Literature DB >> 29178873

Prevalence and molecular characterization of Staphylococcus aureus isolated from goats in Chongqing, China.

Zuoyong Zhou1,2, Mengsi Zhang3,4,5, Hexian Li3,4, Haoyue Yang3,4, Xiaoxia Li3,4, Xinyue Song3,4, Zhiying Wang3,4.   

Abstract

BACKGROUND: Staphylococcus aureus is an important zoonotic pathogen which not only causes significant economic loss in livestock production but also poses a potential threat to public health. Compared with bovine and swine, the information on the colonization of S. aureus in goats is very limited. To understand the prevalence and characteristics of S. aureus in goats, we used the nasal swabs collected from apparently healthy goats to isolate S. aureus, and tested their antimicrobial susceptibility, virulence gene carrying levels, and multilocus sequence typing (MLST).
RESULTS: In 74 nasal swabs of apparently healthy goats, 32 (43.24%) S. aureus strains were isolated and identified, most of which were susceptible to many antibiotics, except for trimethoprim, furazolidone, amoxicillin, lincomycin and roxithromycin, and the resistance incidence of which were 50%, 40.63%, 37.5%, 28.13%, and 21.88% respectively. All the isolates were methicillin-susceptible S. aureus (MSSA) and mecA-negative. Enterotoxin genes were found in 53.13% of the strains. Of which, sej was the most prevalent (21.88%), followed by seb, sec, and see with the same level (18.75%). The most prevalent combination were seb + see and seb + tst. None of the S. aureus isolates harbored sea, sed, seh, eta and etb. Multilocus sequence typing (MLST) revealed 6 new alleles (aroe-552, aroe-553, glpf-500, pta-440, yqil-482 and yqil-496) and 5 new sequence types (STs) (3431,3440,3444,3445 and 3461). Using eBURST, the 5 STs were assigned to clonal complex 522 (CC522) and a further CC with no predicted ancestor. Phylogenetic analysis of seven concatenated MLST alleles revealed that the 5 STs were grouped into cluster I composed of S. aureus mainly from goats and sheep.
CONCLUSION: We provide the data for prevalence of S. aureus in goats in Chongqing municipality and their characterization which will help in tracking evolution of epidemic strains and their control methods.

Entities:  

Keywords:  Antimicrobial resistance; Goats; MLST; Staphylococcus aureus; Virulence genes

Mesh:

Substances:

Year:  2017        PMID: 29178873      PMCID: PMC5702051          DOI: 10.1186/s12917-017-1272-4

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Staphylococcus aureus is an important opportunistic pathogen and the cause of infection among human, domestic and wild animals [1-3]. Due to its broad spectrum of inherent virulence factors, the infection of S. aureus usually plays an important role for the causing of abscesses, mastitis, pneumonia and meningitis in mammals [4-6]. The invasion of S. aureus in domestic animals not only causes significant economic loss in livestock production but also poses a potential threat to public health since these animals can act as the reservoir of methicillin-resistant S. aureus (MRSA) [7, 8]. The livestock-associated methicillin-resistant S. aureus (LA-MRSA) represented by clonal complex 398 (CC 398) have been shown to be able to colonize and cause serious infections in people having close contact with animals such as veterinarians, farmers and their family members [9-11]. In addition, both handling and consumption of products of these animals colonized by MRSA may provide a potential transmission to humans [12]. Thus, it is of importance to understand the prevalence and characterization of S. aureus colonizing the livestock. In contrast to the studies of S. aureus infections in bovine and human, less is known on these bacteria in goats or their relevant products. In 2008, Chongqing municipality was incorporated into the national "Advantage of agricultural products regional planning" in China and recognized as the key areas for beef cattle and goats breeding. The number of live sheep and goats in Chongqing was about 2.26 million and 2.74 million slaughtered was provided by the end of 2015 (Chongqing Statistical Yearbook, 2016). However, there is no investigation on the incidences of colonization in goats by S. aureus in Chongqing. To understand the prevalence and characteristics of S. aureus in goats, we used the nasal swabs from apparently healthy goats to isolate S. aureus, tested their antimicrobial susceptibility and virulence gene carrying levels, and defined multilocus sequence typing (MLST).

