Literature DB >> 29138639

Involvement of WNT Signaling in the Regulation of Gestational Age-Dependent Umbilical Cord-Derived Mesenchymal Stem Cell Proliferation.

Sota Iwatani1, Akemi Shono1, Makiko Yoshida2, Keiji Yamana1, Khin Kyae Mon Thwin1, Jumpei Kuroda3, Daisuke Kurokawa1, Tsubasa Koda4, Kosuke Nishida1, Toshihiko Ikuta1, Kazumichi Fujioka1, Masami Mizobuchi5, Mariko Taniguchi-Ikeda1, Ichiro Morioka1, Kazumoto Iijima1, Noriyuki Nishimura1.   

Abstract

Mesenchymal stem cells (MSCs) are a heterogeneous cell population that is isolated initially from the bone marrow (BM) and subsequently almost all tissues including umbilical cord (UC). UC-derived MSCs (UC-MSCs) have attracted an increasing attention as a source for cell therapy against various degenerative diseases due to their vigorous proliferation and differentiation. Although the cell proliferation and differentiation of BM-derived MSCs is known to decline with age, the functional difference between preterm and term UC-MSCs is poorly characterized. In the present study, we isolated UC-MSCs from 23 infants delivered at 22-40 weeks of gestation and analyzed their gene expression and cell proliferation. Microarray analysis revealed that global gene expression in preterm UC-MSCs was distinct from term UC-MSCs. WNT signaling impacts on a variety of tissue stem cell proliferation and differentiation, and its pathway genes were enriched in differentially expressed genes between preterm and term UC-MSCs. Cell proliferation of preterm UC-MSCs was significantly enhanced compared to term UC-MSCs and counteracted by WNT signaling inhibitor XAV939. Furthermore, WNT2B expression in UC-MSCs showed a significant negative correlation with gestational age (GA). These results suggest that WNT signaling is involved in the regulation of GA-dependent UC-MSC proliferation.

Entities:  

Year:  2017        PMID: 29138639      PMCID: PMC5613457          DOI: 10.1155/2017/8749751

Source DB:  PubMed          Journal:  Stem Cells Int            Impact factor:   5.443


1. Introduction

Mesenchymal stem cells (MSCs) are a heterogeneous cell population that has a potential to proliferate and differentiate into trilineage mesenchymal cells: adipocytes, osteocytes, and chondrocytes. MSCs were initially isolated and characterized from the bone marrow (BM) [1, 2] and subsequently derived from almost all tissues including adipose tissue (AT), synovium, skin, dental pulp, umbilical cord blood (UCB), placenta, and umbilical cord (UC) [3]. Due to the ability to home to sites of injury, undergo differentiation, suppress immune responses, and modulate angiogenesis, MSCs are paid an increasing attention as a source for cell therapy against various degenerative diseases. Currently, MSCs from different sources have been tested in clinical studies for treatment of graft-versus-host disease, myocardial infarction, cerebral infarction, and so on [4, 5]. Although BM is the most well-characterized source of MSCs, it has certain limitations with the invasive BM aspiration and the decline in MSC proliferation and differentiation capacity with age. In contrast, fetal MSCs obtained from UCB, placenta, and UC have advantages with the noninvasive sampling during newborn delivery and the vigorous proliferation and differentiation capacity for cell therapy [6, 7]. Especially, human UC starts to develop at 4–8 weeks of gestation, continues to grow until 50–60 cm in length, and is usually discarded as medical waste after newborn delivery. Taken together, UC-derived MSCs (UC-MSCs) will become a promising source for cell therapy [8, 9]. Various genes and signaling pathways are known to regulate MSC proliferation and differentiation. WNT signaling serves as a key regulator that influences various stages of embryonic development as well as tissue homeostasis in adulthood [10]. It affects the proliferation, self-renewal, and differentiation of various tissue stem cells and controls the various tissue renewal and regeneration in response to disease, trauma, and ageing [11]. WNT ligands, which comprise a family of 19 members in human, are evolutionally conserved, are lipid modified, and secreted glycoproteins. They can activate either β-catenin-dependent (canonical) or β-catenin-independent (noncanonical) pathways by acting on transmembrane receptor FZD and its coreceptors LRP5/LRP6. The canonical pathway inhibits the β-catenin destruction complex, associates the transcriptional coactivator β-catenin with the transcriptional factor complex TCF/LEF, and induces WNT target gene transcription. The noncanonical pathway is independent of β-catenin and mainly associates with Ca2+-dependent and JNK-dependent signaling pathways, which can impact on cell migration, cell polarity, and cytoskeletal organization. The molecular events occurring these noncanonical pathways are far less defined than the canonical pathway [12]. Early studies showed the profound impacts of WNT signaling on a variety of tissue stem cell proliferation and differentiation [13-15]. In MSCs, both stimulatory and inhibitory roles for WNT signaling in cell proliferation and differentiation into trilineage mesenchymal cells were documented [16]. The adipogenic differentiation of AT-derived MSCs (AT-MSCs) was inhibited by WNT signaling activation [17]. The potential of WNT signaling on osteogenic differentiation of MSCs was controversial, with both stimulatory and inhibitory effects being reported [18, 19]. An inhibitory effect of WNT signaling on chondrogenic differentiation was demonstrated in AT-MSCs [20]. Although UC can be obtained from a wide range of gestational age (GA) newborn as a result of preterm, term, and postterm delivery, their functional differences are poorly characterized [21]. An understanding of the molecular mechanisms controlling UC-MSC proliferation and differentiation is crucial to determining the drivers and effectors of the functional difference between different GA UC-MSCs as well as the most suitable use of UC-MSCs for cell therapy against degenerative diseases. In the present study, we isolated UC-MSCs from 23 infants delivered at 22–40 weeks of gestation and analyzed their gene expression and cell proliferation.

2. Materials and Methods

2.1. Patients and Samples

Human UCs were obtained from 23 infants delivered at 22–40 weeks of gestation with parental written consent. This study was approved by the Ethics Committee at Kobe University Graduate School of Medicine (approval number 1370) and Hyogo Prefectural Kobe Children's Hospital (approval numbers 24-25) and conducted in accordance with the approved guidelines.

