Takayuki Mineshige1,2, Junichi Kamiie1, Go Sugahara1, Kinji Shirota1. 1. Laboratory of Veterinary Pathology, School of Veterinary Medicine, Azabu University, 1-17-71 Fuchinobe, Chuo-ku, Sagamihara, Kanagawa 252-5201, Japan. 2. Present address: Marmoset Research Department, Central Institute for Experimental Animals, 3-25-12 Tonomachi, Kawasaki-ku, Kawasaki, Kanagawa 210-0821, Japan.
Abstract
Atopic dermatitis (AD) is a chronic, pruritic, and allergic skin disease in humans and animals, particularly dogs. Canine AD (cAD) has received attention as a spontaneous atopic animal model because domesticated dogs inhabit a human environment, and cAD shares several clinicopathological features with human AD (hAD). In hAD, periostin (PO) is suggested to play a critical role in the enhancement and chronicity of allergic skin inflammation; however, PO involvement in the pathogenesis of cAD is unknown. Here we aimed to clarify PO involvement in the pathophysiology of cAD and focused on the inducing factor and function of PO in canine atopic skin. Using double-labeled in situ hybridization (ISH), interleukin (IL)-13 mRNA-positive cells were detected near the keratinocytes and dermal fibroblasts expressing PO mRNA in atopic skin. Using an in vitro assay, IL-13 induced PO gene expression in both canine dermal fibroblasts and keratinocytes. PO enhanced in vitro growth of canine keratinocytes. Moreover, among PO-induced genes in cultured canine keratinocytes detected using a microarray, we identified IL-25 as a possible mediator in canine atopic skin. In addition, real time polymerase chain reaction (PCR) analysis revealed upregulation of IL-25 gene expression in PO-stimulated keratinocytes. These data suggest that IL-13 possibly derived from T helper 2 (Th2) cells stimulates PO production in both keratinocytes and fibroblasts, and then PO may play a critical role in the pathophysiology of cAD, particularly in the enhancement and chronicity of skin lesions via IL-25.
Atopic dermatitis (AD) is a chronic, pruritic, and allergic skin disease in humans and animals, particularly dogs. CanineAD (cAD) has received attention as a spontaneous atopic animal model because domesticated dogs inhabit a human environment, and cAD shares several clinicopathological features with humanAD (hAD). In hAD, periostin (PO) is suggested to play a critical role in the enhancement and chronicity of allergic skin inflammation; however, PO involvement in the pathogenesis of cAD is unknown. Here we aimed to clarify PO involvement in the pathophysiology of cAD and focused on the inducing factor and function of PO in canine atopic skin. Using double-labeled in situ hybridization (ISH), interleukin (IL)-13 mRNA-positive cells were detected near the keratinocytes and dermal fibroblasts expressing PO mRNA in atopic skin. Using an in vitro assay, IL-13 induced PO gene expression in both canine dermal fibroblasts and keratinocytes. PO enhanced in vitro growth of canine keratinocytes. Moreover, among PO-induced genes in cultured canine keratinocytes detected using a microarray, we identified IL-25 as a possible mediator in canine atopic skin. In addition, real time polymerase chain reaction (PCR) analysis revealed upregulation of IL-25 gene expression in PO-stimulated keratinocytes. These data suggest that IL-13 possibly derived from T helper 2 (Th2) cells stimulates PO production in both keratinocytes and fibroblasts, and then PO may play a critical role in the pathophysiology of cAD, particularly in the enhancement and chronicity of skin lesions via IL-25.
