| Literature DB >> 29183375 |
Chan Yang1,2, Zushi Huang1, Mei Li1, Xiangyang Feng3, Xinghui Qiu4.
Abstract
BACKGROUND: Anopheles sinensis is a major vector of malaria in China. The gamma-aminobutyric acid (GABA)-gated chloride channel, encoded by the RDL (Resistant to dieldrin) gene, is the important target for insecticides of widely varied structures. The use of various insecticides in agriculture and vector control has inevitably led to the development of insecticide resistance, which may reduce the control effectiveness. Therefore, it is important to investigate the presence and distribution frequency of the resistance related mutation(s) in An. sinensis RDL to predict resistance to both the withdrawn cyclodienes (e.g. dieldrin) and currently used insecticides, such as fipronil.Entities:
Keywords: Anopheles sinensis; Gamma-aminobutyric acid gated chloride channel; Genealogical analysis; Guangxi Zhuang Autonomous Region; Haplotype
Mesh:
Substances:
Year: 2017 PMID: 29183375 PMCID: PMC5704519 DOI: 10.1186/s12936-017-2133-0
Source DB: PubMed Journal: Malar J ISSN: 1475-2875 Impact factor: 2.979
Fig. 1Schematic representation of polymorphisms in AsRDL monomer. The substitutions indicated by blue dots (R119G, I162V, I176V, I278V) are identified in a laboratory strain. The insecticide resistance-related mutations (296S, 327I, 345S) are marked by red dots. The polymorphisms indicated by orange dots are detected in field mosquitoes (M349L, R356G, K357L/M/N, F360L, Q408H, G473S)
Fig. 2Exon/intron organization of the AsRDL gene. E represents exon and dash line represents intron. The numbers above the box or below the dash line represent the length (base pair) of different parts of AsRDL gene. The intron phase is indicated using braced numbers: 0 means intron splicing between codons, 1 means intron splicing between the first and second nucleotides of a codon, and 2 means intron splicing between the second and third nucleotides of a codon
Fig. 3Alignment of amino acid sequences of RDLs from Anopheles sinensis (AsRDL), An. funestus (AEB60992) and Drosophila melanogaster (AAA28556). The asterisks (*) indicate identical amino acid, colons (:) represent conserved substitution and black dots (·) indicate weakly conserved sites. The three insecticide resistance-related residues (296, 327,345) are marked with arrows. The four transmembrane regions (TM1–4) are indicated by a straight line. The two cysteines forming the cys-loop are in box
Fig. 4The polymorphic sites (S) identified in the AsRDL gene in this study. Non-synonymous sites are indicated by red dots
Fig. 5Direct sequencing chromatograph showing three individual genotypes of the three insecticide resistance-related sites
The distribution frequency of the amino acid substitution identified in AsRDL in nine An. sinensis populations from Guangxi, China
| 296A | 296S | 327V | 327I | 345T | 345S | 349M | 349L | 356R | 356G | 357K | 357L | 357M | 357N | 360F | 360L | 408Q | 408H | 473G | 473S | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NN | 1.000 | 0.636 | 0.364 | 0.591 | 0.409 | 0.985 | 0.015 | 1.000 | 0.924 | 0.076 | 0.985 | 0.015 | 1.000 | 1.000 | ||||||
| YL | 1.000 | 0.650 | 0.350 | 0.583 | 0.417 | 0.950 | 0.050 | 1.000 | 0.967 | 0.033 | 0.983 | 0.017 | 1.000 | 0.983 | 0.017 | |||||
