Literature DB >> 29179675

Cgl2 plays an essential role in cuticular wax biosynthesis in cabbage (Brassica oleracea L. var. capitata).

Dongming Liu1,2, Jun Tang1, Zezhou Liu1, Xin Dong1, Mu Zhuang1, Yangyong Zhang1, Honghao Lv1, Peitian Sun1, Yumei Liu1, Zhansheng Li1, Zhibiao Ye3, Zhiyuan Fang4, Limei Yang5.   

Abstract

BACKGROUND: The aerial parts of most land plants are covered with cuticular wax which is important for plants to avoid harmful factors. There is still no cloning study about wax synthesis gene of the alcohol-forming pathway in Brassica species.
RESULTS: Scanning electron microscopy (SEM) showed that, compared with wild type (WT), wax crystal are severely reduced in both the adaxial and abaxial sides of cabbage (Brassica oleracea L. var. capitata L.) leaves from the LD10GL mutant. Genetic analysis results revealed that the glossy trait of LD10GL is controlled by a single recessive gene, and fine mapping results revealed that the target gene Cgl2 (Cabbage glossy 2) is located within a physical region of 170 kb on chromosome 1. Based on sequence analysis of the genes in the mapped region, the gene designated Bol013612 was speculated to be the candidate gene. Gene Bol013612 is homologous to Arabidopsis CER4, which encodes fatty acyl-coenzyme A reductase. Sequencing identified a single nucleotide substitution at an intron/exon boundary that results in an insertion of six nucleotides in the cDNA of Bol013612 in LD10GL. The phenotypic defect of LD10GL was confirmed by a functional complementation test with Arabidopsis mutant cer4.
CONCLUSIONS: Our results indicated that wax crystals of cabbage mutant LD10GL are severely reduced and mutation of gene Bol013612 causes a glossy phenotype in the LD10GL mutant.

Entities:  

Keywords:  Cabbage; Cuticular wax; Functional analysis; Gene mapping; Glossy trait

Mesh:

Substances:

Year:  2017        PMID: 29179675      PMCID: PMC5704555          DOI: 10.1186/s12870-017-1162-8

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

Cabbage leaves usually appear glaucous due to the existence of cuticular wax crystals, but they tend to be glossy green in wax-deficient mutants. Wax plays important roles in protecting plants against various biotic and abiotic stresses, including drought, cold, UV radiation, insect attack, and pathogen infection [1-7]. Both the amount and composition of plant cuticular wax can differ across species, ontogeny, and environment [8-11]. The major compositions of cuticular wax are very long-chain fatty acids (VLCFAs) (C20-C40) and their derivatives, such as alkanes, aldehydes, ketones, esters, primary alcohols, and secondary alcohols [12]. In Arabidopsis, wax biosynthesis begins with the elongation cycle, which converts fatty acids (C16-C18) into VLCFAs by transferring a C2 unit from malonyl-CoA to long-chain acyl-CoA [13-17]. The generated VLCFAs are subsequently modified by the alcohol-forming pathway (also known as the acyl reduction pathway) or the alkane-forming pathway (also known as the decarbonylation pathway) to produce the main components of cuticular wax, including primary alcohols, esters, secondary alcohols, aldehydes, alkanes, and ketones [18, 19]. In Arabidopsis, primary alcohols and wax esters, the main products of the alcohol-forming pathway, account for 10–15% of the total wax on the stems and 15–25% on the leaves, while the alkane-forming pathway produces the majority of wax compounds on the stems (84%) and on the leaves (60%) [20]. With cer (eceriferum) and gl (glossy) mutants in Arabidopsis and other plants, several genes involved in wax biosynthesis have been isolated. These genes encode various proteins, including wax synthesis-related enzymes (CER4, CER6, CER10, FATB, and GL8) [20-24], wax transporters (CER5 and WBC11) [25-27], and transcription factors (SHN1, MYB30, MYB96, and WXP1) [28-31]. In Arabidopsis, CER4 encodes the fatty acyl-coenzyme A reductase (FAR), which is involved in production of VLCFAs and synthesis of primary alcohols [20]. Some genes involved in wax biosynthesis of Brassica species have been reported in recent studies. For example, gene BrWax1 in Brassica rapa was mapped to an 86.4-kb physical interval on linkage group A1, and gene Bra013809, which is orthologous to the CER2 gene in Arabidopsis, was predicted to be the candidate gene [32]. In Brassica napus, the BnaA.GL gene was fine-mapped using cDNA microarray chip analysis [33]. In cabbage, Cgl1 was fine-mapped, and a candidate gene orthologous to CER1 was identified [34]. Although several genes involved in wax biosynthesis have been identified in Brassica species, few genes of the alcohol-forming pathway have been cloned. In the present study, with help of wax-deficient cabbage mutant LD10GL, a high-resolution genetic map was constructed. The Bol013612 gene was predicted to be the candidate gene associated with the glossy phenotype, and the prediction was proved by gene sequencing and functional analysis results. Based on the homology analysis with Arabidopsis CER4 which encodes fatty acyl-coenzyme A reductase, Bol013612 was speculated to be involved in the alcohol-forming pathway in cabbage. These results will help to illustrate the alcohol-forming pathway and accelerate research concerning wax metabolism in Brassica species.