Methods

Sample collection and S. aureus isolation

The nasal swabs were collected from 74 apparently healthy goats from 10 herds in 4 counties (Rongchang, Jiangjing, Zhongxian and Dazu) of Chongqing municipality, transported to the laboratory and stored at 4 °C prior to isolation. The bacteria were enriched in a common broth at 37 °C for 18 h, and then inoculated on 7.5% NaCl agar plates for cultivation at 37 °C for 24 h. The colonies suspected to be S. aureus were identified by Gram staining, colony morphology, and coagulase testing. All the presumptive S. aureus colonies were then subcultured and confirmed by the PCR amplification of nuc (a thermonuclease gene characteristic of S. aureus) [13] (Table 1) with the following conditions: denaturation for 4 min at 94 °C, followed by 30 cycles for 1 min at 94 °C, 30 s at 58 °C and 90 s at 72 °C, and a final extension at 72 °C for 3.5 min. S. sciuri was used as nuc-negative control strain.
Table 1

Primers used for nuc, mecA and virulence genes amplification

Gene PrimerPrimer sequence (5′to 3′)Amplification size (bp)Reference
nuc SF:GCGATTGATGGTGATACGGTT279[13]
SR:AGCCAAGCCTTGACGAACTAAAGC
mecA SF: AAAATCGATGGTAAAGGTTGGC533[15]
SR: AGTTCTGCAGTACCGGATTTGC
sea SF: GGTTATCAATGTGCGGGTGG102[16]
SR: CGGCACTTTTTTCTCTTCGG
seb SF: GTATGGTGGTGTAACTGAGC164[16]
SR: CCAAATAGTGACGAGTTAGG
sec SF: AGATGAAGTAGTTGATGTGTATGG451[16]
SR: CACACTTTTAGAATCAACCG
sed SF:CCAATAATAGGAGAAAATAAAAG278[16]
SR: ATTGGTATTTTTTTTCGTTC
see SF:AGGTTTTTTCACAGGTCATCC209[16]
SR: CTTTTTTTTCTTCGGTCAATC
seg SF: TGCTATCGACACACTACAACC704[17]
SR:CCAGATTCAAATGCAGAACC
seh SF:CGAAAGCAGAAGATTTACACG495[17]
SR: GACCTTTACTTATTTCGCTGTC
sei SF:GACAACAAAACTGTCGAAACTG630[17]
SR: CCATATTCTTTGCCTTTACCAG
sej SF: CATCAGAACTGTTGTTCCGCTAG142[18]
SR: CTGAATTTTACCATCAAAGGTAC
tst SF: ACCCCTGTTCCCTTATCATC326[16]
SR: TTTTCAGTATTTGTAACGCC
eta SF: ATATCAACGTGAGGGCTCTAGTAC1155[20]
SR: ATGCAGTCAGCTTCTTACTGCTA
etb SF: CACACATTACGGATAATGCAAG604[20]
SR: TCAACCGAATAGAGTGAACTTATCT
pvl SF: GTGCCAGACAATGAATTACCC255[19]
SR: TTCATGAGTTTTCCAGTTCACTTC
Primers used for nuc, mecA and virulence genes amplification

Antimicrobial resistance profile

The S. aureus isolates were used for antimicrobial susceptibility test using disk diffusion method according to Clinical and Laboratory Standards Institute (CLSI) guidelines [14]. Following antibiotics with stated concentrations (μg/disc) were used: cefotaxime (30), ceftriaxone (30), streptomycin (10),kanamycin (30), gentamicin (10),tetracycline (30), chloramphenicol (30),lincomycin (2), macrodantin (300),furazolidone (300), vancomycin (30), norfloxacin (10),minocyline (30), amoxicillin (10), cefoxitin (30),clarithromycin (15), levofloxacin (5),roxithromycin (15),trimethoprim (5) and cefepime (30). The presence of mecA (staphylococci methicillin resistance gene) [15] (Table 1) was analyzed by PCR method under the same amplification conditions as stated earlier for nuc, ATCC 43300 (mecA positive) and ATCC 29213 (mecA negative) were used as control strains.