2.2. Preparation of UC-MSC

The umbilical cord (2-3 g weight) was collected, cut into 2-3 mm pieces, enzymatically dissociated with Liberase DH Research Grade (Roche, Mannheim, Germany) in PBS for 45–60 min at 37°C followed by the addition of 10% fetal bovine serum (FBS; Sigma, St. Louis, MO) to inhibit enzyme activity, and filtered through a 100 μm cell strainer (BD Bioscience, Bedford, MA). The resulting cells derived from all compartments of the umbilical cord (whole UC) were cultured at 37°C (5% CO2 and 95% air) in MEM-α (Wako Pure Chemical, Osaka, Japan) containing 10% FBS and 1% antibiotic-antimycotic solution (Invitrogen, Carlsbad, CA) until confluent primary cultures were established. The cells were then disassociated with trypsin-EDTA (Wako Pure Chemical), and the trypsinized cells were seeded into fresh dishes and passaged to confluence. Serial passaging was carried out until the tenth passage. The cells at fifth to eighth passages were used in the present experiments.

2.3. Cell Surface Marker Analysis

UC-MSCs were dissociated with 0.25% trypsin-EDTA for 10 minutes, washed with PBS and suspended at ~1 × 106 cells/ml in FCM buffer containing 1 × PBS, 2 mM EDTA, and 10% Block Ace (Dainippon Pharmaceutical, Osaka, Japan). The cells were incubated with phycoeryhrin- (PE-) conjugated mouse primary antibodies against CD14, CD19, CD34, CD45, CD73, CD90, CD105, or HLA-DR (BD Bioscience, Franklin Lakes, NJ) for 45 min on ice, washed with PBS, incubated with Fixable Viability Stain 450 (BD Bioscience) for 15 min at room temperature, washed with PBS, and filtered through a 70 μm cell strainer (BD Bioscience). PE-conjugated mouse IgG1 k, IgG2a k, or IgG2b k isotype control (BD Bioscience) was used as a negative control for each primary antibody. Flow cytometric analysis was performed using FACSAria III carrying a triple laser (BD Bioscience) and FACSDiva software (BD Bioscience).

2.4. Cell Differentiation

To verify the multipotency of UC-MSCs, the cells were induced to differentiate into the adipogenic, osteogenic, and chondrogenic lineages. Adipogenic differentiation was induced in STEMPRO adipogenesis differentiation medium (Invitrogen) for 2-3 weeks and stained, and the differentiation was investigated by staining lipid vesicles with Oil Red O (Sigma). Osteogenic differentiation was induced in STEMPRO osteogenesis differentiation medium (Invitrogen) or STK-3 (DS Pharma Biomedical, Osaka, Japan) for 1-2 weeks, and the differentiation was examined by staining with Arizarin Red S (Sigma) reacting to calcium cation. Chondrogenic differentiation was induced by forming cell aggregates in micromass culture in STEMPRO chondorogenesis differentiation medium (Invitrogen) for 1 week, and the differentiation was assessed by staining anionic glycoconjugates with Toluidine Blue (Sigma). Cell images were acquired using a BZ-X700 microscope (Keyence, Osaka, Japan).

2.5. RNA Extraction

Total RNA from UC-MSCs and fibroblasts was extracted with a TRIZOL Plus RNA purification kit (Life Technologies) according to the manufacturer's instructions. RNA integrity was evaluated by Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) using RNA 6000 nanokit (Agilent Technologies) according to the manufacturer's instructions.

2.6. Gene Expression Microarray Analysis

Total RNA from three term and five preterm UC-MSCs (Table 1) was subjected to global gene expression analysis using the Low Input Quick Amp Labeling Kit One-Color (Agilent Technologies) and SurePrint G3 Human Gene Expression v3 8 × 60 K Microarray Kit (Agilent Technologies) according to the manufacturer's instruction. Briefly, double-stranded cDNA was synthesized from 100 ng of total RNA by AffinityScript-RT using T7 promoter-incorporated Oligo-dT primer. Cyanine 3- (Cy3-) CTP-incorporated RNA (cRNA) was generated using the second strand cDNA as a template via an in vitro transcription reaction. The amplified cRNA was purified with the RNeasy mini kit (Qiagen, Valencia, CA) and quantified cRNA by the NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA). 600 ng of Cy3-labeled cRNA was hybridized to the microarray slides at 65°C for 17 hr with rotation at 10 rpm. After hybridization, the slides were washed and scanned by the SureScan (Agilent Technologies), the images were subsequently extracted using the Feature Extraction Software (Agilent Technologies). Extracted data with good QC metrics were normalized (percentile shift to the 75th percentile) and filtered by gene expression (20.0–100.0 percentile), flags for signals and error for CV in the GeneSpring GX (v 14.5) (Agilent Technologies). The processed data were subjected to statistical analysis (moderated T-test with Benjamini-Hochberg FDR), and the corrected p value <0.05 was determined to be significant (n = 3–5). The following analyses were performed for further data interpretation: principal component analysis (PCA), clustering analysis, GO (gene ontology) analysis, and pathway analysis with curated datasets of WikiPathways (413 pathways) and KEGG (10 pathways). A gene-set list associated with human WNT signaling pathway (150 genes, 04310 from KEGG pathways) was obtained from a public database (https://www.stemformatics.org/).
Table 1

UC-MSC sample characteristics.