Atopic dermatitis (AD) is a chronic, pruritic, and allergic skin disease in humans and animals, particularly dogs. CanineAD (cAD) has received attention as a spontaneous animal model of humanAD (hAD) because domestic dogs
inhabit a human environment, and cAD shares several clinicopathological features with hAD, including age of onset, skin areas affected, severe pruritus and the immunopathological mechanism [13, 16, 22]. Histologically, the skin lesions in hAD and cAD are characterized by spongiotic and hyperplastic dermatitis with
mononuclear infiltrate composed of T lymphocytes [5, 17, 22]. The pathogenesis of both hAD and cAD has been
characterized by skin barrier damage and allergic inflammation with T helper 2 (Th2) immune response caused by the release of Th2 cytokines such as interleukin (IL)-4 and IL-13, particularly in the acute lesions [19, 21, 22]. In AD, once allergic inflammation is triggered by exposure to allergens, skin lesions chronically
persist without continuous allergen stimulation [14]. However, the mechanisms underlying chronicity in allergic inflammation and the associated skin reaction are unknown.Periostin (PO) is a matricellular protein that belongs to the fasciclin family [16, 20, 29]. PO was first
described as osteoblast-specific factor 2 (OSF-2) in 1993 as a homophilic adhesion molecule in osteogenesis [24]. PO modulates cell function by binding to αvβ1,
αvβ3 and αvβ5 integrin molecules on the cell surface; thus, PO provides signals for tissue development, proliferation and remodeling [9,
20, 29, 30]. PO production is induced by transforming growth factor (TGF)-β, IL-4 and IL-13, which are
major cytokines of the Th2-type immune response in bronchial asthma, suggesting PO involvement in allergic inflammation [10, 14, 29]. Recently, Masuoka et al. [14] reported that a deficiency of PO suppressed allergic inflammation induced by treatment with house
dust mite extract in atopic model mice. They further indicated the binding of PO to αv integrin on mouse keratinocytes in vitro, which resulted in the induction of proinflammatory cytokines,
including thymic stromal lymphopoietin (TSLP) from the keratinocytes [14]. Thus, PO fulfills important roles in the enhancement and chronicity of allergic skin inflammation in hAD and
experimental atopic models.We have previously reported that PO expression was more intense in the canine atopic dermis and correlated with the severity of chronic histopathological lesions (epidermal thickening and fibrosis) and CD3+ cell number in
the dermis, similar to these reported in hAD patients [15]. In the article, in situ hybridization (ISH) showed that fibroblasts and keratinocytes were the main source
of PO in cAD [15]. These results suggested that PO may be involved in the pathogenesis of chronicity in cAD.In the present study, we attempted to clarify PO involvement in canine atopic skin using skin tissues of cAD and cultured canine keratinocytes and dermal fibroblasts. First, we focused on IL-13 and TGF-β1 which were assumed
to be inducing factors of PO. Reportedly, TGF-β is a major trigger of PO production from both dermal and pulmonary fibroblasts [23, 30]. However,
Masuoka et al. [14] recently reported that IL-13-induced PO production independently of TGF-β in the skin of a murine atopic model.Further, we examined the effects of PO in cultured canine keratinocytes using a proliferation assay, microarray and real time quantitative reverse transcription polymerase chain reaction (RT-PCR). The keratinocytes act as
immune cells and a mechanical barrier between the external environment and body [3, 19]. Previous studies have reported that cytokines and
chemokines such as thymus and activation-regulated chemokine (TARC/CCL17) are exclusively produced by keratinocytes in human and canine atopic skin [12]. From our previous results
[15], we assumed that PO may involve in epidermal thickening and the infiltration of inflammatory cells, which are major pathologic features in atopic skin.Finally, we discussed possible PO involvement in the pathophysiology of cAD. The findings of the present study may provide a molecular basis of PO for further understanding cAD as a model of hAD and for considering PO as a
potential therapeutic target for hAD and cAD.