Results

Wax is significantly reduced in LD10GL

WT (LD10) material is a high-generation cabbage (B. oleracea L. var. capitata) inbred line with glaucous appearance, and it is the near-isogenic line (NIL) of LD10GL. Surfaces of all the aerial organs of WT, such as the leaves (Fig. 1a), seedpods (Fig. 1c), stems, and flower buds (Fig. 1e), were glaucous with cuticular wax. In contrast, appearance of the corresponding organs tended to be glossy green in LD10GL (Fig. 1b, d and f).
Fig. 1

The morphological character of WT and LD10GL. (a) leaf, (c) seedpod, and (e) flower buds and stem of WT; (b) leaf, (d) seedpod, and (f) flower buds and stem of mutant LD10GL

The morphological character of WT and LD10GL. (a) leaf, (c) seedpod, and (e) flower buds and stem of WT; (b) leaf, (d) seedpod, and (f) flower buds and stem of mutant LD10GL To study microscopic character of wax crystals, SEM was used to observe the adaxial and abaxial sides of the leaves. Result showed that both leaf sides of WT are covered with compact wax crystals and the crystals are rod shaped (Fig. 2a and c). In contrast, the amount of wax crystals in both the adaxial and abaxial sides of LD10GL was markedly reduced, and the wax crystals tended to be rodlet shaped (Fig. 2b and d).
Fig. 2

SEM images of wax crystals on the surface of cabbage leaves at 3000 × magnification. Appearance of leaf adaxial side of WT (a) and LD10GL (b), and appearance of leaf abaxial side of WT (c) and LD10GL (d)

SEM images of wax crystals on the surface of cabbage leaves at 3000 × magnification. Appearance of leaf adaxial side of WT (a) and LD10GL (b), and appearance of leaf abaxial side of WT (c) and LD10GL (d) To dissect chemical components changes in LD10GL, wax composition of WT and LD10GL was analyzed by GC-MS. As shown in Fig. 3 and Additional file 1, similar content of alkanes, ketones, fatty acids, aldehydes, and secondary alcohols was observed by WT and LD10GL. But significant reduction of primary alcohols and wax esters was detected in LD10GL compared with WT. For example, the primary alcohol and wax ester content is about sixtyfold and fourfold in WT of LD10GL.
Fig. 3

Cuticular wax compositions of WT and LD10GL. Three replicates were performed and the bars indicate SE of the mean

Cuticular wax compositions of WT and LD10GL. Three replicates were performed and the bars indicate SE of the mean

The glossy green character of the LD10GL mutant is controlled by a single recessive gene

To investigate the inheritance of the glossy green trait in LD10GL, seeds of the parental materials, LD10GL(B. oleracea L. var. capitata)and M36 (B. oleracea var. alboglabra), and the derived F1, F2, BC1 and BC2 populations were sown. The glossy green individuals were identified visually. Results showed that surface of leaves and stems of all F1 plants is glaucous, suggesting that the glossy green trait is recessive to the glaucous trait. In the F2 population, 2130 of 2834 individuals showed a glaucous appearance, and 704 individuals showed a glossy green phenotype. The segregation ratio was confirmed to be 3:1 (χ2 = 0.24 < χ20.05 = 3.84, P > 0.05) by the Chi-square test. In BC1 population, which was obtained through backcross of F1 with LD10GL plants, the numbers of glaucous plants and glossy plants were 202 and 192, respectively, displaying a ratio of 1:1 (χ2 = 0.03 < χ20.05 = 3.84, P > 0.05). Furthermore, surface of all BC2 plants, which were achieved through backcrossing the F1 plant with M36, was glaucous (Table 1). All results above indicate that the glossy green trait of LD10GL is controlled by a single recessive gene.
Table 1

Segregation of glossy traits and the χ2 goodness-of-fit test of segregation in BC1 and F2 populations

PopulationTotalNon-glossyGlossySegregation ratioχ2
P1(LD10GL)16016
P2(M36)16160
F1 1001000
F2 283421307042.99:10.03
BC1(F1 × LD10GL)3942021921.05:10.24
BC2(F1 × M36)2682680
Segregation of glossy traits and the χ2 goodness-of-fit test of segregation in BC1 and F2 populations