Detection of virulence genes

DNA extraction was done using a commercial DNA extraction kit (Dalian TaKaRa Biotechnology Co.,Ltd.) following the manufacturer’s instructions. Thirteen S. aureus virulence genes including enterotoxins (SEs), sea, seb, sec, sed, see, seg, seh, sei, sej [16-18]; cytotoxin pvl [19]; exfoliative toxins (ETs), eta, etb [20]; and a toxic shock syndrome toxin 1(tst) [16] (Table 1) were selected for PCR with the following amplification conditions: initial denaturation for 5 min at 94 °C, followed by 30 cycles of 94 °C for 1 min, 50 °C for 1 min (55 °C for seg and pvl), and 72 °C for 1 min, with a final elongation of 72 °C for 10 min. S. aureus reference strains including ATCC 25923 (pvl positive) and ATCC 29213 (sea, sec, see and tst positive).

Multilocus sequence typing (MLST) of S. aureus

A random selection of 13 S. aureus isolates were analyzed by MLST. The 7 housekeeping genes, carbamate kinase (arcc), shikimate dehydrogenase (aroe), glycerol kinase (glpf), guanylate kinase (gmk), phosphate acetyltransferase (pta), triosephosphate isomerase (tpi), and acetyl coenzyme A acetyltransferase (yqil) (http://saureus.mlst.net/misc/info.asp), were amplified by PCR method consisting of initial denaturation at 95 °C for 5 min, followed by a total of 35 cycles of 30 s denaturation at 94 °C, 30 s annealing at 55 °C, and 1 min elongation at 72 °C, with a final elongation step of 10 min at 72 °C. PCR products were sequenced both in forward and reverse directions by Shanghai Invitrogen Biotechnology Co., Ltd. The sequences for each locus were compared to the allele sequences through the MLST website (http://www.mlst.net). Isolates were defined by their alleles at the seven loci (allelic profile), and each allelic profile was submitted to the database to obtain a sequence type (ST) number.

Clonal complexes (CCs) clustering and phylogenetic analysis of S. aureus STs

The clustering of STs was performed using eBURST algorithm (http://eburst.mlst.net/) [21] by comparing the present dataset to that of the MLST database of 4066 STs by the end of May 2017, and ran with the default settings. Clonal complexes (CCs) were composed of STs that shared at least six alleles in common and a predicted ancestral ST and its associated single locus variants (SLVs: the variants differ at one of the seven MLST alleles from the ancestor) and double locus variants (DLVs: the variants differ at two of the seven MLST alleles from the ancestor) [3]. Along with the STs obtained in this research, 23 STs from human (ST7, 12,13, 15, 27, 88, 101 and 240), goats and sheep (ST130, 133, 398, 425, 522, 1595, 1740, 1742, 1743, 1758, 1780, 1781, 2011, 2305, 2328) [2, 9, 22, 23] were collected for phylogenetic analyses. The concatenated sequences of all seven MLST alleles for each ST were aligned using the CLUSTAL X program with default parameters followed by manual inspection. MEGA 4.0 was used to construct neighbour-joining trees [24]. Bootstrapping was performed with 1000 replicates.

Results

Isolation and identification of S. aureus

Of 74 nasal swabs of goats collected from 10 herds, 32 (43.24%) were identified as S. aureus through nuc amplification (Fig. 1), and all the S. aureus isolates were found to be coagulase positive.
Fig. 1

Gel electrophoresis of amplified nuc in S. aureus isolated from goats in Chongqing. M: DL-2000 DNA marker; 1: Staphylococcus sciuri; 2–5: the nuc gene of some S. aureus isolates by amplified at 297 bp

Gel electrophoresis of amplified nuc in S. aureus isolated from goats in Chongqing. M: DL-2000 DNA marker; 1: Staphylococcus sciuri; 2–5: the nuc gene of some S. aureus isolates by amplified at 297 bp The antimicrobial susceptibility test showed most of the S. aureus isolates susceptible to a majority of antibiotics and the resistance rates below 20%, with the exceptions of following: trimethoprim (50% resistant), furazolidone (40.63%), amoxicillin (37.5%), lincomycin (28.13%), and roxithromycin (21.88%) (Table 2). All the isolates (n = 32) were methicillin-susceptible S. aureus (MSSA) and cefoxitin-susceptible.
Table 2