MATERIALS AND METHODS
Skin samples
The diagnosis of cAD was based on the clinical criteria proposed by Terada et al [25]. A total of five biopsies taken from the four atopic dogs were used for
immunohistochemistry (IHC) and ISH. Their ages ranged from five to 13 years, and the cohort included three males and one female.The skin tissues obtained from the chest regions of five normal beagles (two males and three females, aged 1–7 years) were used as control for IHC and ISH, and canine primary dermal fibroblasts were derived from three
12 month-old male beagles. These dogs were purchased from a laboratory animal breeding and supply company (Kitayama Labes Co., Ltd., Ina, Japan) and were confirmed to be healthy by physical examination. They were used
for clinical education and euthanized in accordance with the guidelines approved by the Animal Research Committee of Azabu University (No.100408-3). Skin specimens were obtained from the dogs immediately after
euthanasia.Skin specimens were fixed in 10% neutral-buffered formalin, embedded in paraffin, cut, and stained with hematoxylin and eosin (HE). The paraffin sections were provided for IHC and ISH.
Immunohistochemistry
IHC for PO using an immunoenzyme polymer method was performed as previously described [15].
Double-in situ hybridization
Double-ISH for PO and IL-13/ TGF-β1 was performed using the QuantiGene® ViewRNA ISH Tissue Assay (Affymetrix, Santa Clara, CA, U.S.A.) according to the manufacturer’s protocol, as described previously [15]. Type 1/Fast Red was used for PO probes and Type 6/Fast Blue was applied for IL-13 and TGF-β1. Double-ISH sections were counterstained with Mayer’s hematoxylin. To identify the
expressing IL-13 mRNA on CD3 positive cells, serial sections were additionally subjected to IHC for CD3 (rabbit anti–human CD3; Dako Denmark A/S., Glostrup, Denmark) as previously described [15]. An ISH reaction solution without the probes was used as a negative control, according to the manufacturer’s recommendations.
Culture of canine keratinocytes and dermal fibroblasts
Two types of culture cells, commercially available canine keratinocyte cell line (CPEK, CELLnTEC Advanced Cell Systems, Bern, Switzerland) and primary canine dermal fibroblasts, were used in the present study.CPEK was cultured in 25 cm2 flasks (AGC Techno Glass Co., Ltd., Haibara, Japan) in CnT-09 (CELLnTEC Advanced Cell Systems) with 10% fetal bovine serum (FBS; Hana-nesco Bio. Co., Tokyo, Japan) and 1%
Antibiotic Antimycotic (Thermo Fisher Scientific Inc., Waltham, MA, U.S.A.) until approximately 80% confluence at 37°C under 5% CO2. The cultured cells were trypsinized by treatment with 2 ml
Trypsin-EDTA and incubated for 7–10 min at 37°C. Fifth- to tenth-passage CPEK was used in these experiments.Primary culture of canine dermal fibroblasts was performed according to the previous report for the human dermal fibroblasts [1]. Briefly, full-depth skin samples obtained from the
chest region of healthy dogs were immediately placed in phosphate buffered saline (PBS; pH 7.2, 0.01 M) with 1% Antibiotic Antimycotic. Skin samples were rinsed seven times with PBS and fragmented into 5 mm2
pieces. These skin fragments were placed on a surface of 60 × 15 mm Petri dishes with Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/ F12, 1:1; Invitrogen Life Technologies, Carlsbad, CA, U.S.A.)
containing of 10% FBS and 1% Antibiotic Antimycotic. Cultures were incubated at 37°C in a humidified incubator with 5% CO2. The culture medium was changed every three days. Satisfactory proliferation of
fibroblasts was observed by approximately 20 days. Fibroblasts of the 3rd–5th passages were used for the experiments.