Preliminary genetic mapping of Cgl2

Two DNA pools were constructed by mixing equal amounts of DNA from 12 glossy green and 12 glaucous F2 individuals. To obtain the markers linked to gene Cgl2, 1064 pairs of primers were screened with the parents and DNA pools successively. As a result, only primer BoID000046 with polymorphism both between the parents and the two DNA pools was obtained. To further verify the linkage between BoID000046 and Cgl2, gDNA of 2834 F2 individuals was amplified as a template with primer BoID000046. As expected, genetic distance between primer BoID000046 and Cgl2 was confirmed to be 4.7 cM (Fig. 4a). To acquire more markers linked to the Cgl2 gene, another 200 pairs of primers on the same chromosome (chromosome C01) were analyzed with F2 individuals. Consequently, four more pairs of markers linked to Cgl2 were obtained, and Cgl2 was mapped to a genetic interval of 6.2 cM with markers BoID000046 and BoID000065 (Fig. 4a).
Fig. 4

Genetic and physical maps of gene Cgl2. a Genetic linkage map constructed with the screened markers. b Physical map to fine map Cgl2

Genetic and physical maps of gene Cgl2. a Genetic linkage map constructed with the screened markers. b Physical map to fine map Cgl2

Marker development and fine mapping of Cgl2

To narrow the mapped region, 50 pairs of new primers within the mapped region were developed according to B. oleracea genome database. Screened with the parental lines, 11 pairs of polymorphic primers were identified. These markers were used to screen 704 F2 individuals with the glossy phenotype for the recombinant plants. Based on the information of the polymorphic markers and the recombinants, a fine linkage map comprising 13 DNA markers was constructed (Fig. 4b). Gene Cgl2 was delimited to a region between markers C01SSR147 and C01SSR150 with genetic distances of 0.2 cM and 0.1 cM, respectively, covering a physical distance of 170 kb (2503307–2,752,299) (Figs. 4b and 5a and b).
Fig. 5

PCR amplification patterns of polymorphic markers. a C01gSSR147and (b) C01gSSR150 with the parents, F1, and the recessive individuals from the F2 population. The black arrows show the polymorphism between the glaucous and glossy green lines. Lanes 1, 2, and 3 is LD10GL, M36, and the F1 respectively. Lanes 4–20 represent the glossy green recessive individuals from the F2 populations

PCR amplification patterns of polymorphic markers. a C01gSSR147and (b) C01gSSR150 with the parents, F1, and the recessive individuals from the F2 population. The black arrows show the polymorphism between the glaucous and glossy green lines. Lanes 1, 2, and 3 is LD10GL, M36, and the F1 respectively. Lanes 4–20 represent the glossy green recessive individuals from the F2 populations

Identification of the candidate gene for Cgl2

To identify the candidate gene, BLAST searches against the NCBI conserved domain database with genes in the mapped region were conducted. Result revealed that the gene Bol013612 (C01:2,609,971:2,615,418), which contains the fatty acyl-coenzyme A reductase (FAR) domain, may be a candidate gene. The FAR enzyme usually acts on medium- and long-chain fatty acids and has been reported to be involved in the biosynthesis of plant primary alcohols and cuticular wax [20]. To examine transcriptional level of the candidate gene, expression of Bol013612 was tested using qPCR. Results showed that the expression level in LD10GL is lower than that in WT, which may be induced by mutation and abnormal function of gene Bol013612 in LD10GL (Fig. 6). The cDNA, gDNA, and nucleotide sequence approximately 2000 bp upstream of the gDNA of Bol013612 were sequenced. Results showed that, compared with the WT, there exists a nucleotide substitution from adenine to guanine at nucleotide position 622 in the gDNA and an insert of six nucleotides in the cDNA of gene Bol013612 (Fig. 7a and b; Additional file 2). According to the GT-AG rule, which implies that an intron should start with a ‘GT’ at the 5′ side and end with an ‘AG’ at the 3′ side [35], the mutational pattern in LD10GL was illustrated as follows: a single nucleotide substitution at position 622 in the gDNA brings a new terminal ‘AG’ to the first intron and thus generated an alternative 3′ splice site in intron 1. Because of the earlier ending of the first intron, the six additional nucleotides were included within the 5′ portion of exon 2 (Fig. 7a and b). As a result, six nucleotides are inserted into the cDNA sequence at nucleotide position 92 (Fig. 7b). Because of the insertion of the six nucleotides, one amino acid is modified and another two additional amino acids are introduced (Fig. 7c), which is just within the FAR domain of this protein (Additional file 3). The resulting change of amino acid sequence is considered to disrupt the gene function, influence the wax biosynthesis, and further lead to the glossy appearance.
Fig. 6