| HZ | 1.000 | 0.882 | 0.118 | 0.529 | 0.471 | 1.000 | 1.000 | 0.882 | 0.088 | 0.030 | 1.000 | 1.000 | 0.706 | 0.294 | ||||||
| BS | 0.182 | 0.818 | 0.795 | 0.205 | 0.648 | 0.352 | 1.000 | 1.000 | 0.966 | 0.011 | 0.023 | 0.989 | 0.011 | 0.989 | 0.011 | 1.000 | ||||
| WZ | 1.000 | 0.738 | 0.262 | 0.548 | 0.452 | 0.952 | 0.048 | 0.976 | 0.024 | 0.976 | 0.024 | 1.000 | 1.000 | 0.881 | 0.119 | |||||
| LZ | 0.229 | 0.771 | 0.917 | 0.083 | 0.625 | 0.375 | 0.979 | 0.021 | 1.000 | 1.000 | 1.000 | 1.000 | 0.792 | 0.208 | ||||||
| GL | 0.093 | 0.907 | 0.704 | 0.296 | 0.741 | 0.259 | 0.944 | 0.056 | 1.000 | 0.907 | 0.093 | 1.000 | 1.000 | 0.870 | 0.130 | |||||
| HC | 1.000 | 0.397 | 0.603 | 0.776 | 0.224 | 0.983 | 0.017 | 1.000 | 0.983 | 0.017 | 1.000 | 1.000 | 1.000 | |||||||
| GG | 1.000 | 0.733 | 0.267 | 0.700 | 0.300 | 1.000 | 1.000 | 0.933 | 0.067 | 1.000 | 1.000 | 0.833 | 0.167 |
BS Baise, HC Hechi, HZ Hezhou, GG Guigang, GL Guilin, LZ Liuzhou, NN Nanning, WZ Wuzhou, YL Yulin
Fig. 6The sampling location (a), and distribution frequencies of individual genotypes of AsRDL in Guangxi (b–d). BS Baise, HC Hechi, HZ Hezhou, GG Guigang, GL Guilin, LZ Liuzhou, NN Nanning, WZ Wuzhou, YL Yulin. n represents the sample size
Frequency (in percentage) of combinations of insecticide resistance-associated sites in AsRDL
| Residue sites | Populations | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 296 | 327 | 345 | NN | YL | HZ | BS | WZ | LZ | GL | HC | GG | |
| Combination 1 |
|
| T/T | 12.1 | 13.3 | 2.3 | 4.2 | 3.7 | 34.5 | 6.7 | ||
| Combination 2 |
|
|
| 2.3 | 3.4 | |||||||
| Combination 3 |
|
| T/ | 36.4 | 23.3 | 23.5 | 11.4 | 33.3 | 4.2 | 22.2 | 24.1 | 26.7 |
| Combination 4 |
|
| T/T | 12.1 | 20.0 | 18.2 | 19.0 | 25.9 | 24.1 | 13.3 | ||
| Combination 5 |
| V/V |
| 15.2 | 23.3 | 23.5 | 9.1 | 19.0 | 16.7 | 3.7 | 3.4 | |
| Combination 6 |
| V/V | T/ | 15.2 | 13.3 | 23.5 | 25.0 | 19.0 | 29.2 | 18.5 | 6.9 | 33.3 |
| Combination 7 |
| V/V | T/T | 9.1 | 6.7 | 29.4 | 2.3 | 9.5 | 12.5 | 7.4 | 3.4 | 20.0 |
| Combination 8 |
| I/V | T/T | 4.5 | 4.2 | 3.7 | ||||||
| Combination 9 |
| V/V | T/ | 11.4 | 8.3 | 3.7 | ||||||
| Combination 10 |
| V/V | T/T | 6.8 | 8.3 | 11.1 | ||||||
| Combination 11 | A/A | V/V | T/T | 6.8 | 12.5 | |||||||
The putatively resistant mutations are in italic. The blank cells indicate 0 values
BS Baise, HC Hechi, HZ Hezhou, GG Guigang, GL Guilin, LZ Liuzhou, NN Nanning, WZ Wuzhou, YL Yulin
Haplotypes of the AsRDL gene and their frequencies in nine An. sinensis populations from Guangxi, China
| Haplotype | Polymorphic sites | Intron type | 345aa | NN | YL | HZ | BS | WZ | LZ | GL | HC | GG | Total numbers |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| H1 | ACCCTGATTGAACAAGTCGGCCGGGGGT | [1] | T | 4 | 2 | 1 | 4 | 3 | 4 | 3 | 6 | 2 | 29 |
|
| ACCCTGATTGTACAAGTCGGCCGGGGGT | [1] | S | 7 | 9 | 7 | 2 | 3 | 1 | 29 | |||
| H3 | ACCCTGCTTGAACAAGTCGGCCGGGGGT | [2] | T | 26 | 28 | 9 | 22 | 13 | 10 | 21 | 28 | 10 | 167 |
| H4 | ACCCTGCTTGAACAAGTCGGCCGGGGGC | [2] | T | 1 | 1 | ||||||||
| H5 | ACCCTGCTTGAACAAGTCGGCCGGGGAT | [2] | T | 3 | 1 | 2 | 3 | 2 | 11 | ||||
| H6 | ACCCTGCTTGAACAAGTCGGCCGGATGC | [2] | T | 1 | 1 | ||||||||