Qualitative RT-PCR
RT-PCR was performed to confirm the expression of the interleukin 13 receptor alpha 1 and αv integrin gene in CPEK and canine dermal fibroblasts. Total RNA was extracted from CPEK and canine dermal fibroblasts using the
RNeasy Plus Micro Kit (Qiagen, Hilden, Germany). Extracted total RNA was used in RT-PCR using the SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen Life Technologies).Primer sequences were obtained by determining the predicted mRNA sequences of Canis lupus familiarisinterleukin 13 receptor, alpha 1 (IL13RA1) (NCBI database accession number:
XM_538150.5) and C. lupus familiarisintegrin, alpha V (ITGAV) (NCBI database accession number: XM_014110784.1). The primer sequences were as follows: canineIL13RA1 forward,
5′GGAGACTCCTCTGTTCTTACCATTTG3′; and reverse, 5′CTCATAACCAGTTGTGACTGTAAGGG3′, and canineITGAV forward, 5′GATAGAGCTGTGTTATACAGAGCCAGAC3′; and reverse, 5′CAGATAAGCTACTAGTTCCTCACACTGC3′. The PCR reaction with KOD FX Neo
(Toyobo, Osaka, Japan) was performed as follows: denaturation at 94°C for 2 min; 35 cycles of denaturation at 98°C for 10 sec, annealing at 65°C for 30 sec, and extension at 68°C for 30 sec; and a final extension step at
68°C for 1 min. The amplification products were separated on 2% agarose gels and stained with Midori Green DNA Stain (NIPPON Genetics Co., Ltd., Tokyo, Japan).
Real time quantitative RT-PCR
CPEK and dermal fibroblasts were grown in 24-well plates (AGC Techno Glass Co., Ltd.); after washing with PBS to remove all sera, then the cells were serum-starved for 24 hr.For real time quantitative RT-PCR to evaluate PO mRNA expression, CPEK and fibroblasts were cultured in DMEM/F12 with or without 50 ng/µl recombinant canineIL-13 (rIL-13: R&D
Systems, Minneapolis, MN, U.S.A.) for 6 or 24 hr. CPEK were cultured in DMEM/F12 with or without 2 µg/ml recombinant humanPO (rPO: R&D Systems) for 2, 6, 12, 24 or 36 hr.After stimulation by rIL-13 or rPO, total RNA was extracted from cell cultures using the RNeasy Plus Micro Kit. Extracted total RNA was used for RT-PCR employing the SuperScript® VILO™ cDNA Synthesis Kit. Quantification
of mRNA expression was performed using StepOne™ Real-Time PCR Systems (Applied Biosystems, Foster city, CA, U.S.A.), TaqMan Universal PCR Master Mix (Applied Biosystems), and a TaqMan MGB probe for the target genes: PO
(Assay ID: Cf02680558_m1; Applied Biosystems), IL-25 (Assay ID, Cf02643291_m1; Applied Biosystems) and keratinocyte differentiation-associated protein (KDAP) (assay ID, Cf02627160_m1; Applied Biosystems)
according to the manufacturer’s protocol. The PCR reaction was performed in duplicate for each sample and mean values of the target gene expression were calculated as a ratio to those of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) according to the ΔΔCT method.
Proliferation assay
For the proliferation assay, CPEK was cultured in DMEM/F12 supplemented with 0.1% FBS and either rPO (1 or 4 µg/ml) dissolved in PBS or PBS alone for 24 hr. After stimulation, the
proliferation assay was performed using a cell-counting kit (CCK-8; Dojindo Molecular Technologies, Kumamoto, Japan) according to the manufacturer’s protocol.
Microarray
For DNA microarray analysis, CPEK was cultured with or without 4 µg/ml rPO for 6 or 24 hr. After stimulation by rPO, total RNA was extracted from cell cultures using the RNeasy Plus
Micro Kit. The microarray analyses were performed by DNA Chip Research Inc. (Yokohama, Japan) using the Canine (V2) Gene Expression Microarray (4 × 44k, two-color array; Agilent Technologies, Palo Alto, CA, U.S.A.)
according to Agilent microarray DNA chip analysis. cRNA was synthesized from the mRNA component of total cellular RNA. Each cRNA sample was then independently labeled with Cy3 (green) and Cy5 (red). The fold change was
calculated for samples to represent a ratio of expression between PO-stimulated and vehicle control samples.
Statistical analyses
Statistical analyses of results of real time quantitative RT-PCR and proliferation assays were performed using GraphPad Prism (ver. 5.0, GraphPad Software, La Jolla, CA, U.S.A.). Comparisons of mRNA between extracted
samples from stimulated and unstimulated cells were performed by the unpaired T test. P<0.05 was considered to be statistically significant.