Expression level of gene Bol013612 in the WT, LD10GL, cgl2-LD10GL, and Cgl2-LD10. The columns (a) and (b) are for expression of gene Bol013612 in cabbage material WT and LD10GL; columns (c) and (d) depict expression levels of alleles Bol013612 from LD10GL and WT when expressed in Arabidopsis. The date represents the means ± standard deviations of three replicates

Fig. 7

The gene structure and mutational pattern of gene Bol013612 in LD10GL. a The gene structure and the nucleotide substitution in the gDNA of LD10GL. The underlined nucleotides are the partial sequence of the 1st intron. b The insertion of six nucleotides in gene Bol013612 of LD10GL. c The mutational pattern in the level of amino acid of LD10GL

Expression level of gene Bol013612 in the WT, LD10GL, cgl2-LD10GL, and Cgl2-LD10. The columns (a) and (b) are for expression of gene Bol013612 in cabbage material WT and LD10GL; columns (c) and (d) depict expression levels of alleles Bol013612 from LD10GL and WT when expressed in Arabidopsis. The date represents the means ± standard deviations of three replicates The gene structure and mutational pattern of gene Bol013612 in LD10GL. a The gene structure and the nucleotide substitution in the gDNA of LD10GL. The underlined nucleotides are the partial sequence of the 1st intron. b The insertion of six nucleotides in gene Bol013612 of LD10GL. c The mutational pattern in the level of amino acid of LD10GL

Bol013612 can rescue the phenotype of the Arabidopsis cer4 mutant

Sequence analysis result show that protein sequence of Bol013612 and CER4 is highly homologous with each other (84.58%)(Additional file 4), and FAR domain was both contained by CER4 and Bol013612. To further confirm the relationship between Bol013612 and the glossy green phenotype in LD10GL, the full-length coding sequence (CDS) of the Bol013612 gene from LD10GL was ectopically expressed in Arabidopsis cer4 mutant under control of the 35S promoter (designated as cgl2-LD10GL). The Arabidopsis cer4 plants, cer4 plants with Bol013612 cDNA from WT (designated as Cgl2-LD10), and mutant plants with an empty pCambia3301 vector (designated as cer4–3301) were used as the controls. Several independent transgenic lines were obtained from each process, and the Bol013612 gene was ectopically expressed in Arabidopsis in the cgl2-LD10GL and Cgl2-LD10 plants (Fig. 6). As a result, the phenotypic defect of Arabidopsis mutant cer4 was restored in Cgl2-LD10 (Fig. 8d), but the glossy appearance was still exhibited in cgl2-LD10GL (Fig. 8b) and cer4–3301 (Fig. 8c) plants; the wax load and morphology were restored to wildtype-levels in transgenic plants expressing Cgl2, but not cgl2-LD10GL (Fig. 9). The functional complementation test result and high sequence homology between gene Bol013612 and known FAR-coding gene implicates protein Bol013612 is a wax biosynthesis enzyme. Collectively, these results illustrate that it is the mutation of Bol013612 that influences wax biosynthesis and causes the glossy green trait in LD10GL.
Fig. 8

Recovery of cer4-Cgl2 plants from waxless Arabidopsis mutant cer4. Bright green appearance is presented by stems of cer4 (a), cgl2-LD10GL (b), and cer4–3301(c); the color of stem in Cgl2-LD10 (d) turns to be glaucous, just like the WT (e)

Fig. 9

SEM images of wax crystals on the surface of Arabidopsis stems at 3000 × magnification. There are only a few wax crystals on the surface of cer4 (a), cgl2-LD10GL (b), and cer4–3301 (c); There are amounts of wax crystals on the surface of Cgl2-LD10 (d), just like the WT (e), which indicates that the wax reduction defect was restored in Cgl2-LD10

Recovery of cer4-Cgl2 plants from waxless Arabidopsis mutant cer4. Bright green appearance is presented by stems of cer4 (a), cgl2-LD10GL (b), and cer4–3301(c); the color of stem in Cgl2-LD10 (d) turns to be glaucous, just like the WT (e) SEM images of wax crystals on the surface of Arabidopsis stems at 3000 × magnification. There are only a few wax crystals on the surface of cer4 (a), cgl2-LD10GL (b), and cer4–3301 (c); There are amounts of wax crystals on the surface of Cgl2-LD10 (d), just like the WT (e), which indicates that the wax reduction defect was restored in Cgl2-LD10