Results of drug sensitivity test for S. aureus (n = 32)

AntibioticsNo. of S. aureus Percentage of resistance or sensitive
RISResistance rate (%)Sensitive rate (%)
Macrodantin24266.2581.25
Streptomycin22286.2587.50
Gentamicin11303.1393.75
Norfloxacin402812.5087.50
Kanamycin24266.2581.25
Vancomycin31289.3887.50
Ceftriaxone317129.3837.50
Tetracycline28226.2568.75
Cefotaxime15263.1381.25
Chloramphenicol562115.6365.63
Trimethoprim1651150.0034.38
Cefepime11303.1393.75
Roxithromycin7141121.8834.38
Levofloxacin502715.6384.38
Lincomycin9101328.1340.63
Minocyline0428087.50
Cefoxitin0131096.88
Clarithromycin522515.6378.13
Amoxicillin1241637.5050.00
Furazolidone1381140.6334.38

“R” represents resistance; “I” represents intermediate; “S” represents susceptible

Results of drug sensitivity test for S. aureus (n = 32) “R” represents resistance; “I” represents intermediate; “S” represents susceptible

Distribution of virulence genes among S. aureus isolates

Since every S. aureus carries several virulence genes, but here 19/32 strains carried at least one of the small chosen set of virulence genes (Fig. 2). Enterotoxin genes were detected in majority (53.13%) of the strains, and sej gene was found in 7 (21.88%), followed by seb, sec and see in 18.75% isolates each, sei (9.38%), seg (3.13%). In addition, both tst gene and pvl gene were detected in 6 (18.75%) isolates. The most prevalent combination was determined to be seb + see and seb + tst in 12.5% of all isolates (Table 3). There were 8 isolates which only encode a virulence gene.
Fig. 2

Gel electrophoresis of amplified virulence gene products of S. aureus isolates from goats in Chongqing. M: DL-2000 DNA marker; 1: seb (164 bp); 2: sec (451 bp); 3: see (209 bp); 4: seg (704 bp); 5: sei (630 bp); 6: sej (142 bp); 7: tst (326 bp); 8: pvl (255 bp); 9: amplification of seb in Staphylococcus sciuri

Table 3

Distribution of virulence genes among S. aureus isolates from goats (n = 32)

GeneNumber of isolatesDetection rate(%)GenesNumber of isolatesDetection rate(%)
seb 618.75 seb + see + pvl 26.25
sec 618.75 seb + tst + pvl 26.25
see 618.75 seb + see + sej 26.25
seg 13.13 seb + see 412.50
sei 39.38 see + sej 39.38
sej 721.88 seb + tst 412.50
tst 618.75 seb + pvl 39.38
pvl 618.75 sec + pvl 26.25
sec + tst 26.25
Gel electrophoresis of amplified virulence gene products of S. aureus isolates from goats in Chongqing. M: DL-2000 DNA marker; 1: seb (164 bp); 2: sec (451 bp); 3: see (209 bp); 4: seg (704 bp); 5: sei (630 bp); 6: sej (142 bp); 7: tst (326 bp); 8: pvl (255 bp); 9: amplification of seb in Staphylococcus sciuri Distribution of virulence genes among S. aureus isolates from goats (n = 32)

MLST analysis

After MLST analysis, 6 new alleles (aroe-552, aroe-553, glpf-500, pta-440,yqil-482 and yqil-496) and 5 new STs (ST 3431,ST 3440,ST 3444,ST 3445 and ST 3461) were identified and added to the S. aureus MLST database (Table 4). The dominant type of aroE was aroE-552, which was present in 92.31% (12/13) of S. aureus isolates, followed by pta-440 and yqiL-496, which accounted for 69.23% (9/13) and 61.54% (8/13) respectively. The ST3444 was the most common ST type which accounted for 61.54% (8/13) of the S. aureus isolates, followed by ST3445 (2 strains), and ST 3431, ST 3440, ST 3461 which just had one strain.
Table 4

