MHNSM205950.0520.0700.0690.0770.0450.0450.045
22 Phrynopus kauneorum MTD443320.0520.0700.0690.0770.0450.0450.045
23 Phrynopus bracki USNM2869190.0680.0690.0810.0750.0810.0810.081
24 Phrynopus juninensis MUSM332580.1090.1140.1170.1140.1180.1180.118
25 Phrynopus heimorum MTD456210.1340.1470.1360.1420.1330.1330.133
26 Phrynopus heimorum MTD456220.1340.1470.1360.1420.1330.1330.133
27 Phrynopus nicoleae MUBI 64410.1140.1200.1360.1430.1280.1280.128
28 Phrynopus tribulosus KU2916300.1140.1200.1360.1430.1280.1280.128
29 Phrynopus tribulosus MUBI 64510.1130.1200.1360.1400.1290.1290.129
30 Phrynopus tribulosus MUBI 71660.1130.1200.1360.1400.1290.1290.129
15 16 17 18 19 20 21
1 Phrynopus auriculatus KU291634
2 Phrynopus auriculatus MUBI 6471
3 Phrynopus barthlenae MHNSM20609
4 Phrynopus barthlenae SMF81720
5 Phrynopus horstpauli MTD44333
6 Phrynopus horstpauli MTD44334
7 Phrynopus horstpauli MTD44335
8 Phrynopus pesantesi MTD45072
9 Phrynopus bufoides MHNSM19860
10 Phrynopus tautzorum MHNSM20613
11 Phrynopus miroslawae MUBI 6469
12 Phrynopus inti MUSM31203
13 Phrynopus intiUMMZ 245218
14 Phrynopus intiUMMZ 245219
15 Phrynopus inti MUSM31968 0.000
16 Phrynopus inti NMP6V75584 0.0000.000
17 Phrynopus inti MUSM31976 0.0170.0180.000
18 Phrynopus inti MUSM31984 0.0230.0230.0080.000
19 Phrynopus sp. MTD450750.0230.0240.0150.0160.000
20 Phrynopus sp. MTD447590.0280.0290.0220.0170.0080.000
21 Phrynopus kauneorum MHNSM205950.0450.0480.0370.0400.0430.0490.000
22 Phrynopus kauneorum MTD443320.0450.0480.0370.0400.0430.0490.000
23 Phrynopus bracki USNM2869190.0810.0840.0790.0830.0730.0770.086
24 Phrynopus juninensis MUSM332580.1180.1190.1130.1160.1150.1160.113
25 Phrynopus heimorum MTD456210.1330.1370.1410.1410.1330.1350.146
26 Phrynopus heimorum MTD456220.1330.1370.1410.1410.1330.1350.146
27 Phrynopus nicoleae MUBI 64410.1280.1280.1300.1250.1230.1190.133
28 Phrynopus tribulosus KU2916300.1280.1280.1300.1250.1230.1190.133
29 Phrynopus tribulosus MUBI 64510.1290.1290.1320.1260.1240.1200.135
30 Phrynopus tribulosus MUBI 71660.1290.1290.1320.1260.1240.1200.135
22 23 24 25 26 27 28
1 Phrynopus auriculatus KU291634
2 Phrynopus auriculatus MUBI 6471
3 Phrynopus barthlenae MHNSM20609
4 Phrynopus barthlenae SMF81720
5 Phrynopus horstpauli MTD44333
6 Phrynopus horstpauli MTD44334
7 Phrynopus horstpauli MTD44335
8 Phrynopus pesantesi MTD45072
9 Phrynopus bufoides MHNSM19860
10 Phrynopus tautzorum MHNSM20613
11 Phrynopus miroslawae MUBI 6469
12 Phrynopus inti MUSM31203
13 Phrynopus intiUMMZ 245218
14 Phrynopus intiUMMZ 245219
15 Phrynopus inti MUSM31968
16 Phrynopus inti NMP6V75584
17 Phrynopus inti MUSM31976
18 Phrynopus inti MUSM31984
19 Phrynopus sp. MTD45075
20 Phrynopus sp. MTD44759
21 Phrynopus kauneorum MHNSM20595
22 Phrynopus kauneorum MTD443320.000
23 Phrynopus bracki USNM2869190.0860.000
24 Phrynopus juninensis MUSM332580.1130.1050.000
25 Phrynopus heimorum MTD456210.1460.1180.1130.000
26 Phrynopus heimorum MTD456220.1460.1180.1130.0000.000
27 Phrynopus nicoleae MUBI 64410.1330.1110.1210.1190.1190.000
28 Phrynopus tribulosus KU2916300.1330.1110.1210.1190.1190.0000.000
29 Phrynopus tribulosus MUBI 64510.1350.1100.1230.1210.1210.0020.002
30 Phrynopus tribulosus MUBI 71660.1350.1100.1230.1210.1210.0020.002
29 30
1 Phrynopus auriculatus KU291634
2 Phrynopus auriculatus MUBI 6471
3 Phrynopus barthlenae MHNSM20609
4 Phrynopus barthlenae SMF81720
5 Phrynopus horstpauli MTD44333
6 Phrynopus horstpauli MTD44334
7 Phrynopus horstpauli MTD44335
8 Phrynopus pesantesi MTD45072
9 Phrynopus bufoides MHNSM19860
10 Phrynopus tautzorum MHNSM20613
11 Phrynopus miroslawae MUBI 6469
12 Phrynopus inti MUSM31203
13 Phrynopus intiUMMZ 245218
14 Phrynopus intiUMMZ 245219
15 Phrynopus inti MUSM31968
16 Phrynopus inti NMP6V75584
17 Phrynopus inti MUSM31976
18 Phrynopus inti MUSM31984
19 Phrynopus sp. MTD45075
20 Phrynopus sp. MTD44759
21 Phrynopus kauneorum MHNSM20595
22 Phrynopus kauneorum MTD44332
23 Phrynopus bracki USNM286919
24 Phrynopus juninensis MUSM33258
25 Phrynopus heimorum MTD45621
26 Phrynopus heimorum MTD45622
27 Phrynopus nicoleae MUBI 6441
28 Phrynopus tribulosus KU291630
29 Phrynopus tribulosus MUBI 64510.000
30 Phrynopus tribulosus MUBI 71660.0000.000
Bayesian maximum clade-credibility tree for species included in this study based on a 2684-bp concatenated partitioned dataset (16S, 12S, COI, RAG1, Tyr) analyzed in MrBayes (posterior probabilities are indicated at each node). Uncorrected p-distances of the 16S mitochondrial rRNA gene for 30 specimens of , including the new species.