Discussion

Appearance of many plants is glaucous for the covering of cuticular wax, which constitutes the outermost barrier of plants. Compared with glaucous wild-type plants, most land plants with metabolic defects in wax biosynthesis are readily detectable with naked eye. With T-DNA insertion, many Arabidopsis cer (eceriferum) mutants were isolated and the corresponding genes were identified. Same as other Arabidopsis cer mutants, cer4 has a glossy green appearance. But different from some sterile cer mutants, such as cer1, cer3, cer6, and cer10, cer4 mutant is fertile [36].In contrast to the glaucous appearance in WT, surface of the leaves, seedpods, flower buds and stems is glossy green in cabbage LD10GL mutant. Changes of wax crystal density and shape were observed through SEM, indicating that it is the reduction of wax leads to glossiness in LD10GL. Similar as cer4 mutant, cabbage mutant LD10GL is fertile, different from another cabbage glossy green mutant 10Q-961, in which few seeds were produced after self-pollination [34]. Plant wax compounds are produced through alcohol-forming pathway and the alkane-forming pathway in Arabidopsis. Many genes have been isolated. Several genes implicated in Brassica plants wax biosynthesis were reported in recent studies. Gene BrWax1 in Brassica rapa was mapped to a fragment of 86.4 kb, and Bra013809 was predicted to be the candidate gene for BrWax1 [32]. The BnaA.GL gene in Brassica napus was proved to be located at the end of the A9 chromosome [33]. In cabbage, the BoGL1 gene was delimited to the end of chromosome C08 by flanking marker SSRC08–76 with genetic distance of 0.2 cM and Bol018504 was selected as the candidate gene [34]. Although several wax biosynthesis-related genes have been identified in Brassica species, little research about the alcohol-forming pathway and the related genes were reported. In Arabidopsis, FAR catalyzes the two-step reduction of VLCFAs to produce primary alcohols. The primary alcohols together with C16:0 acyl-CoAs combine to produce alkyl esters. Primary alcohols and alkyl esters are two of the main cuticular wax components [20, 37]. CER4 is one of the key genes encoding FAR in Arabidopsis. For reduction of primary alcohols and wax esters, glossy wax-deficient trait is displayed in cer4 [20]. High level of protein sequence homology is exhibited between cabbage gene Bol013612 and CER4. Similar as cer4, primary alcohol and wax esters are the main reduced wax compositions in mutant LG10GL. As helpful material for metabolic mechanism research, the cabbage mutant LD10GL was applied to the wax biosynthesis study. Using a standard molecular genetic mapping strategy, the Cgl2 gene was delimited to the interval between markers C01SSR147 and C01SSR150. Based on sequence analysis results, gene Bol013612 was speculated to be the candidate gene. Concerning sequence homology and similar reduced wax composition in LD10GL and cer4, gene Bol013612 was speculated to encode FAR. Linkage relationship of the glossy character in LD10GL and Bol013612 was further confirmed by a functional complementation test. All results provided evidence that Bol013612 may be the target gene for Cgl2. All of these results will help us to further illustrate the formation of the glossy trait in LD10GL and wax biosynthesis in cabbage. More research needs to be carried out in future work, such as the metabolic mechanism of cabbage wax biosynthesis and identification of other genes involved.

Conclusions

We fine-mapped a wax synthesis gene using the F2 populations, analyzed the genes present in the candidate region, and identified Bol013612, which is homologous to CER4, as a candidate gene for Cgl2. A 6-bp insertion resulted in the abnormal function of the FAR domain in the LD10GL glossy mutant line. The identification of Cgl2 gene will enhance our understanding about its role in cabbage wax biosynthesis and lays a foundation for further study of cabbage wax metabolism.

Methods

Plant materials and genetic study

Plant materials in this study are all maintained in our lab. F1, F2, BC1, and BC2 populations were constructed using the female LD10GL parent (P1) and male M36 parent (P2) for inheritance and fine mapping studies. The glossy cabbage mutant LD10GL is a natural glossy mutant of LD10 cabbage. The gene responsible for the glossy green trait in LD10GL is named as Cgl2 for the reason that Cgl2 is the 2nd gene which was fine-mapped and cloned in cabbage (the 1st gene fine-mapped and cloned was named Cgl1). LD10 is a high-generation cabbage (B. oleracea L. var. capitata) inbred line with glaucous appearance and is referred as WT in this study. Same agronomic traits, such as shape of the head and plant type are exhibited by LD10 and LD10GL, except the glossy green appearance. M36 is a Chinese kale (Brassica oleracea var. alboglabra) material with glaucous appearance. F1 plants were obtained by crossing LD10GL and M36. One F1 plant was used as the female parent material in the backcrosses with LD10GL and M36, and F2 plants were obtained by selfing the same F1 plant. All the plant materials were provided by the Cabbage and Broccoli Research Group, Institute of Vegetables and Flowers (IVF), Chinese Academy of Agricultural Sciences (CAAS) and grown in the greenhouse in Changping (39°54′N, 116°13′E, Beijing, China) according to local crop management practices. The glossy phenotype was assessed and recorded at the five-leaf stage. The segregation ratios of the F2 and BC1 populations were analyzed with the Chi-square test (χ2).