The alleles and STs of S. aureus isolates from goats in Chongqing

IsolatesMLST allelic profileST
arcc aroe glpf gmk pta tpi yqil
18 552 1352 440 127 482 3431
218 552 500 27155 3440
38 552 1352 440 127 496 3444
48 552 1352 440 127 496 3444
58 552 1352 440 127 496 3444
618 552 4527155 3445
78 552 1352 440 127 496 3444
88 552 1352 440 127 496 3444
98 552 1352 440 127 496 3444
108 552 1352 440 127 496 3444
1118 552 4527155 3445
128 552 1352 440 127 496 3444
138 553 4527155 3461

The bold-italic numbers indicate new alleles or STs

The alleles and STs of S. aureus isolates from goats in Chongqing The bold-italic numbers indicate new alleles or STs eBURST generated 103 groups and 483 singletons. The S. aureus isolates tested in this study were clustered into CC522 containing ST3440 and ST3445, and a further CC with no predicted ancestor containing ST3431 and ST3444, while ST3461 was a singleton (Fig. 3). The phylogenetic relationship of 28 STs, based on concatenated sequences of seven MLST alleles, resulted in two main clusters: clusterI(mainly from goats and sheep) and cluster II (from humans). In clusterI, there were three sub-clusters (SCs) (SC1 containing ST130, 522, 1740, 1742, 1758, 2011, 3440, 3445 and 3461; SC2 containing ST133, 425, 1743, 1780, 1781, 2305 and 2328; SC3 containing ST 398, 1595, 3431 and 3444) (Fig. 4).
Fig. 3

eBURST-generated CC522 containing the major ST522 comprising 14 STs. The primary founder (ST522) is colored blue and positioned centrally in the cluster, and subgroup founders are colored yellow; the SLVs were connected by red lines, and the DVLs were connected by blue lines; the areas of each of the circles indicate the prevalence of the ST in the input data. The novel STs in this study were marked by red oval circle

Fig. 4

Phylogenetic tree of S. aureus STs using the concatenated sequences of the seven MLST genes mainly from human, goats and sheep. ClusterI: mainly from goats and sheep; Cluster II: mainly from human. In clusterI, the STs divided into three sub-clusters (SCs), and the new STs (marked by red filled circles) obtained in this study were clustered in SC1 and SC3. ST398 (marked by black filled diamond), is associated with animals infection [9]; ST522 (marked by black filled triangle) is associated with goats and sheep [2]; ST133 (marked by black filled square) appears to be an ungulate-animal-specific genotype [3]

eBURST-generated CC522 containing the major ST522 comprising 14 STs. The primary founder (ST522) is colored blue and positioned centrally in the cluster, and subgroup founders are colored yellow; the SLVs were connected by red lines, and the DVLs were connected by blue lines; the areas of each of the circles indicate the prevalence of the ST in the input data. The novel STs in this study were marked by red oval circle Phylogenetic tree of S. aureus STs using the concatenated sequences of the seven MLST genes mainly from human, goats and sheep. ClusterI: mainly from goats and sheep; Cluster II: mainly from human. In clusterI, the STs divided into three sub-clusters (SCs), and the new STs (marked by red filled circles) obtained in this study were clustered in SC1 and SC3. ST398 (marked by black filled diamond), is associated with animals infection [9]; ST522 (marked by black filled triangle) is associated with goats and sheep [2]; ST133 (marked by black filled square) appears to be an ungulate-animal-specific genotype [3]