SampleGestational age (weeks)Birth weight (g)SexApgar score 1 minApgar score 5 minPaternal age (years)Maternal age (years)GravidityParityPerinatal historyMaternal complicationUsage in the present study
Pre-124530Female13423822Cesarean section due to non-reassuring fetal status involved with abruption of placentaPregnancy-induced hypertensionFigures 2, 3, 5, and 6, S
Pre-225656Male48263100Cesarean section due to active premature laborFigures 2, 3, 5, and 6, S
Pre-326338Male22373611Cesarean section due to active premature labor involved with placental hematomaFigures 2, 3, 4, 5, and 6, S
Pre-422550Male14262511Cesarean section due to active premature laborFigures 2, 3, 5, and 6, S
Pre-523530Female24323111Vaginal delivery due to active premature laborFigures 2, 3, 5, and 6, S
Pre-623478Female15323221Cesarean section due to active premature laborFigures 5 and 6, S
Pre-724642Male13161700Cesarean section due to active premature laborFigures 1, 5, and 6, S
Pre-826750Female59393821Cesarean section due to advancing pregnancy-induced hypertensionPregnancy-induced hypertension Graves' diseaseFigures 4, 5, and 6, S
Pre-926568Female47383621Cesarean section due to non-reassuring fetal statusLow-lying placenta Figure 4
Int-1301546Female78444200Cesarean section due to non-reassuring fetal status Figure 6, S
Int-2311170Male47272811Cesarean section due to non-reassuring fetal statusPregnancy-induced hypertension Figure 6, S
Int-3342062Female79484232Cesarean section due to non-reassuring fetal statusPregnancy-induced hypertension Figure 6, S
Term-1382550Male88373400Cesarean section due to placental previaFigures 2, 3, and 6, S
Term-2402546Male26404411Cesarean section due to non-reassuring fetal statusFigures 2, 3, and 6, S
Term-3383314Male88403300Cesarean section due to breech presentationFigures 2, 3, 5, and 6, S
Term-4372750Female89363300Cesarean section due to placental previaFigures 5 and 6, S
Term-5373062Male910353511Repeated cesarean section Figure 5
Term-6372776Female89424521Repeated cesarean sectionFigures 5 and 6, S
Term-7383390Male910322611Normal vaginal deliveryFigures 5 and 6, S
Term-8382960Male89383911Repeated cesarean sectionFigures 1, 5, and 6, S
Term-9383144Female88393911Repeated cesarean section Figure 4
Term-10382666Female89282800Cesarean section due to breech presentation Figure 4
Term-11392892Female99373110Cesarean section due to breech presentation Figure 4

2.7. Quantitative RT-PCR (RT-qPCR)

cDNA was synthesized from 1 μg of total RNA from UC-MSCs by using a QuantiTect reverse transcription kit (Qiagen). Real-time PCR analysis was performed with an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA) using FastStart Universal SYBR Green master mix (Roche) with 0.5 μM sense and antisense primers and cDNA (corresponding to 12.5 ng total RNA) according to the manufacturer's instructions. Each cDNA was amplified with a precycling hold at 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 60 sec, and one cycle at 95°C for 15 sec, 60°C for 60 sec, 95°C for 15 sec, and 60°C for 15 sec. Relative expression of each transcript was calculated based on the ΔΔCt method using β-actin (ACTB) as an endogenous reference for normalization. Primer sequences for WNT2, WNT2B, WNT3A, WNT4, WNT5B, WNT6, SFRP1, and ACTB were shown in Table 2. All sample measurements were repeated at least three times, and the results were expressed as the mean ± SE.
Table 2

Primers used for RT-qPCR.

Forward primerReverse primer
WNT2 tttggcagggtcctactcccctggtgatggcaaatacaa
WNT2B aacttacataataaccgctgtggtcactcacgccatggcactt
WNT3A aactgcaccaccgtccacaaggccgactccctggta
WNT4 gcagagccctcatgaacctcacccgcatgtgtgtcag
WNT5B gcgagaagactggaatcaggcagagcagccgtgaacag
WNT6 agagtgccagttccagttccgaacacgaaggccgtctc
SFRP1 gctggagcacgagaccattggcagttcttgttgagca
ACTB ccaaccgcgagaagatgaccagaggcgtacagggatag

2.8. Ki-67 Staining

Cell suspensions of UC-MSCs were centrifuged at 3000 rpm for 5 min, and two smears were immediately prepared. Slides were fixed in 95% ethanol for immunostaining or fixed in 20% formalin and 80% methanol and stained with hematoxylin and eosin (H&E), respectively. Immunostaining was performed with antibody against Ki-67 (Clone MIB-1, Dako, Santa Clara, CA) using Leica Bond-Max automation and Bond Polymer Refine detection kit (Leica Biosystems, Nussloch, Germany) according to manufacturer's instructions. IHC cytology protocol included primary antibody incubation for 15 min, post primary for 8 min, polymer for 8 min, peroxide block for 5 min, mixed DAB refine for 10 min, and followed by 5 min hematoxylin counterstaining.

2.9. MTS Assay

UC-MSCs were seeded at the density of 12,000 cells/well in a 12-well plate, incubated in 1 ml of MEM-α with 10% FBS in the presence or absence of 10 μM XAV939 (Selleck Chemicals, Houston, TX) at 37°C (5% CO2 and 95% air) for 24, 48, or 72 h. Cell proliferation was then determined by the CellTiter 96H AQueous One Solution Cell Proliferation Assay kit (Promega, Madison, WI, USA) according to the manufacturer's instruction. Briefly, 200 μl of MTS reagent (a tetrazolium compound) was added into each well and incubated at 37°C (5% CO2 and 95% air) for 4 h. The absorbance at 490 nm was measured using an EnSpire Microplate Reader (Perkin Elmer, Poland, OR). All experiments were repeated at least three times, and the results were expressed as the mean ± SE.

2.10. Statistical Analysis

Pearson's correlation coefficients were determined, and the Mann–Whitney U test was used to compare two independent datasets, using Excel software (Microsoft, Redmond, WA) and Excel Statistics (Statcel 3; Social Survey Research Information, Tokyo, Japan). Differences were considered statistically significant for p < 0.05.