RESULTS
PO protein highly deposited in canine atopic dermis
A small amount of PO protein was localized in the healthy canine dermis at the perifollicular area and exactly beneath the basal layer (Fig. 1a). PO was highly deposited in the canine atopic dermis (Fig. 1b).
Fig. 1.
a. Healthy skin, beagle. The brown color indicates positive staining of the periostin (PO) protein. PO protein was faintly localized in the dermis at the perifollicular area and just beneath the basal layer
(arrows). Immunohistochemical staining (IHC) for PO. Bar=500 µm. b. Atopic dermatitis, skin, chihuahua. PO was diffusely deposited in the dermis. IHC for PO. Bar=500 µm.
a. Healthy skin, beagle. The brown color indicates positive staining of the periostin (PO) protein. PO protein was faintly localized in the dermis at the perifollicular area and just beneath the basal layer
(arrows). Immunohistochemical staining (IHC) for PO. Bar=500 µm. b. Atopic dermatitis, skin, chihuahua. PO was diffusely deposited in the dermis. IHC for PO. Bar=500 µm.
IL-13 mRNA-positive cells were present near PO mRNA-positive cells
Using Double-ISH, IL-13 mRNA-positive small round cells were detected near PO mRNA-positive keratinocytes and fibroblasts in the dermis of atopic skin (Fig. 2a). Infiltration of IL-13 mRNA-positive cells in the epidermis was also detected in the atopic skin (Fig. 2b), which was consistent with that in CD3-positive cells (data not
shown). No TGF-β1 mRNA-positive cells were observed in atopic skins. No signals were detected in the hybridized tissues using the ISH solution without the probe.
Fig. 2.
a. Atopic dermatitis, skin, Shiba inu. The interleukin (IL)-13 mRNA-positive cells (arrows) are detected near the periostin (PO) mRNA-positive cells in the atopic skin. Double-In situ
hybridization (ISH) for PO (red) and IL-13 (blue). Bar=50 µm. b. Atopic dermatitis, skin, Shih Tzu. Infiltration of the IL-13 mRNA-positive small round cells in the epidermis was evident (arrows).
The inset shows the infiltration of IL-13 mRNA-positive cells into epidermis (arrows). ISH for PO and IL-13. Bar=500 µm.
a. Atopic dermatitis, skin, Shiba inu. The interleukin (IL)-13 mRNA-positive cells (arrows) are detected near the periostin (PO) mRNA-positive cells in the atopic skin. Double-In situ
hybridization (ISH) for PO (red) and IL-13 (blue). Bar=50 µm. b. Atopic dermatitis, skin, Shih Tzu. Infiltration of the IL-13 mRNA-positive small round cells in the epidermis was evident (arrows).
The inset shows the infiltration of IL-13 mRNA-positive cells into epidermis (arrows). ISH for PO and IL-13. Bar=500 µm.
IL13RA1 and ITGAV gene expressed in canine keratinocytes and dermal fibroblasts
The mRNAs encoding IL13RA1 and ITGAV expressed in both CPEK and cultured canine dermal fibroblast (Fig. 3a and 3b).
Fig. 3.
Agarose gel electrophoresis of reverse transcription polymerase chain reaction (RT-PCR) products. a. The mRNAs encoding Canis lupus familiaris interleukin 13 receptor, alpha 1 (IL13RA1) expressed
in both canine keratinocyte cell line (CPEK) and cultured canine dermal fibroblast. b. The mRNAs encoding C. lupus familiaris integrin, alpha V (ITGAV) expressed in both CPEK and cultured canine
dermal fibroblast. C: CPEK. F: cultured canine dermal fibroblast. M: molecular weight marker.