sp. n.

http://zoobank.org/C3E88CD6-7AD2-4CFE-8129-A6DB6D747F70 sp. A in Lehr, von May, Moravec, & Cusi (2017)

Common name.

English: Inti Andes Frog. Spanish: Rana Andina Inti.

Holotype

(Figs 4A,B, 5, 6). MUSM 31183 (IWU 155), adult male from the buffer zone of the Pui Pui Protected Forest, Quebrada Tasta, forest patch near the house of Evaristo Bórquez Quintana, , 3609 m a.s.l. (Figs 2, 10C), Provincia Satipo, Región Junín, Peru, collected on 9 May 2012 by E. Lehr and R. von May.
Figure 4.

sp. n. (A, B holotype, MUSM 31183, male, SVL 32.5 mm), (C, D MUSM 33258, female, SVL 33.0 mm), (E, F holotype, MUSM 20459, female, SVL 29.1 mm) in dorsolateral and ventral views. Photos by E. Lehr and R. von May (C, D).

Figure 5.

Life male holotype (MUSM 31183, SVL 32.5 mm) of sp. n. in dorsolateral view (A), dorsal view (B), flanks, groin, anterior surfaces of thighs (C), and ventral view (D). Photos by E. Lehr.

Figure 6.

Ventral views of right hand (A) and right foot (B) of holotype of sp. n. (MUSM 31183). Drawings by E. Lehr.

Figure 10.

Type locality and habitats of sp. n. Satipo-Toldopampa Road at km 134 on left side of street coming from Satipo, 3350 m a.s.l., 23 June 2013 (A); Quebrada Toldopampa, 3670 m a.s.l., 22 June 2013 (B); Type locality, Quebrada Tasta, 3609 m a.s.l., 20 May 2012 (C); Antuyo, PPPF, 3700 m a.s.l., 27 June 2013 (D); Laguna Sinchon, PPPF, 3890 m a.s.l., 29 June 2013 (E). Photos by E. Lehr.