SEM and GC-MS analysis

Fresh leaves from the five-leaf-stage plants were fixed overnight in 2% glutaraldehyde, mounted on specimen stubs using double-sided tape and then coated with gold particles in a SEMPrep2 sputter coater (Nanotech). The phenotype was analyzed by SEM (S-4800, Hitachi, Japan) with a secondary electron detector at a high voltage (10 kV). GC-MS analysis of cuticular wax was carried out as described as Tang [38].

The mapping strategy

Total genomic DNA from fresh leaves was extracted with the cetyltrimethylammonium bromide (CTAB) protocol, and the concentration of genomic DNA was adjusted to 30 ng/μl [39]. Polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) was performed with 20 μl of reaction mixture [40]. Using the bulked segregant analysis (BSA) method, 12 glaucous and 12 glossy individuals from the F2 population were selected to construct two DNA bulks. One thousand two hundred sixty-four pairs of SSR primers that were designed according to data of the B. oleracea genome database (Brassica Database, BRAD; http://brassicadb.org/brad/index.php) [41] were screened by the parental materials and two DNA pools successively for mapping analysis. The linkage relationships between the Cgl2 gene and the polymorphic primers were confirmed with F2 individuals. Linkages between markers and the Cgl2 gene were determined using the software Joinmap 4.0 (Kyasma, NL). To finely map Cgl2, 50 pairs of SSR primers near the preliminary mapping region were developed and used to screen for the recombinants among 704 recessive F2 individuals. The individuals whose gel bands were the same as those of M36 or the F1 were used as the recombinants and selected for further analysis. The linkage between the markers and the Cgl2 gene was determined with the Kosambi mapping function, and a genetic map was constructed using the software Mapdraw 2.1 [42, 43]. The sequences of all polymorphic markers used in this study are listed in Table 2.
Table 2

Sequences of primers

Primer nameForward primer sequence (5′-3′)Reverse primer sequence (5′-3′)
BoID000042ACCATGTTCATAGCAAGCTCACACTCGCACGTAAAGAAAT
BoID000043GCTGATGGAAGGAAGATGTACCTGCTTTGAAAATTCACTC
BoID000046CACAAAATCATTAGGCCAACAAAAGACAGTGCCTTCCTAA
BoID000065ATTGGTTTAGTGCAAGTGCTCTTCATTTTTCGAGGTCAAG
BoID000066TCCTGTGATGTGATTTTCCTAAAATGCTTGTGAAGTGACC
C01gSSR127GGCGTGAGACAGTCCAATTGAGAACCTTGCTTACAAAC
C01gSSR128TCGTTCGACTGTATTTGACACAGTGTGTTGATGATGAAGC
C01gSSR129ATGCATCATGTTCGTTACTGTCACTGGTAAATGATGGGTT
C01gSSR132CAAAACATGAGACCAAGACCGCTGGATAGCATTCTAAAGG
C01gSSR134CAAACAATGTGAGGGAAGTTGTATGTTCTTGTTGGGTTGG
C01gSSR135CACAACTTATTCGCTGACAACACTCTTATTACGTGCTCCA
C01gSSR137GTTCAGTCTGGATTTTGCTTTCCAAAGACGAACAAAAGAG
C01gSSR139TTAAGGGATTTTGGACAGGGAAGGATATACTGTGGTGGC
C01gSSR140CCCACTTCACTCTGCTTATGGTATGGTCGAAGTGGTATGC
C01gSSR147TAAAAATGAGGAAGTGGCCGGGGCAGATAGTCTAGCACGC
C01gSSR150AGAATTCAAGTCTTTGCGAGTATCCCCTGTATGGTGATGT
Bol013612g1ACTAGGCATAATGTGTGCGCACGACAGTCATCAGAAGC
Bol013612g2GTTTGGACTTGTAGTGCTTCTGGATTATCTATGGGTGGTAACGG
Bol013612g3AGACGAGGTTTGTCCCTTCCATACTCTTCTAAAGCACCCG
Bol013612g4TATCAACACACTGGGCGTCACACGAACCACCTTACCTTC
Bol013612g5GGCTCACCAGGTTCTATTCCCCCAACTTCCCAATCAGAC
Bol013612c1CTCGCTCATACGTACATACTTTAAATAGCAACATCCC
qPCR-013612AGCCTCTCCTGAAACCATCCGGACGAATCAACACAAG
qPCR-actin-BolCCTCCGTCTTGACCTTGCGTCTCCATCTCCTGCTCGT
Sequences of primers