Discussion

This is the first study of the prevalence of S. aureus from the nose swabs of apparently healthy goats in Chongqing. Our results were comparable to the carriage frequency of S. aureus in healthy sheep in Tunisia [25] approaching to ~ 45% level, which were higher than reported by other investigators in dairy sheep and goats [26-28], but lower than that in goats in Norway and Denmark [22, 29]. It is interesting that all the S. aureus isolates in this study were methicillin-susceptible S. aureus (MSSA) since they were sensitive or medium sensitivity to cefoxitin and mecA tested negative. The majority of S. aureus showed relatively low resistance to vancomycin, ceftriaxone, macrodantin, streptomycin, kanamycin, tetracycline, gentamicin, cefotaxime and cefepime, which is similar to the resistance of S. aureus isolated from sheep and goat in Spain [23], but lower than the resistance of S. aureus from goats in Taiwan [26]. The relatively high sensitivity spectrum of S. aureus from Chongqing is likely due to a limited use of antimicrobials for goats [28]. The infections caused by S. aureus is associated with its virulence factors which allow it to adhere to surface, invade or avoid the immune system, and cause harmful toxic effects to the host [30, 31]. More than half of isolates in this study were tested positive for SE genes, which is similar to other reports in S. aureus from dairy goats [29] and their milk products [32], and higher than the result in goats and cows affected with mastitis [33]. Of the SE genes tested, sej was the most predominantly occurring gene which is different from the detection rates in goats from Taiwan or sheep in Tunisia where there were no sej occurrence [25, 26]. Except for sej, the seb, sec, see, tst and pvl carriage rate of 18.75% is similar to the other reports in S. aureus from goats and their milk products [26, 32, 34, 35] but lower than sec and tst found in S. aureus from dairy goats [29], or in MSSA from sheep [25]. In contrast to the other report [29], although sec and tst showed the same detection rates, they were not always co-detected. In the previous study, see was identified only in S. aureus associated with mastitis in goat [26], the carry level of seb and see in this study are inconsistent with other reports [32, 35] where there were no S. aureus strain harboured seb and see. Pvl is associated with S. aureus causing goat subclinical mastitis [36]. Different from the previous report [25], we found 18.75% isolates pvl-positive. To understand the molecular characteristics of S. aureus isolates from Chongqing goats, we used MLST typing and found 6 new alleles (aroe-552, aroe-553, glpf-500, pta-440,yqil-482 and yqil-496) and 5 new STs (3431,3440,3444,3445 and 3461). The dominant alleles belonged to aroE was aroE-552, which occurred in most of S. aureus strains, followed by pta-440 and yqiL-496. In the newly found STs, ST3444 was the most common, which occurred in approximately 60% of the S. aureus isolates. It is relatively normal for S. aureus from goats to possess novel alleles or STs in contrast to human or bovine strains, which may be simply due to the investigation of a new population, since most reports have focused on human clinical isolates or bovine mastitis [37]. The eBURST analyses assigned S. aureus isolates to CC522 containing ST3440 and ST3445, and a further CC with no predicted ancestor. The results from phylogenetic analyses showed that STs from goats and sheep were separated from that of human, thus formed two main clusters. Three new STs (ST3440, 3445 and 3461) were sub-grouped in the branch of SC1 containing ST522, the primary founder ST of CC522, which was reported previously from cases of goat mastitis or goat’s milk samples [2, 3, 23]. ST3444, the predominate ST in this study, and ST3431 were sub-clustered into the branch SC3 containing ST398, which is associated with animals infection [9]. In SC2, ST133 was found in variety of animals including cows, goats and sheep [2, 3, 22, 23], and was found to be the most common animal-associated MLST type [3]. Our results confirmed the relative close relationship of ST 3440, ST3445 and ST3461 with ST522, and ST3444, ST3431 with ST398.

Conclusion

This is the first study to report the prevalence rate, antimicrobial resistance profile, virulence genes association and MLST characteristics of S. aureus from goats in Chongqing municipality. This study will help in tracking evolution of S. aureus epidemic strains and proving the methods to control S. aureus in goats in China.
  31 in total

1.  [Methicillin resistant Staphylococcus aureus community acquired meningitis: a case report].

Authors:  Roxana Gabriela Spini; Verónica Ferraris; María Patricia Glasman; Guillermina Orofino; Alejandra Casanovas; Gustavo Debaisi
Journal:  Arch Argent Pediatr       Date:  2014-12       Impact factor: 0.635

2.  Carriage frequency, diversity and methicillin resistance of Staphylococcus aureus in Danish small ruminants.

Authors:  Jacob Eriksson; Carmen Espinosa-Gongora; Inga Stamphøj; Anders Rhod Larsen; Luca Guardabassi
Journal:  Vet Microbiol       Date:  2012-12-13       Impact factor: 3.293

3.  Panton-Valentine leukocidin and some exotoxins of Staphylococcus aureus and antimicrobial susceptibility profiles of staphylococci isolated from milks of small ruminants.