Paratypes

(Figs 7, 8, 9). A total of 15, all from Provincia Satipo, Región Junín, Peru (for detailed information see below): 5 males (MUSM 31976, 31984, 31203, NMP6V 75584, UMMZ 245220), 1 female (MUSM 31968), 9 juveniles (MUSM 31184, 31969, 31974, 31985, NMP6V 75585–87, UMMZ 245218, 245219).
Figure 7.

Variation of male paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (UMMZ 245220, SVL 27.4 mm), D–F (MUSM 31976, SVL 35.2 mm), G–I (MSUM 31984, SVL 35.1 mm) . Photos by E. Lehr, and by J.C. Cusi (E).

Figure 8.

Female paratype of sp. n. (MUSM 31968, SVL 40.4 mm) in dorsolateral (A), dorsal (B), and ventral views (C). Photos by E. Lehr and J. Moravec (A).

Figure 9.

Variation of juvenile paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (MUSM 31969, SVL 16.0 mm), D–F (NMP6V 75587, SVL 20.3 mm). Photos by E. Lehr.

MUSM 31184, UMMZ 245218, 245219, collected with the holotype on 9 May 2012 by E. Lehr and R. von May; MUSM 31203, near trail from Tasta to Tarhuish (first cumbre), forest patch, , 3886 m a.s.l. collected on 20 May 2012 by E. Lehr and R. von May; MUSM 31968, 31969, UMMZ 245220, Toldopampa, , 3670 m a.s.l., collected on 22 June 2013 by E. Lehr, J. Moravec, and J.C. Cusi; NMP6V 75584, from Sector Carrizal, Satipo-Toldopampa Road at km 134 on left side of road coming from Satipo, , 3350 m a.s.l., collected on 23 June 2013 by E. Lehr, J.C. Cusi, and J. Moravec; MUSM 31974, 31976, NMP6V 75585, Antuyo, , 3700 m a.s.l., collected on 27 June 2013 by E. Lehr, J.C. Cusi, and J. Moravec; MUSM 31984, 31985, NMP6V 75586, 75587, Laguna Sinchon, , 3890 m, collected on 30 June 2013 by E. Lehr, J.C. Cusi, and J. Moravec.

Generic placement.

We assign this species to based on molecular evidence (Fig. 3).

Diagnosis.

A species of having the following combination of characters: (1) Skin on dorsum and flanks shagreen with scattered, low tubercles, more dense on dorsum; skin on venter smooth; discoidal fold absent, thoracic fold present; prominent supratympanic fold; dorsolateral folds absent; (2) tympanic membrane and tympanic annulus absent; (3) snout rounded in dorsal and lateral views; (4) upper eyelid without enlarged tubercles; width of upper eyelid narrower than IOD; cranial crests absent; (5) dentigerous processes of vomers minute or absent; (6) vocal slits and nuptial pads absent; (7) Finger I shorter than Finger II; tips of digits bulbous, rounded; (8) fingers without lateral fringes; (9) ulnar and tarsal tubercles absent; (10) heel without tubercles; inner tarsal fold absent; (11) inner metatarsal tubercle rounded, about three times as large as ovoid outer metatarsal tubercle; supernumerary plantar tubercles absent; (12) toes without lateral fringes; basal webbing absent; Toe V slightly longer than Toe III; toe tips bulbous, rounded, about as large as those on fingers; (13) in life, dorsum pale grayish brown with or without dark brown blotches or blackish brown with small yellow flecks; throat, chest and venter pale grayish brown with salmon mottling, groin pale grayish brown with salmon colored flecks; iris golden orange with fine dark brown reticulations; (14) SVL 27.2–35.2 mm in males (n = 6), and 40.4 mm in single female.