3. Results

3.1. UC-MSCs Isolated from Infants Delivered at 22–40 Weeks of Gestation

We first obtained UCs from infants delivered at 22–40 weeks of gestation and then isolated the plastic-adherent cells from these UCs (Table 1). The cells exhibited a spindle-like shape (Figure 1(a)). Their cell surface markers were positive for MSC signature markers CD73, CD90, and CD105 but negative for hematopoietic, macrophage, and endothelial markers CD14, CD19, CD34, CD45, and HLA-DR by flow cytometric analysis (Figure 1(b)). There were no statistically significant differences in the percentages of MSC signature marker-positive cells (CD73: 99.9 ± 0.1% and 99.6 ± 0.4%, CD90: 99.9 ± 0.1% and 99.5 ± 0.5%, and CD105: 99.7 ± 0.3% and 99.5 ± 0.5%) between preterm and term UCs.
Figure 1

Characterization of UC-MSCs from term and preterm infants. (a) UC-MSCs from preterm (24 weeks of gestation, preterm UC-MSCs) and term (38 weeks of gestation, term UC-MSCs) newborns at passage numbers 6 to 7 were examined by phase-contrast microscopy. The images shown are representative of three independent experiments. Scale bars show 100 μm. (b) Preterm and term UC-MSCs were analyzed by flow cytometer using antibodies against MSC markers (CD14, CD19, CD34, CD45, CD73, CD90, CD105, and HLA-DR) defined by ISCT [22]. The histograms shown are representative of three independent experiments. (c) Preterm and term UC-MSCs were differentiated into adipocyte as visualized by Oil Red O and into osteocyte as visualized by Alizarin Red S and chondrocyte as visualized by Toluidine Blue. The images shown are representative of three independent experiments. Scale bars represent 50 μm.

Under standard in vitro differentiation conditions, both preterm and term UC-MSCs were induced to differentiate into osteocytes, adipocytes, and chondrocytes (Figure 1(c)). Preterm UC-MSCs did not qualitatively differ from term UC-MSCs in their capacity to differentiate into trilineage mesenchymal cells. Taken together, the resulting cells fulfilled the criteria defined by the ISCT position paper [22] and were defined as UC-MSCs.

3.2. Differentially Expressed Genes between Preterm and Term UC-MSCs

To get an insight into the functional difference between preterm and term UC-MSCs, we extracted total RNA from five preterm and three term UC-MSCs (Table 1) and performed microarray analysis. Principal component analysis (PCA) for global gene expression revealed that preterm UC-MSC samples were clustered together and were separated from term UC-MSC samples (Figure 2(a)). In total, 5578 unique genes (4272 upregulated and 1306 downregulated) showed greater than twofold-expression changes between preterm and term UC-MSCs with a corrected p value less than 0.05 (Figure 2(b), Supplementary Table S1 available online at https://doi.org/10.1155/2017/8749751). The pathway analysis of all differentially expressed genes identified significant enrichment of signaling pathways for immune/inflammatory reactions, cell-cell/cell-extracellular matrix interactions, glucose/lipid metabolism, and cell proliferation and differentiation (Table 3). Among these signaling pathways, we focused WNT signaling pathway that was previously implicated in the regulation of MSC proliferation and differentiation. Noticeably, 32/150 of WNT signaling pathway genes were overlapped with differentially expressed genes between preterm and term UC-MSCs (Figures 2(c) and 2(d)).
Figure 2

Gene expression microarray analysis of preterm and term UC-MSCs. (a) PCA mapping of gene expression profile for preterm (pre-1-5) and term (term-1-3) UC-MSCs. (b) Heat map of 5578 differentially expressed gene with greater than twofold changes in preterm UC-MSCs as compared to term UC-MSCs at a corrected p value less than 0.05. Green color refers to low levels of gene expression and red color to high levels. (c) Pie chart of altered expression genes and WNT signaling pathway genes. The list shows overlapped 32 genes. (d) Heat map of 32 genes extracted from (c). Green color refers to low levels of gene expression and red color to high levels.

Table 3

Pathway analysis of differentially expressed genes between preterm and term UC-MSCs.