Identification and sequence analysis of the candidate gene

Conserved domains of genes between the two closest markers were analyzed using the BLAST program (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) [44]. Genes with wax-related conserved domains were selected as the candidate genes. The level of protein sequence homology between Bol013612 and Arabidopsis CER4 was analyzed with software MultAlin (http://multalin.toulouse.inra.fr/multalin/multalin.html) [45] and DNAMAN software (http://www.lynnon.com/dnaman.html). The expression level of the candidate gene in WT and LD10GL was tested by qPCR. Sequences of the candidate genes were amplified using the gDNA and cDNA as templates with a KAPPA HiFi HotStart ReadyMix PCR Kit (Kappa Biosystems). The PCR products were sequenced by BGI TechSolutions Co., Ltd. Sequences were aligned with the software MultAlin (http://multalin.toulouse.inra.fr/multalin/multalin.html) [45]. The gene structure was analyzed with the Gene Structure Display Server software (http://gsds.cbi.pku.edu.cn/index.php) [46]. The primers used to amplify the gDNA sequence were designed according to the B. oleracea genome database (Brassica Database, BRAD; http://brassicadb.org/brad/index.php) [41] with the software Primer Premier 5 [47] and were named Bol013612g1, Bol013612g2, Bol013612g3, Bol013612g4, and Bol013612g5 (Table 2). The primers used to amplify the cDNA sequence were designed according to the B. oleracea transcriptome database (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42891) [41] and named Bol013612c1 (Table 2). Total RNA extraction, first-strand cDNAs synthesis, and real-time PCR were performed as previously reported [34]. Sequences of the primers for qPCR named qPCR-013612 and qPCR-actin-Bol are listed in Table 2. Each sample was tested in triplicate.

Transformation of Arabidopsis mutants

The cDNA of Bol013612 from LD10GL and WT was cloned and inserted into the pCAMBIA3301 vector between the NcoI and BstEII sites. The constructed vectors contained the 35S CaMV promoter and a Basta resistance marker. The plasmid was introduced into Agrobacterium EHA105 via heat shock and transformed into Arabidopsis plants using the floral dip method [48]. Arabidopsis thaliana mutant material cer4 (ecotype Columbia; named SALK_000575C in Arabidopsis Biological Resource Center, ABRC), which has glossy green stem surface, was used for experiments involving transformation [49]. Seeds of transformed Arabidopsis plants were selected on MS (Murashige and Skoog) medium containing 50 mg/ml of Basta. qRT-PCR was employed to further confirm the successful transfer of 35S:Bol013612 in the stems with the primers qPCR-013612 and qPCR-actin-At (Table 2). Cuticular wax composition of WT and LD10GL. (DOCX 20 kb) CDS of gene Bol013612 in WT and LD10GL. (DOCX 21 kb) Insertion of six nucleotides at nucleotide position 92 in cDNA sequence of gene Bol013612 is just within the FAR domain of this protein. (DOCX 106 kb) Protein sequence homology analysis of gene Bol013612 and CER4. (DOCX 32 kb)
  38 in total

1.  Acyl-lipid metabolism.

Authors:  Yonghua Li-Beisson; Basil Shorrosh; Fred Beisson; Mats X Andersson; Vincent Arondel; Philip D Bates; Sébastien Baud; David Bird; Allan Debono; Timothy P Durrett; Rochus B Franke; Ian A Graham; Kenta Katayama; Amélie A Kelly; Tony Larson; Jonathan E Markham; Martine Miquel; Isabel Molina; Ikuo Nishida; Owen Rowland; Lacey Samuels; Katherine M Schmid; Hajime Wada; Ruth Welti; Changcheng Xu; Rémi Zallot; John Ohlrogge
Journal:  Arabidopsis Book       Date:  2010-06-11

2.  [MapDraw: a microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data].

Authors:  Ren-Hu Liu; Jin-Ling Meng
Journal:  Yi Chuan       Date:  2003-05

3.  Composition of alkyl esters in the cuticular wax on inflorescence stems of Arabidopsis thaliana cer mutants.

Authors:  Christine Lai; Ljerka Kunst; Reinhard Jetter
Journal:  Plant J       Date:  2007-03-21       Impact factor: 6.417

4.  Plant cuticular lipid export requires an ABC transporter.

Authors:  Jamie A Pighin; Huanquan Zheng; Laura J Balakshin; Ian P Goodman; Tamara L Western; Reinhard Jetter; Ljerka Kunst; A Lacey Samuels
Journal:  Science       Date:  2004-10-22       Impact factor: 47.728

5.  Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.