Agarose gel electrophoresis of reverse transcription polymerase chain reaction (RT-PCR) products. a. The mRNAs encoding Canis lupus familiarisinterleukin 13 receptor, alpha 1 (IL13RA1) expressed
in both canine keratinocyte cell line (CPEK) and cultured canine dermal fibroblast. b. The mRNAs encoding C. lupus familiarisintegrin, alpha V (ITGAV) expressed in both CPEK and cultured canine
dermal fibroblast. C: CPEK. F: cultured canine dermal fibroblast. M: molecular weight marker.
IL-13 stimulated both keratinocytes and fibroblasts to produce PO
Following 6 and 24 hr of treatment with rIL-13, PO mRNA expression in keratinocytes was significantly increased compared with the vehicle control (Fig. 4a). Following-24 hr treatment with rIL-13, PO mRNA expression in dermal fibroblasts was significantly increased compared with the vehicle control (Fig. 4b).
Fig. 4.
Quantitative analysis of mRNA levels of periostin (PO) in the cultured keratinocytes and dermal fibroblasts at 6 and 24 hr after sensitization with 50 ng/µl recombinant interleukin (rIL-13). a.
Following both 6 and 24 hr of rIL-13 treatment, PO mRNA expression in keratinocytes was significantly increased as compared with the vehicle control. b. Following 24 hr of rIL-13 treatment, PO mRNA expression in
dermal fibroblasts was significantly increased as compared with the vehicle control. Real time quantitative reverse transcription polymerase chain reaction (RT-PCR; **P<0.01,
***P<0.001; vs vehicle control; unpaired t-test).
Quantitative analysis of mRNA levels of periostin (PO) in the cultured keratinocytes and dermal fibroblasts at 6 and 24 hr after sensitization with 50 ng/µl recombinant interleukin (rIL-13). a.
Following both 6 and 24 hr of rIL-13 treatment, PO mRNA expression in keratinocytes was significantly increased as compared with the vehicle control. b. Following 24 hr of rIL-13 treatment, PO mRNA expression in
dermal fibroblasts was significantly increased as compared with the vehicle control. Real time quantitative reverse transcription polymerase chain reaction (RT-PCR; **P<0.01,
***P<0.001; vs vehicle control; unpaired t-test).
rPO enhanced in vitro growth of canine keratinocytes
The effect of rPO on the growth of keratinocytes was evaluated using CPEK. In vitro growth of CPEK was significantly enhanced by 4 µg/ml of PO (Fig. 5).
Fig. 5.
Proliferation assay of canine keratinocyte cell line (CPEK) with or without recombinant periostin (rPO). In vitro growth of CPEK was significantly enhanced by 4
µg/ml of rPO treatment (*P<0.05, vs vehicle control; unpaired t-test).
Proliferation assay of canine keratinocyte cell line (CPEK) with or without recombinant periostin (rPO). In vitro growth of CPEK was significantly enhanced by 4
µg/ml of rPO treatment (*P<0.05, vs vehicle control; unpaired t-test).
rPO-induced IL-25 and KDAP genes expression of canine keratinocyte cells
The microarray data discussed in the present study have been deposited in the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) of the National Center for Biotechnology Information (NCBI) and are accessible through GEO series accession number GSE77041. Among the genes induced by rPO, we focused on
IL-25 and KDAP because previous studies reported these genes to be overexpressed in chronic allergic dermatitis [11, 26].For validation of microarray results, we performed real time quantitative RT-PCR for the IL-25 and KDAP. Following 36 hr-treatment with rPO, IL-25 mRNA expression in CPEK was significantly increased compared with the
vehicle control (Fig. 6). Following 2 hr of rPO treatment, KDAP mRNA expression in keratinocytes was significantly increased as compared with the vehicle control (Fig. 7).
Fig. 6.
Quantitative analysis of mRNA levels of interleukin (IL)-25 in the cultured keratinocytes at 2, 6, 12, 24 and 36 hr after sensitization with 2 µg/ml recombinant periostin (rPO).