Comparisons.

sp. n. is readily distinguished from its 34 congeners in Peru (AmphibiaWeb 2017), by its relatively large SVL (except for and ) of up to 40.4 mm, by having the groin pale grayish brown with salmon PageBreakcolored flecks, the venter pale grayish brown with salmon mottling and the iris golden orange with fine dark brown reticulations. sp. n. is most similar to the large central Peruvian species (SVL up to 43.1 mm, Duellman and Lehr 2009) and (SVL up to 56.4 mm, Lehr et al. 2002b), Fig. 4. All three species share a gray ground coloration and dark brown canthal and supratympanic stripes, lack dorsolateral folds and males lack vocal slits and nuptial pads, but can be distinguished as follows: sp. n. has weak postocular folds (absent in both and ), has dentigerous processes of vomers (absent in , present in ), skin on dorsum shagreen with scattered, low tubercles (smooth to weakly areolate in , smooth in ), skin on venter smooth (areolate in , smooth in ), dorsum pale grayish brown with or without dark brown blotches or blackish brown with small yellow flecks (dorsum grayish brown with dark brown markings in , dorsum pale brown to tan with dark brown markings in ), venter pale grayish brown with salmon mottling (pale brown with gray blotches in , pinkish to grayish tan in ), and the iris is golden orange (copper in , dark brown in ). sp. n. (A, B holotype, MUSM 31183, male, SVL 32.5 mm), (C, D MUSM 33258, female, SVL 33.0 mm), (E, F holotype, MUSM 20459, female, SVL 29.1 mm) in dorsolateral and ventral views. Photos by E. Lehr and R. von May (C, D).

Description of the holotype.

Head as wide as body, wider than long, HW 110% of HL; HW 38% of SVL; HL 35% of SVL; snout short, rounded in dorsal and lateral views (Figs 5A, B), ED larger than E–N distance (ED 148% of E–N); nostrils protuberant, directed dorsolaterally; canthus rostralis slightly curved in dorsal view, rounded in profile; loreal region slightly concave; lips rounded; upper eyelid without enlarged tubercles; EW slightly narrower than IOD (EW 94% of IOD); postocular folds low, extending from posterior margin of upper eyelid to level of upper arm insertion (Fig. 5B); supratympanic fold broad, extending from posterior corner of eye to level of upper arm insertion; tympanic membrane and tympanic annulus absent, tympanic region without postrictal tubercles. Choanae small, ovoid, close to but not concealed by palatal shelf of maxilla; dentigerous processes of vomers minute, embedded in mucosa of mouth, widely separated; tongue broad, about twice as long as wide, not notched posteriorly, posterior half free; vocal slits absent. Life male holotype (MUSM 31183, SVL 32.5 mm) of sp. n. in dorsolateral view (A), dorsal view (B), flanks, groin, anterior surfaces of thighs (C), and ventral view (D). Photos by E. Lehr. Skin on dorsum shagreen with scattered, low tubercles, more dense on posterior half of body, dorsolateral folds absent (Fig. 5B); skin on flanks shagreen with few scattered, low tubercles; skin on throat, chest and belly smooth (Fig. 5D); discoidal fold absent, thoracic fold present; cloacal sheath not distinct; cloacal region without tubercles. Outer surface of forearm without tubercles; outer palmar tubercle barely visible, low, ovoid, slightly smaller than ovoid inner palmar tubercle; supernumerary tubercles absent; subarticular tubercles low, ovoid, most prominent on base of fingers; fingers without lateral fringes; Finger I shorter than Finger II; tips of digits rounded, bulbous, lacking circumferential grooves; nuptial pads absent (Fig. 6A). Ventral views of right hand (A) and right foot (B) of holotype of sp. n. (MUSM 31183). Drawings by E. Lehr. Hind limbs long and slender, TL 39% of SVL; FL 43% of SVL; dorsal surface of hind limbs shagreen with few low tubercles; anterior surfaces of thighs shagreen, posterior surfaces of thighs weakly areolate; heel without a conical tubercle; outer surface of tarsus without tubercles; outer metatarsal tubercle rounded, weakly conical, about four times as large as prominent ovoid inner metatarsal tubercle; supernumerary plantar PageBreaktubercles absent; subarticular tubercles low, ovoid in dorsal view, most distinct on base of toes; toes without lateral fringes; basal webbing absent; toe tips bulbous, rounded, lacking circumferential grooves, about as large as those on fingers; relative lengths of toes: 1 < 2 < 3 < 5 < 4; Toe V slightly longer than Toe III (Fig. 6B). Measurements of the holotype (in mm). SVL 32.5; tibia length 12.7; foot length 14.0; head length 11.3; head width 12.5; eye diameter 3.4; interorbital distance 3.5; upper eyelid width 3.3; internarial distance 2.9; eye-nostril distance 2.3. Coloration of the holotype in life (Fig. Dorsum pale grayish brown with dark brown blotches, a dark brown X-shaped marking on shoulder region and an irregular shaped dark brown interorbital blotch. Flanks paler than dorsum with few pale brown flecks. Canthal and supratympanic stripes dark brown. Upper lip with few pale brown flecks. Arms and legs dorsally with few pale and dark brown blotches and flecks. Throat, chest and venter pale grayish brown with salmon mottling, denser on posterior half of belly and thighs. Groin, posterior surfaces of thighs, posterior surfaces of tibias and dorsal surfaces of feet vibrant salmon colored. Iris golden orange with fine dark brown reticulations. Dorsum tan with dark brown blotches and dark brown X-shaped marking on shoulder region and an irregular shaped dark brown interorbital blotch. Flanks paler than dorsum, with few pale brown flecks. Canthal and supratympanic stripes dark brown. Upper lip with few pale brown flecks. Arms and legs dorsally tan with few pale and dark brown blotches and flecks. Groin creamy white. Throat, chest and venter creamy white and pale gray mottled. Ventral surfaces of hand and feet creamy white. Iris pale gray.