Authors:  S J Clough; A F Bent
Journal:  Plant J       Date:  1998-12       Impact factor: 6.417

6.  WIN1, a transcriptional activator of epidermal wax accumulation in Arabidopsis.

Authors:  Pierre Broun; Patricia Poindexter; Erin Osborne; Cai-Zhong Jiang; José Luis Riechmann
Journal:  Proc Natl Acad Sci U S A       Date:  2004-03-22       Impact factor: 11.205

7.  Genome-wide insertional mutagenesis of Arabidopsis thaliana.

Authors:  José M Alonso; Anna N Stepanova; Thomas J Leisse; Christopher J Kim; Huaming Chen; Paul Shinn; Denise K Stevenson; Justin Zimmerman; Pascual Barajas; Rosa Cheuk; Carmelita Gadrinab; Collen Heller; Albert Jeske; Eric Koesema; Cristina C Meyers; Holly Parker; Lance Prednis; Yasser Ansari; Nathan Choy; Hashim Deen; Michael Geralt; Nisha Hazari; Emily Hom; Meagan Karnes; Celene Mulholland; Ral Ndubaku; Ian Schmidt; Plinio Guzman; Laura Aguilar-Henonin; Markus Schmid; Detlef Weigel; David E Carter; Trudy Marchand; Eddy Risseeuw; Debra Brogden; Albana Zeko; William L Crosby; Charles C Berry; Joseph R Ecker
Journal:  Science       Date:  2003-08-01       Impact factor: 47.728

8.  A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis.

Authors:  Sylvain Raffaele; Fabienne Vailleau; Amandine Léger; Jérôme Joubès; Otto Miersch; Carine Huard; Elisabeth Blée; Sébastien Mongrand; Frédéric Domergue; Dominique Roby
Journal:  Plant Cell       Date:  2008-03-07       Impact factor: 11.277

Review 9.  Sealing plant surfaces: cuticular wax formation by epidermal cells.

Authors:  Lacey Samuels; Ljerka Kunst; Reinhard Jetter
Journal:  Annu Rev Plant Biol       Date:  2008       Impact factor: 26.379

10.  GSDS 2.0: an upgraded gene feature visualization server.

Authors:  Bo Hu; Jinpu Jin; An-Yuan Guo; He Zhang; Jingchu Luo; Ge Gao
Journal:  Bioinformatics       Date:  2014-12-10       Impact factor: 6.937

View more
  4 in total

1.  Fine-mapping and transcriptome analysis of BoGL-3, a wax-less gene in cabbage (Brassica oleracea L. var. capitata).

Authors:  Xin Dong; Jialei Ji; Limei Yang; Zhiyuan Fang; Mu Zhuang; Yangyong Zhang; Honghao Lv; Yong Wang; Peitian Sun; Jun Tang; Dongming Liu; Yumei Liu; Zhansheng Li
Journal:  Mol Genet Genomics       Date:  2019-05-16       Impact factor: 3.291

2.  BrWAX2 plays an essential role in cuticular wax biosynthesis in Chinese cabbage (Brassica rapa L. ssp. pekinensis).

Authors:  Shuangjuan Yang; Honglei Liu; Xiaochun Wei; Yanyan Zhao; Zhiyong Wang; Henan Su; Xiaobin Zhao; Baoming Tian; Xiao-Wei Zhang; Yuxiang Yuan
Journal:  Theor Appl Genet       Date:  2021-11-11       Impact factor: 5.699

3.  Genome-Wide Analysis of Coding and Long Non-Coding RNAs Involved in Cuticular Wax Biosynthesis in Cabbage (Brassica oleracea L. var. capitata).

Authors:  Xiaowei Zhu; Xiang Tai; Yunying Ren; Jinxiu Chen; Tianyue Bo
Journal:  Int J Mol Sci       Date:  2019-06-10       Impact factor: 5.923

4.  An SNP Mutation of Gene RsPP Converts Petal Color From Purple to White in Radish (Raphanus sativus L.).

Authors:  Dongming Liu; Xiaochun Wei; Dongling Sun; Shuangjuan Yang; Henan Su; Zhiyong Wang; Yanyan Zhao; Lin Li; Jinfang Liang; Luming Yang; Xiaowei Zhang; Yuxiang Yuan
Journal:  Front Plant Sci       Date:  2021-06-03       Impact factor: 5.753

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.