Pathway p valueMatchedentitiesPathway entities
Hs_Interferon_alpha-beta_signaling_WP1835_832241.91E−0929122
Hs_GPCR_downstream_signaling_WP1824_833011.85E−07171919
Hs_Interferon_gamma_signaling_WP1836_832348.41E−0632170
Hs_NRF2_pathway_WP2884_830413.20E−0536143
Hs_Immunoregulatory_interactions_between_a_Lymphoid_and_a_non-Lymphoid_cell_WP1829_831645.33E−0532332
Hs_Gastrin-CREB_signalling_pathway_via_PKC_and_MAPK_WP2664_832661.55E−0442180
Hs_Focal_Adhesion_WP306_803082.25E−0445191
Hs_GPCR_ligand_binding_WP1825_833462.99E−0485438
Hs_Regulation_of_beta-cell_development_WP3513_834073.98E−041128
Hs_Glycerophospholipid_biosynthesis_WP2740_833414.59E−042696
Hs_Allograft_Rejection_WP2328_785545.49E−0424100
Hs_Extracellular_matrix_organization_WP2703_831066.47E−042278
Hs_Selenium_Micronutrient_Network_WP15_827056.56E−042384
MAPK signaling pathway7.53E−0455257
Hs_MicroRNAs_in_cardiomyocyte_hypertrophy_WP1544_752587.89E−0423104
Hs_DNA_Damage_Response_(only_ATM_dependent)_WP710_799748.29E−0429114
Hs_Parkin-Ubiquitin_Proteasomal_System_pathway_WP2359_721219.16E−042073
Hs_Cell_surface_interactions_at_the_vascular_wall_WP1794_838240.00108941552599
Hs_BDNF_signaling_pathway_WP2380_799530.001299625134144
Hs_Nuclear_Receptors_Meta-Pathway_WP2882_830400.001313857962318
Hs_Wnt_Signaling_Pathway_WP428_798540.00133065121967
Hs_B_Cell_Receptor_Signaling_Pathway_WP23_799850.00149926012598
Hs_MAPK_Signaling_Pathway_WP382_799510.001635024938168
Hs_SIDS_Susceptibility_Pathways_WP706_800560.001746409837166
Hs_O-linked_glycosylation_WP3315_832620.002034950525104
Hs_NGF_signalling_via_TRKA_from_the_plasma_membrane_WP1873_831470.00233170372077
Hs_Arachidonic_acid_metabolism_WP2650_830440.00265657761553
Hs_Vitamin_B12_Metabolism_WP1533_827070.00265657761553
Hs_Folate_Metabolism_WP176_827040.00282431041867
Hs_Nanoparticle-mediated_activation_of_receptor_signaling_WP2643_742510.00332638971028
Hs_Muscle_contraction_WP1864_832900.00339543141763
Hs_NCAM_signaling_for_neurite_out-growth_WP1866_833140.00339832621240
Hs_Corticotropin-releasing_hormone_WP2355_799730.00344431452392
Hs_Cori_Cycle_WP1946_796910.0037244426723
Hs_Eicosanoid_Synthesis_WP167_827020.0037961914825
Hs_Serotonin_Receptor_2_and_ELK-SRF-GATA4_signaling_WP732_800100.0037961914820
Hs_Semaphorin_interactions_WP1907_832710.00403357251867
Hs_Histidine,_lysine,_phenylalanine,_tyrosine,_proline_and_tryptophan_catabolism_WP3573_834630.0054898271239
Hs_ACE_Inhibitor_Pathway_WP554_777120.0055746404717
Hs_Integrin-mediated_Cell_Adhesion_WP185_800360.00569319424101
Hs_Prostaglandin_Synthesis_and_Regulation_WP98_720880.00585020431031
Hs_GPCRs,_Class_A_Rhodopsin-like_WP455_817930.006282676550262
Hs_Phase_1_-_Functionalization_of_compounds_WP1879_830570.00672252432188
Hs_Complement_and_Coagulation_Cascades_WP558_796800.0070090791661
Hs_Lipid_digestion,_mobilization,_and_transport_WP2764_831870.00712189731561
Hs_Type_II_diabetes_mellitus_WP1584_817790.0074452385822
Hs_miRNA_targets_in_ECM_and_membrane_receptors_WP2911_830200.0074452385845
Hs_Insulin_Signaling_WP481_827310.008487700534161
Hs_L1CAM_interactions_WP1843_830820.0088329672192
Hs_Calcium_Regulation_in_the_Cardiac_Cell_WP536_802110.00897518832150
Hs_Cell_junction_organization_WP1793_834020.0093559092085
Hs_XBP1(S)_activates_chaperone_genes_WP3472_832430.0107276122298
Hs_G1_to_S_cell_cycle_control_WP45_800010.0109317751768
Hs_Prostate_Cancer_WP2263_804390.01103618325117
Hs_Wnt_Signaling_Pathway_and_Pluripotency_WP399_794740.01132130123101
Hs_Human_Complement_System_WP2806_830050.01132130123136
Hs_Assembly_of_collagen_fibrils_and_other_multimeric_structures_WP2798_832310.0113662705929
Hs_DSCAM_interactions_WP1808_833720.0118092755511
Hs_Arrhythmogenic_Right_Ventricular_Cardiomyopathy_WP2118_712650.0120062861878
Hs_Endothelin_Pathways_WP2197_748520.01215774751033
Hs_Nuclear_Receptors_WP170_710830.0125465461138
Hs_Metapathway_biotransformation_WP702_735160.01343192834188
Hs_Potassium_Channels_WP2669_832720.01391017251559
Hs_Myometrial_Relaxation_and_Contraction_Pathways_WP289_810780.01439557932156
Hs_Collagen_biosynthesis_and_modifying_enzymes_WP2725_831300.0144584771454
Hs_Cardiac_Hypertrophic_Response_WP2795_785440.0144584771454
Hs_IL-3_Signaling_Pathway_WP286_785830.0149117171349
Hs_Hematopoietic_Stem_Cell_Differentiation_WP2849_830390.0153188281198
Hs_Telomere_Maintenance_WP1928_830970.0162105361561
Hs_Signaling_Pathways_in_Glioblastoma_WP2261_811970.0167991983
Glycolysis/Gluconeogenesis0.0177754051666
Hs_Reversible_hydration_of_carbon_dioxide_WP2770_831760.017944276512
Hs_Transport_of_inorganic_cations-anions_and_amino_acids-oligopeptides_WP1936_832670.018519322197
Hs_Neural_Crest_Differentiation_WP2064_792630.0192203222101
Hs_Signaling_by_the_B_Cell_Receptor_(BCR)_WP2746_831580.02034601424247
Hs_Adipogenesis_WP236_802090.0214582727131
Hs_Secretion_of_Hydrochloric_Acid_in_Parietal_Cells_WP2597_784850.02190148835
Pathways in cancer0.02305642359327
Hs_NLR_Proteins_WP288_800260.02675793410
Hs_Neurotransmitter_Release_Cycle_WP1871_832540.0271708821039
Hs_Transport_of_vitamins,_nucleosides,_and_related_molecules_WP1937_832070.0271708821038
Hs_S_Phase_WP2772_833950.0276941325123
Hs_Integrin_cell_surface_interactions_WP1833_831810.0284216011566
Hs_GABA_synthesis,_release,_reuptake_and_degradation_WP2685_830900.030757299619
Hs_Transport_of_glucose_and_other_sugars,_bile_salts_and_organic_acids,_metal_ions_and_amine_compounds_WP1935_831320.031666321100
Hs_Class_I_MHC_mediated_antigen_processing_&_presentation_WP3577_834670.03238653849330
Hs_Formation_of_Fibrin_Clot_(Clotting_Cascade)_WP1818_831430.0323938581039
Hs_Parkinsons_Disease_Pathway_WP2371_797660.0323938581071
Hs_ErbB_Signaling_Pathway_WP673_802020.0323957841355
Hs_Interferon_type_I_signaling_pathways_WP585_802010.0323957841354
Hs_Metabolism_of_water-soluble_vitamins_and_cofactors_WP1857_830830.0335786531993
Hs_Primary_Focal_Segmental_Glomerulosclerosis_FSGS_WP2572_799470.0339473151674
Hs_Glycolysis_and_Gluconeogenesis_WP534_785850.0344274981249
Hs_Interleukin-11_Signaling_Pathway_WP2332_795250.036419721144
Hs_Sleep_regulation_WP3591_838610.03828181039
Hs_Regulation_of_toll-like_receptor_signaling_pathway_WP1449_811720.0394049827149
Hs_PI_Metabolism_WP2747_831600.039729611251
Hs_Signal_regulatory_protein_(SIRP)_family_interactions_WP1909_831900.0397491411
Hs_Neurotoxicity_of_clostridium_toxins_WP2665_833210.0397491422
Hs_Overview_of_nanoparticle_effects_WP3287_829260.039779507622
Hs_Protein_folding_WP1892_831030.039869573934
Hs_Platelet_homeostasis_WP1885_831920.0412754271570
Hs_Synthesis_of_DNA_WP1925_831440.041895852098
Hs_Pathogenic_Escherichia_coli_infection_WP2272_785940.0424287131364
Hs_Mitotic_G1-G1-S_phases_WP1858_833150.04292910525128
Hs_Synaptic_Vesicle_Pathway_WP2267_785950.045577751251
Hs_Spinal_Cord_Injury_WP2431_803430.04672784423117
Hs_Gamma_carboxylation,_hypusine_formation_and_arylsulfatase_activation_WP2762_833880.04724196936
Hs_RAF-MAP_kinase_cascade_WP2735_831420.04790438336216
Hs_Binding_and_Uptake_of_Ligands_by_Scavenger_Receptors_WP2784_832170.04884686711195
Hs_Extracellular_vesicle-mediated_signaling_in_recipient_cells_WP2870_795550.04923168830
We then confirmed a subset of these WNT signaling pathway gene expressions by RT-qPCR using cDNA from the same five preterm and three term UC-MSCs as a template. A subset included secreted WNT ligands and modulators: WNT2, WNT2B, WNT3A, WNT4, WNT5B, WNT6, and SFRP1. Consistent with microarray analysis, upregulated WNT2, WNT2B, WNT3A, WNT4, and WNT6 showed increased expression in preterm UC-MSCs compared to term UC-MSCs by RT-qPCR (Table 4, Figure 3). Decreased expression of downregulated WNT5B and SFRP1 was also detected by RT-qPCR (Table 4, Figure 3). Collectively, these results suggested that WNT signaling pathway gene expression in preterm UC-MSCs was distinct from term UC-MSCs.
Table 4