Authors:  Nilgün Ünal; Şinasi Askar; Hasan Ceyhun Macun; Fatma Sakarya; Belgin Altun; Murat Yıldırım
Journal:  Trop Anim Health Prod       Date:  2011-07-29       Impact factor: 1.559

4.  Skin lesion by methicillin-resistant Staphylococcus aureus ST398-t1451 in a Spanish pig farmer: possible transmission from animals to humans.

Authors:  Carmen Lozano; Carmen Aspiroz; Luis Charlez; Elena Gómez-Sanz; Miguel Toledo; Myriam Zarazaga; Carmen Torres
Journal:  Vector Borne Zoonotic Dis       Date:  2011-05-06       Impact factor: 2.133

5.  Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical disease.

Authors:  A Holmes; M Ganner; S McGuane; T L Pitt; B D Cookson; A M Kearns
Journal:  J Clin Microbiol       Date:  2005-05       Impact factor: 5.948

6.  Prevalence, antibiotic resistance, virulence traits and genetic lineages of Staphylococcus aureus in healthy sheep in Tunisia.

Authors:  Haythem Gharsa; Karim Ben Slama; Carmen Lozano; Elena Gómez-Sanz; Naouel Klibi; Rym Ben Sallem; Paula Gómez; Myriam Zarazaga; Abdellatif Boudabous; Carmen Torres
Journal:  Vet Microbiol       Date:  2011-11-17       Impact factor: 3.293

7.  Epidemiology of methicillin-resistant Staphylococcus aureus carrying the novel mecC gene in Denmark corroborates a zoonotic reservoir with transmission to humans.

Authors:  A Petersen; M Stegger; O Heltberg; J Christensen; A Zeuthen; L K Knudsen; T Urth; M Sorum; L Schouls; J Larsen; R Skov; A R Larsen
Journal:  Clin Microbiol Infect       Date:  2012-10-19       Impact factor: 8.067

8.  Suspected goat-to-human transmission of methicillin-resistant Staphylococcus aureus sequence type 398.

Authors:  Igor Loncaric; René Brunthaler; Joachim Spergser
Journal:  J Clin Microbiol       Date:  2013-02-27       Impact factor: 5.948

9.  Livestock-associated Staphylococcus aureus CC398: animal reservoirs and human infections.

Authors:  Erwin Verkade; Jan Kluytmans
Journal:  Infect Genet Evol       Date:  2013-03-05       Impact factor: 3.342

10.  Molecular genetic typing reveals further insights into the diversity of animal-associated Staphylococcus aureus.

Authors:  Davida S Smyth; Edward J Feil; William J Meaney; Patrick J Hartigan; Tore Tollersrud; J Ross Fitzgerald; Mark C Enright; Cyril J Smyth
Journal:  J Med Microbiol       Date:  2009-06-15       Impact factor: 2.472

View more
  3 in total

1.  Genomic analysis of Staphylococcus aureus from the West African Dwarf (WAD) goat in Nigeria.

Authors:  Adebayo Osagie Shittu; Fadekemi Funmilayo Taiwo; Neele Judith Froböse; Bianca Schwartbeck; Silke Niemann; Alexander Mellmann; Frieder Schaumburg
Journal:  Antimicrob Resist Infect Control       Date:  2021-08-19       Impact factor: 4.887

2.  Profiles of Staphyloccocus aureus isolated from goat persistent mastitis before and after treatment with enrofloxacin.

Authors:  Magna Coroa Lima; Mariana de Barros; Thalita Moreira Scatamburlo; Richard Costa Polveiro; Laís Karolyne de Castro; Samuel Henrique Sales Guimarães; Sanely Lourenço da Costa; Mateus Matiuzzi da Costa; Maria Aparecida Scatamburlo Moreira
Journal:  BMC Microbiol       Date:  2020-05-24       Impact factor: 3.605

3.  Study on bacterial pathogens through multiplex polymerase chain reaction system and their antimicrobial resistance pattern in goats presumed with fever and/or diarrhea.

Authors:  Pranab Paul; Md Rayhan Faruque; Md Kaisar Rahman; Priyanka Das; Mohammed Yousuf Elahi Chowdhury
Journal:  Vet World       Date:  2021-05-06
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.