| H7 | ACCCTGCTTGAACAAGTCGGCCCGATGC | [2] | T | 1 | 1 | ||||||||
| H8 | ACCCTGCTTGAACAAGTCGGTCGGGGGT | [2] | T | 1 | 1 | ||||||||
| H9 | ACCCTGCTTGAACAAGTCGACCGGGGGT | [2] | T | 1 | 1 | ||||||||
| H10 | ACCCTGCTTGAACAAGTGGGCCGGGGGT | [2] | T | 1 | 1 | ||||||||
| H11 | ACCCTGCTTGAACAAGCCGGCCGGGGGT | [2] | T | 1 | 1 | 1 | 2 | 5 | |||||
| H12 | ACCCTGCTTGAACAACTCGGCCGGGGGT | [2] | T | 1 | 1 | ||||||||
| H13 | ACCCTGCTTGAACATGTCGGCCGGGGGT | [2] | T | 5 | 2 | 1 | 1 | 1 | 10 | ||||
| H14 | ACCCTGCTTGAACTTGTCGGCCGGGGGT | [2] | T | 1 | 1 | ||||||||
| H15 | ACCCTGCTTGAAGAAGTCGGCCGGGGGT | [2] | T | 1 | 1 | ||||||||
| H16 | ACCCTGCTTGATCAAGTCGGCCGGGGGT | [2] | T | 1 | 1 | 1 | 1 | 4 | |||||
|
| ACCCTGCTTGTACAAGTCGGCCGGGGGT | [2] | S | 13 | 12 | 2 | 17 | 8 | 2 | 2 | 4 | 3 | 63 |
|
| ACCCTGCTTGTACAAGTCGGCCGGGGAT | [2] | S | 1 | 7 | 4 | 8 | 4 | 3 | 27 | |||
|
| ACCCTGCTTGTACAAGTCGGCCGGGTGC | [2] | S | 1 | 1 | ||||||||
|
| ACCCTGCTTGTACAAGTCGGCCGGATGT | [2] | S | 1 | 1 | 2 | |||||||
|
| ACCCTGCTTGTACAAGTCGGCCGGATGC | [2] | S | 6 | 1 | 1 | 5 | 1 | 1 | 4 | 6 | 25 | |
|
| ACCCTGCTTGTTCAAGTCGGCCGGGGGT | [2] | S | 1 | 1 | 2 | |||||||
| H23 | ACCCTGCTTAAACAAGTCGGCCGGGGGT | [3] | T | 1 | 2 | 1 | 4 | 8 | |||||
| H24 | ACCCTGCTTAAACATGTCGGCCGGGGGT | [3] | T | 1 | 1 | 2 | |||||||
| H25 | ACCCCGCACGAACAAGTCGGCCGGGGGT | [4] | T | 2 | 18 | 5 | 1 | 7 | 33 | ||||
| H26 | ACCCCGCACGAACAAGTCGGCCGGAGGT | [4] | T | 1 | 1 | ||||||||
| H27 | ACCCCGCACGAACAAGTCGGCTGGGGGT | [4] | T | 1 | 1 | ||||||||
| H28 | ACCCCGCACGAACAAGTCAGCCGGGGGT | [4] | T | 1 | 1 | ||||||||
| H29 | ACCCCGCACGAACATGTCGGCCGGGGGT | [4] | T | 3 | 1 | 1 | 2 | 7 | |||||
| H30 | ACCCCGCACGAACATGTCGGCCGAGGGT | [4] | T | 1 | 1 | 2 | |||||||
| H31 | ACCCCGCACGATCAAGTCGGCCGGGGGT | [4] | T | 2 | 1 | 3 | 1 | 7 | |||||
|
| ACCCCGCACGTACAAGTCGGCCGGGGGT | [4] | S | 1 | 2 | 3 | |||||||
|
| ACCCCGCACGTACAAGTCGGCTGGGGGT | [4] | S | 6 | 2 | 7 | 3 | 2 | 20 | ||||
| H34 | ACCTTGCTTGAACAAGTCGGCCGGGGGT | [5] | T | 2 | 1 | 3 | 6 | ||||||
| H35 | ACCTTGCTTGAACAAGTCGGCCGAGGGT | [5] | T | 2 | 2 | ||||||||
| H36 | ACCTTCCTTGAACAAGTCGGCCGGGGGT | [6] | T | 1 | 1 | ||||||||
| H37 | ACACCGCACGAACAAGTCGGCCGGGGGT | [7] | T | 1 | 1 | ||||||||
| H38 | TTCCCGCACGAACAAGTCGGCCGGGGGT | [8] | T | 1 | 1 | ||||||||
| 2N | 66 | 60 | 34 | 88 | 42 | 48 | 54 | 58 | 30 | 480 |
The haplotypes containing the 345S mutation are in italics
BS Baise, HC Hechi, HZ Hezhou, GG Guigang, GL Guilin, LZ Liuzhou, NN Nanning, WZ Wuzhou, YL Yulin
Fig. 7Network showing the genealogy of AsRDL haplotypes. The size of each circle is proportional to the corresponding frequency of a certain haplotype identified in Guangxi. Straight line indicates the possible mutational step. The note near the connecting line is referred to the mutation position and base. The intron type for each haplotype is indicated by corresponding number in bracket
Fig. 8Maximum-likelihood (ML) tree derived from AsRDL haplotypes sampled in Guangxi, China. The haplotypes are named by numbers (1–38). Numbers next to nodes of ML tree indicate bootstrap values (%) and Bayesian posterior probabilities, only bootstrap values greater than 50% and Bayesian posterior probabilities greater than 0.8 are shown. Resistant haplotypes are labelled by nearby black squares