Variation.

All paratypes (Figs 7–9) are similar to the holotype regarding morphology and proportions (Tables 3, 4). Besides differences in SVL (Tables 3, 4), coloration variation in life is notable. Three males (MUSM 31203, UMMZ 245220 (Fig. 7A–C), PageBreak285) are similar to the holotype in coloration except for having much less salmon coloration. One male (MUSM 31976, Fig. 7D–F) has the dorsum uniformly grayish brown without dark brown blotches. One male (MUSM 31984, Fig. 7G–I) has the dorsum blackish brown with small yellow flecks. The single female (MSUM 31968, Fig. 8) is similar in coloration to the holotype except for only having few small flecks of salmon PageBreakin groin, and ventrally on thighs and shanks. The dorsal coloration of the juveniles (Fig. 9) is similar to the adults (dorsum pale grayish brown with dark brown blotches in MUSM 31969 [Fig. 9A, B], 31974, NMP6V 75585, blackish brown with small yellow flecks in NMP6V 75586, 75587 [Fig. 9D, E], uniformly blackish brown in MUSM 31985). The ventral coloration is different in juveniles. One juvenile (MSUM 31969, Fig. 9C) has the venter reddish brown, three juveniles (MUSM 31974, NMP6V 75585, 75587 (Fig. 9F)) have the venter reddish brown and tan mottled.
Table 3.

Measurements (in mm) of adult type specimens of sp. n. M = male, F = female. For other abbreviations see materials and methods.

Characters MUSM UMMZ MUSM NMP6V MUSM MUSM MUSM
312032452203118375584319843197631968
SexMMMMMMF
SVL 27.227.432.534.235.135.240.4
TL 10.39.912.714.013.314.015.7
FL 12.211.614.015.413.713.817.1
HL 9.49.911.311.411.913.013.5
HW 10.510.612.512.212.613.414.5
ED 2.42.73.43.13.43.13.5
IOD 3.02.83.53.73.03.73.5
EW 2.52.43.33.22.83.33.4
IND 2.12.52.92.72.62.93.1
E–N1.91.92.32.12.52.63.0
Table 4.

Measurements (in mm) and proportions of male type specimens of sp. n.; ranges followed by means and one standard deviation in parentheses. For abbreviations see materials and methods.