Following 36 hr of rPO-treatment, IL-25 mRNA expression in keratinocytes was significantly increased as compared with the vehicle control. Real time quantitative reverse transcription polymerase chain reaction
(RT-PCR; **P<0.01; vs vehicle control; unpaired t-test).
Fig. 7.
Quantitative analysis of mRNA levels of periostin (rPO) in the cultured keratinocytes at the indicated time 2, 6, 12, 24 and 36 hr after sensitization with 2 µg/ml rPO. Following
2 hr of PO treatment, keratinocyte differentiation-associated protein (KDAP) mRNA expression in keratinocytes was significant increased compared with vehicle control. Real time quantitative reverse transcription
polymerase chain reaction (RT-PCR; *P<0.05; vs vehicle control; unpaired t-test).
Quantitative analysis of mRNA levels of interleukin (IL)-25 in the cultured keratinocytes at 2, 6, 12, 24 and 36 hr after sensitization with 2 µg/ml recombinant periostin (rPO).
Following 36 hr of rPO-treatment, IL-25 mRNA expression in keratinocytes was significantly increased as compared with the vehicle control. Real time quantitative reverse transcription polymerase chain reaction
(RT-PCR; **P<0.01; vs vehicle control; unpaired t-test).Quantitative analysis of mRNA levels of periostin (rPO) in the cultured keratinocytes at the indicated time 2, 6, 12, 24 and 36 hr after sensitization with 2 µg/ml rPO. Following
2 hr of PO treatment, keratinocyte differentiation-associated protein (KDAP) mRNA expression in keratinocytes was significant increased compared with vehicle control. Real time quantitative reverse transcription
polymerase chain reaction (RT-PCR; *P<0.05; vs vehicle control; unpaired t-test).
DISCUSSION
Here we revealed that IL-13 mRNA-positive cells suspected of being T-lymphocytes located near the keratinocytes and dermal fibroblasts expressing PO mRNA in canine atopic skin. This indicates a close correlation between
IL-13 and PO mRNA-positive cells in canine atopic skin. In addition, we confirmed IL13RA1 gene expression in CPEK and cultured canine dermal fibroblasts, and rIL-13-induced PO gene expression in these
culture cells. And no TGF-β1 mRNA-positive cells were observed in canine atopic skins. These results strongly suggest that IL-13 induces PO production in keratinocytes and dermal fibroblasts in canine atopic skin
independent of TGF-β1. To the best of our knowledge, the present study is the first to indicate the close correlation between PO and IL-13 in spontaneous atopic skin. Corren et al. [4] reported that asthmatic patients with high pretreatment levels of serum PO had greater clinical improvement of lung function with administration of lebrikizumab, a monoclonal antibody to IL-13, than
patients with low serum PO levels. Furthermore, serum PO levels were significantly elevated in hAD patients compared with healthy humans, suggesting a close correlation between IL-13 and PO in AD [14].We revealed a subset of the functional roles of PO involved in the enhancement and chronicity of the pathological lesions in canine atopic skin by in vitro experiments. In accordance with previous reports
[6, 7, 14], we set the concentration of PO at 1–4 µg/ml. First, we
confirmed that rPO enhanced in vitro growth of canine keratinocytes. In addition, we showed gene expression of integrin αv, which was a receptor of PO, in both cultured canine keratinocytes and
dermal fibroblasts. Moreover, among the PO-induced genes detected by microarrays, we first identified IL-25 as a possible mediator in spontaneous atopic skin because quantitative RT-PCR analysis revealed upregulation of
IL-25 gene expression in PO-stimulated keratinocytes compared with that in the vehicle control.IL-25 (also termed IL-17E) is important for Th2-mediated immunity in a murine model of asthma, and impairs the skin barrier in ADpatients [8, 11, 27]. The IL-25 mRNA level is elevated in the lungs of asthmatic patients and in the skin of hAD patients [27]. Furthermore, PO
null mice showed amelioration of allergic airway inflammation and mucous metaplasia and reduction in Th2 cytokines mRNA expression including IL-25 by a house dust mite (HDM)-challenge compared with PO wild-type mice [2]. Collectively, we suspect that PO enhances Th2-immunoreaction via IL-25 signaling in canine atopic skin.PO has been reported to plays a role in enhancement of the proliferation and differentiation of keratinocytes using in vitro and in vivo experiments. A deficiency or blockage of PO
suppressed acanthosis induced by transdermal treatment with HDM extract in atopic model mice [14]. In the present study, for validation of microarray results, we performed
quantitative RT-PCR analysis and found temporal upregulation of KDAP gene expression in rPO-stimulated keratinocytes compared with the vehicle control at 2 hr after sensitization. KDAP (encoded by KRTDAP)
is a recently identified secretory protein that may act as a soluble regulator for the differentiation of keratinocytes [26, 28]. Yagihara
et al. [28] reported that KDAP was more widely spread in the spinous layer of the epidermis in chronic allergic dermatitis compared with healthy skin in dogs.