Differentially expressed WNT pathway genes between preterm and term UC-MSCs.

GeneFC (pre versus term) p (Corr)
Ligands
WNT2 4.079170.01631
WNT2B 2.647910.02698
WNT3A 2.560170.02584
WNT6 2.355310.00938
WNT4 2.116230.00510
WNT5B −3.935330.01317
Receptors
FZD9 3.478200.04035
TCF7L2 2.292220.01187
Extracellular modulators
DKK4 3.790290.01143
DKK2 −2.653270.01720
SFRP1 −3.133360.00621
Intracellular signaling molecules
CCND2 3.498920.02933
DAAM2 2.712890.00467
CER1 2.401600.03446
MAPK8 2.360910.00501
NFATC4 2.256870.01089
APC2 2.217740.04864
PPP2R5B 2.209560.00501
PRKCB 2.117800.00504
CAMK2A 2.034430.02825
APC −2.018610.00578
FOSL1 −2.068720.03346
PRKACA −2.164030.02705
PPP2R1A −2.197190.04119
CCND3 −2.207270.01748
RUVBL1 −2.244270.02646
AXIN1 −2.478320.02670
RAC2 −2.518800.00902
TBL1X −2.732440.01261
DVL1 −2.772990.00726
NFATC3 −2.825610.02238
CCND1 −3.285800.03436
Figure 3

WNT signaling pathway gene expression in preterm and term UC-MSCs. The relative expression of WNT2, WNT2B, WNT3A, WNT4, WNT6, WNT5B, and SFRP1 mRNA in preterm (n = 3) and term (n = 5) UC-MSCs was analyzed by RT-qPCR. The mean of term UC-MSCs was set as 1. The results shown are the mean ± SE.

3.3. Cell Proliferation of Preterm and Term UC-MSCs

To examine the function of WNT signaling pathway genes in preterm and term UC-MSCs, we isolated UC-MSCs from nine preterm (22–26 weeks of gestation) and nine term (37–39 weeks of gestation) infants (Table 1) and analyzed their cell proliferation. We first evaluated the expression of Ki-67, a marker of proliferating cells expressed in all active phases of the cell cycle (G1, S, G2, and M), by immunocytochemistry [23]. The percentages of Ki-67-positive cells were markedly increased in preterm UC-MSCs as compared to term UC-MSCs, albeit not statistically significant (Figure 4).
Figure 4

Ki-67 staining of preterm and term UC-MSCs. (a) Smears of preterm (n = 3) and term (n = 3) UC-MSCs were prepared, immunostained with anti-Ki-67 antibody, and counterstained with hematoxylin. The images shown are representative of three independent experiments. (b) The percentage of Ki-67 positive was determined by manually counting 1000 cells and expressed as the mean ± SE.

We then analyzed cell proliferation of preterm and term UC-MSCs by MTS assay. Although both preterm and term UC-MSCs showed vigorous proliferation, the proliferation rate of preterm UC-MSCs measured at 72 h was significantly faster than term UC-MSCs (Figure 5(a)). Next, we examined the effect of WNT signaling inhibition on the growth of preterm and term UC-MSCs using a small molecule XAV939. XAV939 is a potent inhibitor of Tankyrase1 and Tankyrase2, and this inhibition stabilizes Axin1 and Axin2, the concentration-limiting component of the WNT pathway transcription factor β-catenin destruction complex. Increased levels of Axin1 and Axin2 stimulate β-catenin degradation and thereby inhibit β-catenin-mediated transcription [24]. Treatment of preterm UC-MSCs with 10 μM XAV939 resulted in significant inhibition of cell proliferation (Figure 5(b)). Term UC-MSC proliferation was also reduced by 10 μM XAV939, but there was no statistical significance (Figure 5(c)). These results suggest that WNT signaling is involved in the enhanced cell proliferation of preterm UC-MSCs compared to term UC-MSCs.
Figure 5

Cell proliferation of preterm and term UC-MSCs. Preterm (n = 8) and term (n = 6) UC-MSCs were cultured in the absence or presence of XAV939 for 24, 48, and 72 h. Their cell proliferation was determined by MTS assay and expressed as the percent increase. The results shown are the mean ± SE of (a) preterm and term UC-MSCs, (b) preterm UC-MSCs ± XAV939, and (c) term UC-MSCs ± XAV939.