Characters Phrynopus inti sp. n.
Males (n = 6)
SVL 27.2–35.2 (31.9 ± 3.4)
TL 9.9–14.4 (12.4 ± 1.7)
FL 11.6–15.4 (13.5 ± 1.2)
HL 9.4–13.0 (11.2 ± 1.2)
HW 10.5–13.4 (12.0 ± 1.1)
ED 2.4–3.4 (3.0 ± 0.4)
IOD 2.8–3.7 (3.3 ± 0.4)
EW 2.4–3.3 (2.9 ± 0.4)
IND 2.1–2.9 (2.6 ± 0.3)
E–N1.9–2.6 (2.2 ± 0.3)
TL/SVL0.36–0.41
FL/SVL0.39–0.45
HL/SVL0.33–0.37
HW/SVL0.36–0.39
HW/HL1.00–1.10
E–N/ED0.68–0.84
EW/IOD0.83–0.94
Measurements (in mm) of adult type specimens of sp. n. M = male, F = female. For other abbreviations see materials and methods. Measurements (in mm) and proportions of male type specimens of sp. n.; ranges followed by means and one standard deviation in parentheses. For abbreviations see materials and methods. Variation of male paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (UMMZ 245220, SVL 27.4 mm), D–F (MUSM 31976, SVL 35.2 mm), G–I (MSUM 31984, SVL 35.1 mm) . Photos by E. Lehr, and by J.C. Cusi (E). Female paratype of sp. n. (MUSM 31968, SVL 40.4 mm) in dorsolateral (A), dorsal (B), and ventral views (C). Photos by E. Lehr and J. Moravec (A). Variation of juvenile paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (MUSM 31969, SVL 16.0 mm), D–F (NMP6V 75587, SVL 20.3 mm). Photos by E. Lehr.

Etymology.

The species epithet is derived from the Quechuan noun “Inti”, the Incan sun god. The golden-orange iris reminds us of the sun.

Distribution, natural history, and threat status.

sp. n. is known from four localities outside and two localities inside the Pui Pui Protected Forest between 3350 and 3890 m a.s.l., covering an estimated area of 101.3 km2 (Figs 1, 2). The type locality, Quebrada Tasta (Fig. 2), is outside the PPPF. The holotype and three paratypes (MUSM 31184, UMMZ 245218, 245219) were found in the afternoon in a forest patch under rocks near the house of Evaristo Bórquez Quintana, on 9 May PageBreakPageBreak2012 at 3609 m a.s.l. (Fig. 10C). The vegetation at the type locality consists of trees, small bushes, ferns, moss, and Peruvian feather grass. No sympatric anurans were recorded. One specimen (MUSM 31203) was found in the afternoon under moss in a forest patch near the trail from Tasta to Tarhuish at 3886 m a.s.l. Three specimens (MUSM 31968, 31969, UMMZ 245220) were collected in the morning under rocks and in moss in the mountain slopes of the Toldopampa valley close to Toldopampa PageBreakPageBreakat 3670 m a.s.l. (Fig. 10B). Specimens were found under rocks and in moss. Sympatric anurans include Shreve, 1941. One specimen (NMP6V 75584) was collected under moss in the early afternoon at the Satipo-Toldopampa Road at km 134 on the left side of the road coming from Satipo at 3350 m a.s.l. (Fig. 10A). Sympatric anurans here include (MUSM 31970, 31971) and (MUSM 31972). Three specimens (MUSM 31974, 31976, NMP6V 75585) were found under rocks and in moss in Antuyo at 3700 m a.s.l. (Fig. 10D). Sympatric anurans here include (MUSM 31975) and (IWU 290). Four specimens (MUSM 31984, 31985, NMP6V 75586, 75587) were found in the puna in the afternoon in moss close to the Laguna Sinchon at 3890 m a.s.l. (Fig. 10E). Sympatric anurans here include (MSUM 31981–83). Type locality and habitats of sp. n. Satipo-Toldopampa Road at km 134 on left side of street coming from Satipo, 3350 m a.s.l., 23 June 2013 (A); Quebrada Toldopampa, 3670 m a.s.l., 22 June 2013 (B); Type locality, Quebrada Tasta, 3609 m a.s.l., 20 May 2012 (C); Antuyo, PPPF, 3700 m a.s.l., 27 June 2013 (D); Laguna Sinchon, PPPF, 3890 m a.s.l., 29 June 2013 (E). Photos by E. Lehr. One male specimen (MUSM 31203) had as ectoparasites five trombiculid mites on the right side in the area of the upper arm insertion. Such parasites are not uncommon in Andean frogs (e.g., Quinzio and Goldberg 2015, Lehr et al. 2017). The IUCN Red List criteria (IUCN 2001) consider that if a species occurs in fewer than 10 threat-defined locations and the extent of occurrence (EOO) is < 20,000 km2, it should be classified as Vulnerable or Endangered. sp. n. is known from six localities distributed in the PPPF and its buffer zone (Fig. 10), with an estimated EOO of 101.3 km2. As such, this new species might be classified as Vulnerable if we take into account these criteria. However, given that the PPPF may host a greater number of locations (two of them are inside the protected area), we propose that sp. n. should likely be categorized as Near Threatened (NT). Despite that two locations of the known distribution of sp. n. are within the PPPF (Fig. 10) and formally protected, other factors such as fungal infections, climate change, pollution, and man-made fires (used to expand grazing areas for livestock) continue to be threats for many Andean amphibians even inside protected areas (Catenazzi and von May 2014). Agriculture and cattle raising are more acute in the Toldopampa valley than in the Tasta valley.