Acanthosis is a typical histopathological feature of hAD and cAD [14, 17]. Therefore, KDAP induced by PO may play a role in acanthosis of canine
atopic skins.The data in the present study suggest that IL-13 possibly derived from Th2 cells stimulates PO production in both keratinocytes and fibroblasts, and then PO may play a critical role in the enhancement and chronicity of
cAD via IL-25 and KDAP (Fig. 8). Despite treatment with inhaled glucocorticoids, some atopic patients and dogs develop uncontrolled skin lesions that require more intensive therapy [14, 18]. PO may contribute to the enhancement and chronicity of atopic skin inflammation by activating keratinocytes and dermal fibroblasts in the absence of environmental allergens in cAD and hAD.
Fig. 8.
The schema indicates hypothesis on the chronicity of inflammation via periostin (PO) in atopic skin. Interleukin (IL)-131) possibly derived from T helper 2 (Th2) cells stimulates PO production in both
keratinocytes2) and fibroblasts2’), then PO affects keratinocytes3) to enhance Th2-immunoreaction via IL-254), and to induce acanthosis directly5) or via
keratinocyte differentiation-associated protein (KDAP) 5′) in canine atopic skin. APCs: antigen-presenting cells.
The schema indicates hypothesis on the chronicity of inflammation via periostin (PO) in atopic skin. Interleukin (IL)-131) possibly derived from T helper 2 (Th2) cells stimulates PO production in both
keratinocytes2) and fibroblasts2’), then PO affects keratinocytes3) to enhance Th2-immunoreaction via IL-254), and to induce acanthosis directly5) or via
keratinocyte differentiation-associated protein (KDAP) 5′) in canine atopic skin. APCs: antigen-presenting cells.
Authors: Jonathan Corren; Robert F Lemanske; Nicola A Hanania; Phillip E Korenblat; Merdad V Parsey; Joseph R Arron; Jeffrey M Harris; Heleen Scheerens; Lawren C Wu; Zheng Su; Sofia Mosesova; Mark D Eisner; Sean P Bohen; John G Matthews Journal: N Engl J Med Date: 2011-08-03 Impact factor: 91.245
Authors: Christopher G Elliott; Jian Wang; Xiaolei Guo; Shi-wen Xu; Mark Eastwood; Jianjun Guan; Andrew Leask; Simon J Conway; Douglas W Hamilton Journal: J Cell Sci Date: 2012-01-20 Impact factor: 5.285
Authors: Lindsay Gillan; Daniela Matei; David A Fishman; C S Gerbin; Beth Y Karlan; David D Chang Journal: Cancer Res Date: 2002-09-15 Impact factor: 12.701
Authors: J Kelley Bentley; Qiang Chen; Jun Young Hong; Antonia P Popova; Jing Lei; Bethany B Moore; Marc B Hershenson Journal: J Allergy Clin Immunol Date: 2014-07-02 Impact factor: 10.793