3.4. Gestational Age-Dependent Expression of WNT Signaling Pathway Genes

We further analyzed WNT2, WNT2B, WNT3A, WNT4, WNT5B, WNT6, and SFRP1 expressions in UC-MSCs isolated from other 10 infants delivered at 22–40 weeks of gestation by RT-qPCR. Expression of these WNT signaling pathway genes tended to decrease or increase with gestational age. Among them, WNT2B expression showed a statistically significant negative correlation with gestational age (Figure 6, Supplementary Figure S1).
Figure 6

Gestational age-dependent expression of WNT signaling pathway genes. The relative expression of WNT2B mRNA in UC-MSCs isolated from 18 infants delivered at 22–40 weeks of gestation was analyzed by RT-qPCR. The mean of all UC-MSCs was defined as 1.

4. Discussion

In the present study, we isolated UC-MSCs from 23 infants delivered at 22–40 weeks of gestation and obtained the following findings. (1) Global gene expression in preterm UC-MSCs was distinct from term UC-MSCs. (2) WNT signaling pathway genes were enriched in differentially expressed genes between preterm and term UC-MSCs. (3) Preterm UC-MSC proliferation was faster than term UC-MSCs. (4) WNT signaling inhibitor XAV939 significantly inhibited the cell proliferation of preterm but not term UC-MSCs. (5) WNT2B expression in UC-MSCs showed a significant negative correlation with GA. MSCs are isolated from a variety of tissues and result in so heterogeneous population of cells, and not all of them express the same phenotypic markers. In the case of BM-MSCs, younger donor-derived BM-MSCs showed greater proliferative and differentiative potential than older counterparts and may have more potential for cell therapy [25, 26]. Although fetal MSCs could be isolated from newborns delivered at a wide range of GA as a result of preterm, term, and postterm delivery, their GA-dependent function remained poorly characterized [8, 9]. With regard to UCB-MSCs, the MSC population in UCB was significantly higher in preterm newborn compared to term newborn [27, 28]. In the case of UC-MSCs, MSCs were isolated from different UC compartments including cord lining, perivascular region (PV), Wharton's jelly (WJ), and whole UC [29-31]. Preterm UCs were shown to contain more perivascular cells (PVCs), identical to MSCs, than term UCs [32]. Preterm PVCs/UC-MSCs isolated from fetuses aborted at 8–12 weeks of gestation were reported to exhibit a greater proliferative potential, a more efficient differentiation into chondrogenic and adipogenic cell lineages, and a differential gene expression profile compared to term PVCs/UC-MSCs isolated from newborns delivered at 37–40 weeks of gestation [33]. Although we isolated UC-MSCs from the whole UC and preterm newborns delivered at 22–26 weeks of gestation, the present study and others supported that proliferative capacity of UC-MSCs declined with GA. Global gene expression analysis identified 5578 differentially expressed genes between preterm and term UC-MSCs (Figure 2(a), Table S1). The pathway analysis revealed significant enrichment of 111 signaling pathways (Table 3). Immune/inflammatory reaction-associated signaling pathways were top-ranked among the list (Table 3). The upregulation of interferon (IFN) signaling pathways in preterm UC-MSCs may be interpreted as the consequence of preterm delivery that has inherent fetal and/or maternal indications (Table 1, Table 3). Although cell cycle and senescence-associated secretory phenotype pathways were also expected to affect the growth rate and GA-dependent changes of UC-MSCs, these pathways were not included in the list (Table 3). WNT signaling is a key regulator of stem cell functions in development, renewal, and regeneration of multiple tissues [13-15]. In the case of MSCs, mRNA expression of a subset of WNT signaling pathway genes including WNT2, WNT4, WNT5A, WNT11, WNT16, SFRP2, SFRP3, and SFRP4 was detected in BM-MSCs [34]. WNT2, WNT2B, WNT4, WNT5A, WNT5B, SFRP1, and SFRP4 were also highly expressed in AT-MSCs under hypoxic stress conditions [35]. Comparison of BM-MSCs with UC-MSCs revealed lower differentiation capacity toward osteocytes and adipocytes along with the downregulation of WNT3A, WNT5A, WNT5B, WNT7B, WNT8A, SFRP1, and SFRP4 in UC-MSCs compared to BM-MSCs [36]. Consistent with these observations, the present study revealed a significant enrichment of WNT2, WNT2B, WNT3A, WNT4, WNT5B, WNT6, and SFRP1 in differentially expressed genes between preterm and term UC-MSCs (Figure 2(c)). Noticeably, WNT2, WNT2B, WNT4, WNT5B, WNT6, and SFRP1 were associated with a noncanonical WNT pathway, as opposed to only WNT3A with a canonical WNT pathway among these WNT ligands and modulators in UC-MSCs [12]. In contrast, the enhanced cell proliferation of preterm UC-MSCs was abolished by XAV939, which selectively decreased β-catenin expression through Tankyrase1 and Tankyrase2 inhibition and increased Axin1 and Axin2 expression (Figure 5) [24]. Accumulating evidence indicates that noncanonical WNT signaling can inhibit canonical WNT signaling [37, 38] and that activation of either canonical or noncanonical WNT signaling is highly dependent on the cell type and on specific receptors expressed by the cells [39, 40]. Further understanding of how WNT signaling pathway controls the GA-dependent proliferation of UC-MSC will be crucial to develop UC-MSC-based cell therapy. In summary, preterm UC-MSC proliferation is significantly faster than term UC-MSCs, and WNT signaling is involved in the regulation of this GA-dependent proliferation of UC-MSCs. Table S1: List of differentially expressed genes between preterm and term UC-MSCs. Figure S1: Gestational age-dependent expression of WNT signaling pathway genes. Figure S1 legend: Relative expression of WNT2, WNT3A, WNT4, WNT5B, WNT6, and SFRP1 mRNA in UC-MSCs isolated from 18 infants delivered at 22–40 weeks of gestation was analyzed by RT-qPCR. The mean of all UC-MSCs was defined as 1.
  39 in total

Review 1.  Cell-based therapies for the preterm infant.