Discussion

With a snout-vent length of up to 40.4 mm, sp. n. represents one of the largest species of the genus. Usually, species are characterized by a small robust body, short limbs, narrow or only slightly expanded tips of toes and fingers, and absence of a tympanum. These morphological features seem to be associated with a life in moss layers and grass bunches at elevations between 2600 and 4400 m a.s.l. (Rodríguez and Catenazzi 2017, Duellman and Lehr 2009). In the PPPF, however, this niche is widely occupied by several small species (, and ), all of which exhibit a similar body form and lifestyle as most species of . In particular, two species of in the PPPF, , appear to have adapted to similar niches in upper montane forests and puna that are typically occupied by species of with small robust bodies, short limbs, and discs without circumferential groves. AdPageBreakditionally, like in most species of , both and lack a tympanum. The use of genetic characters in such cases of convergence is necessary to determine the proper generic placement and phylogenetic relationships (Lehr and von May 2017, Lehr et al. 2017). The inclusion of from its type locality in our phylogeny (Fig. 2) revealed the existence of a cryptic species ( sp.) that was previously thought to be . This new species, which is found in an area located >50 km away from the type locality of , will be described in the near future. Our phylogenetic analysis suggested that , Chaparro, Padial & De la Riva, 2008 is a junior synonym of Duellman & Hedges, 2008. The high genetic similarity between and was originally identified by De la Riva et al. (2017), who suggested a possible synonymy, but no formal taxonomic action was proposed. Additionally, new evidence suggests that one other species (not included in the tree presented here) is also genetically similar to both and (von May, unpublished). The synonymy among these three species will be discussed in more detail in an upcoming paper. De la Riva et al. (2017) pointed out an underestimated radiation of craugastorid frogs in the Eastern Andes of Peru and Bolivia and described five new species and a new genus (). Ten years earlier, De la Riva (2007) described 12 new species from Bolivia and new amphibians are discovered in similar quantities from Andean Peru. The Andes are indeed a hotspot for biodiversity (Myers et al. 2000); five of the six anuran species recorded by us in upper montane and puna habitats of the PPPF represented new species (see Lehr and von May 2017, Lehr et al. 2017 and this paper), and descriptions of other new anuran as well as reptile taxa are expected. Herpetological surveys conducted by us between 2012 and 2014 demonstrate that the PPPF houses unique amphibian assemblages associated with cloud forest and puna habitats. Therefore, the protection of the PPPF and its native flora and fauna in central Andean Peru is of great importance. The beneficial role of any protected area stands out in light of ongoing habitat loss caused by development and land use changes in neighboring areas including the buffer zone surrounding the PPPF.
Primers used in this study
LocusPrimerSequence (5’-3’)Reference
16S16SARFCGCCTGTTTATCAAAAACAT Palumbi et al. (1991)
16SBRRCCGGTCTGAACTCAGATCACGT Palumbi et al. (1991)
12SL25195FAAACTGGGATTAGATACCCCACTA Palumbi et al. 1991
H2916RGAGGGTGACGGGCGGTGTGT Palumbi et al. 1991
COIdgLCO1490FGGTCAACAAATCATAAAGAYATYGG Meyer et al. (2005)
dgHCO2198RTAAACTTCAGGGT GACCAAARAAYCA Meyer et al. (2005)
RAG1R182FGCCATAACTGCTGGAGCATYAT Heinicke et al. (2007)
R270RAGYAGATGTTGCCTGGGTCTTC Heinicke et al. (2007)
TyrTyr1CFGGCAGAGGAWCRTGCCAAGATGT Bossuyt and Milinkovitch (2000)
Tyr1GRTGCTGGGCRTCTCTCCARTCCCA Bossuyt and Milinkovitch (2000)
  12 in total

1.  Biodiversity hotspots for conservation priorities.

Authors:  N Myers; R A Mittermeier; C G Mittermeier; G A da Fonseca; J Kent
Journal:  Nature       Date:  2000-02-24       Impact factor: 49.962

2.  Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits.

Authors:  F Bossuyt; M C Milinkovitch
Journal:  Proc Natl Acad Sci U S A       Date:  2000-06-06       Impact factor: 11.205

3.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

4.  Partitionfinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses.

Authors:  Robert Lanfear; Brett Calcott; Simon Y W Ho; Stephane Guindon
Journal:  Mol Biol Evol       Date:  2012-01-20       Impact factor: 16.240

5.  Fine scale endemism on coral reefs: archipelagic differentiation in turbinid gastropods.

Authors:  Christopher P Meyer; Jonathan B Geller; Gustav Paulay
Journal:  Evolution       Date:  2005-01       Impact factor: 3.694

6.  Major Caribbean and Central American frog faunas originated by ancient oceanic dispersal.

Authors:  Matthew P Heinicke; William E Duellman; S Blair Hedges
Journal:  Proc Natl Acad Sci U S A       Date:  2007-06-04       Impact factor: 11.205

7.  A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians.

Authors:  R Alexander Pyron; John J Wiens
Journal:  Mol Phylogenet Evol       Date:  2011-06-23       Impact factor: 4.286

8.  Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria.

Authors:  José M Padial; Taran Grant; Darrel R Frost
Journal:  Zootaxa       Date:  2014-06-26       Impact factor: 1.091

9.  APE: Analyses of Phylogenetics and Evolution in R language.

Authors:  Emmanuel Paradis; Julien Claude; Korbinian Strimmer
Journal:  Bioinformatics       Date:  2004-01-22       Impact factor: 6.937

10.  A new species of Pristimantis (Amphibia, Anura, Craugastoridae) from a montane forest of the Pui Pui Protected Forest in central Peru (Región Junín).

Authors:  Edgar Lehr; Jiří Moravec
Journal:  Zookeys       Date:  2017-01-12       Impact factor: 1.546

View more
  4 in total

1.  Evolutionary radiation of earless frogs in the Andes: molecular phylogenetics and habitat shifts in high-elevation terrestrial breeding frogs.

Authors:  Rudolf von May; Edgar Lehr; Daniel L Rabosky
Journal:  PeerJ       Date:  2018-02-22       Impact factor: 2.984

2.  A new species of frog (Terrarana, Strabomantidae, Phrynopus) from the Peruvian Andean grasslands.

Authors:  Germán Chávez; Luis Alberto García Ayachi; Alessandro Catenazzi
Journal:  PeerJ       Date:  2020-06-24       Impact factor: 2.984

3.  Systematics of Neotropical microteiid lizards (Gymnophthalmidae, Cercosaurinae), with the description of a new genus and species from the Andean montane forests.

Authors:  Jiří Moravec; Jiří Šmíd; Jan Štundl; Edgar Lehr
Journal:  Zookeys       Date:  2018-07-16       Impact factor: 1.546

4.  A new species of Pristimantis (Amphibia, Anura, Strabomantidae) from the Pui Pui Protected Forest (central Peru), with comments on Pristimantis albertus Duellman & Hedges, 2007.

Authors:  Jiří Moravec; Edgar Lehr; Karel Kodejš
Journal:  Zookeys       Date:  2020-11-17       Impact factor: 1.546

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.