Authors:  Dandan Zhu; Euan M Wallace; Rebecca Lim
Journal:  Cytotherapy       Date:  2014-08-22       Impact factor: 5.414

2.  Wnt5a inhibits canonical Wnt signaling in hematopoietic stem cells and enhances repopulation.

Authors:  Michael J Nemeth; Lilia Topol; Stacie M Anderson; Yingzi Yang; David M Bodine
Journal:  Proc Natl Acad Sci U S A       Date:  2007-09-19       Impact factor: 11.205

3.  A perivascular origin for mesenchymal stem cells in multiple human organs.

Authors:  Mihaela Crisan; Solomon Yap; Louis Casteilla; Chien-Wen Chen; Mirko Corselli; Tea Soon Park; Gabriella Andriolo; Bin Sun; Bo Zheng; Li Zhang; Cyrille Norotte; Pang-Ning Teng; Jeremy Traas; Rebecca Schugar; Bridget M Deasy; Stephen Badylak; Hans-Jörg Buhring; Jean-Paul Giacobino; Lorenza Lazzari; Johnny Huard; Bruno Péault
Journal:  Cell Stem Cell       Date:  2008-09-11       Impact factor: 24.633

Review 4.  The WNT signaling pathway from ligand secretion to gene transcription: molecular mechanisms and pharmacological targets.

Authors:  Hoeke A Baarsma; Melanie Königshoff; Reinoud Gosens
Journal:  Pharmacol Ther       Date:  2013-01-14       Impact factor: 12.310

Review 5.  "Mesenchymal" stem cells.

Authors:  Paolo Bianco
Journal:  Annu Rev Cell Dev Biol       Date:  2014-08-18       Impact factor: 13.827

6.  The mechanism of endogenous receptor activation functionally distinguishes prototype canonical and noncanonical Wnts.

Authors:  Guizhong Liu; Anna Bafico; Stuart A Aaronson
Journal:  Mol Cell Biol       Date:  2005-05       Impact factor: 4.272

7.  Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4.

Authors:  V Korinek; N Barker; P Moerer; E van Donselaar; G Huls; P J Peters; H Clevers
Journal:  Nat Genet       Date:  1998-08       Impact factor: 38.330

8.  Ontogeny of human umbilical cord perivascular cells: molecular and fate potential changes during gestation.

Authors:  Seok-Ho Hong; Leila Maghen; Shlomit Kenigsberg; Anouk-Martine Teichert; Ashley W Rammeloo; Ekaterina Shlush; Peter Szaraz; Schreiber Pereira; Ayub Lulat; Rong Xiao; Shang-Mian Yie; Andrée Gauthier-Fisher; Clifford L Librach
Journal:  Stem Cells Dev       Date:  2013-05-14       Impact factor: 3.272

9.  Differential expression of cell cycle and WNT pathway-related genes accounts for differences in the growth and differentiation potential of Wharton's jelly and bone marrow-derived mesenchymal stem cells.

Authors:  Aristea K Batsali; Charalampos Pontikoglou; Dimitrios Koutroulakis; Konstantia I Pavlaki; Athina Damianaki; Irene Mavroudi; Kalliopi Alpantaki; Elisavet Kouvidi; George Kontakis; Helen A Papadaki
Journal:  Stem Cell Res Ther       Date:  2017-04-26       Impact factor: 6.832

10.  Mesenchymal stem cells.

Authors:  A I Caplan
Journal:  J Orthop Res       Date:  1991-09       Impact factor: 3.494

View more
  6 in total

Review 1.  Treatment and application of stem cells from different sources for cartilage injury: a literature review.

Authors:  Pengzhen Wang; Shaoheng Zhang; Qingqi Meng; Pingping Zhu; Wei Yuan
Journal:  Ann Transl Med       Date:  2022-05

Review 2.  Significance of Placental Mesenchymal Stem Cell in Placenta Development and Implications for Preeclampsia.

Authors:  Yang Zhang; Yanqi Zhong; Li Zou; Xiaoxia Liu
Journal:  Front Pharmacol       Date:  2022-06-01       Impact factor: 5.988

3.  Induced pluripotent stem cell-derived conditional medium promotes Leydig cell anti-apoptosis and proliferation via autophagy and Wnt/β-catenin pathway.

Authors:  Xiaoling Guo; Yong Chen; Tingting Hong; Xianwu Chen; Yue Duan; Chao Li; Renshan Ge
Journal:  J Cell Mol Med       Date:  2018-04-18       Impact factor: 5.310

4.  Induced pluripotent stem cell-conditional medium inhibits H9C2 cardiomyocytes apoptosis via autophagy flux and Wnt/β-catenin pathway.

Authors:  Xiaoling Guo; Xiaohong Gu; Sohun Hareshwaree; Xing Rong; Lei Li; Maoping Chu
Journal:  J Cell Mol Med       Date:  2019-04-07       Impact factor: 5.310

5.  Peptidome analysis of umbilical cord mesenchymal stem cell (hUC-MSC) conditioned medium from preterm and term infants.

Authors:  Yu Wang; Lin Zhang; Yun Wu; Rongping Zhu; Yan Wang; Yan Cao; Wei Long; Chenbo Ji; Huaiyan Wang; Lianghui You
Journal:  Stem Cell Res Ther       Date:  2020-09-23       Impact factor: 6.832

6.  Glycyrrhizic Acid Promotes Osteogenic Differentiation of Human Bone Marrow Stromal Cells by Activating the Wnt/β-Catenin Signaling Pathway.

Authors:  Jinwu Bai; Jianxiang Xu; Kai Hang; Zhihui Kuang; Li Ying; Chenwei Zhou; Licheng Ni; Yibo Wang; Deting Xue
Journal:  Front Pharmacol       Date:  2021-04-16       Impact factor: 5.810

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.