Literature DB >> 29109920

Using genomic data to develop chloroplast DNA SSRs for the Neotropical liana Stizophyllum riparium (Bignonieae, Bignoniaceae).

Maila Beyer1, Alison G Nazareno1, Lúcia G Lohmann1.   

Abstract

PREMISE OF THE STUDY: We developed chloroplast microsatellite markers (cpSSRs) to be used to study the patterns of genetic structure and genetic diversity of populations of Stizophyllum riparium (Bignonieae, Bignoniaceae). METHODS AND
RESULTS: We used genomic data obtained through an Illumina HiSeq sequencing platform to develop a set of cpSSRs for S. riparium. A total of 36 primer pairs were developed, of which 28 displayed polymorphisms across 59 individuals from three populations. Two to 12 alleles were recorded, and the unbiased haploid diversity per locus ranged from 0.037 to 0.905. All 28 cpSSRs presented transferability to two closely related species, S. inaequilaterum and S. perforatum.
CONCLUSIONS: We report a set of 28 cpSSRs for S. riparium. All markers were shown to be variable in S. riparium, indicating that these markers will be valuable for population genetic studies across S. riparium and congeneric species.

Entities:  

Keywords:  Bignoniaceae; Neotropical flora; Stizophyllum inaequilaterum; Stizophyllum perforatum.; chloroplast microsatellites; cross-amplification

Year:  2017        PMID: 29109920      PMCID: PMC5664965          DOI: 10.3732/apps.1700061

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Stizophyllum Miers (Bignoniaceae) is a small genus of Bignonieae, the largest tribe in the Bignoniaceae (Lohmann and Taylor, 2014). The genus is clearly monophyletic (Lohmann, 2006) and includes three species, i.e., S. inaequilaterum Bureau & K. Schum., S. perforatum (Cham.) Miers, and S. riparium (Kunth) Sandwith (Lohmann and Taylor, 2014). All species of Stizophyllum are lianas with trumpet-shaped flowers that are pollinated by medium-sized bees (Gentry, 1974). Their winged seeds are dispersed by wind (Gentry, 1974). Members of Stizophyllum are easily recognized by their hollow stems, pellucid-punctate leaflets, urceolate calyces, and linear fruits (Lohmann and Taylor, 2014). The genus as a whole is broadly distributed, occurring from southern Mexico to the Atlantic Forest in southern Brazil (Lohmann and Taylor, 2014). Although the generic circumscription is clear, the three species of Stizophyllum currently recognized are morphologically similar and can occur sympatrically in Amazonia. Nuclear DNA polymorphisms based on microsatellites (simple sequence repeats [SSRs]) are powerful sources for population genetic studies (Kalia et al., 2011). These molecular markers, present also in the genomes of organelles (e.g., chloroplast), allow us to access genetic information that facilitates genotype identification, mainly due to their multiallelic nature (Masi et al., 2003). The chloroplast microsatellite and nuclear microsatellite markers (cpSSR and nSSR, respectively) have been widely used to study phylogenetic and genetic diversity in plants (Kalia et al., 2011). Unlike nSSRs, which are highly polymorphic, codominant, and biparentally inherited, cpSSRs are a nonrecombinant molecule and uniparentally inherited, allowing us to trace the history of populations through their haplotype diversity (Ebert and Peakall, 2009). Despite these differences, the two markers are complements for understanding the genetic structure in natural populations (Ebert and Peakall, 2009; Kalia et al., 2011). Furthermore, the advent of high-throughput sequencing technologies (Metzker, 2010) has allowed the development of SSR markers for multiple taxonomic groups (Zalapa et al., 2012; Francisco et al., 2016). Here, we used chloroplast genome sequence data obtained by de novo and reference-guided assembly to develop and characterize chloroplast microsatellite markers for S. riparium. Cross-amplification of the cpSSR markers developed for S. riparium was tested in all congeneric species to evaluate the utility of those markers for population genetic studies in Stizophyllum as a whole.

METHODS AND RESULTS

We first obtained the chloroplast genome sequence of S. riparium using an Illumina platform. For that, we extracted the genomic DNA from fresh leaf material dried in silica gel from a single individual of S. riparium (voucher: Nogueira 170; Appendix 1) collected in Manaus (Amazonas State, Brazil) using the Invisorb Spin Plant Mini Kit (Invitek, Berlin, Germany) and following the manufacturer’s instructions. Approximately 5 μg of total DNA was fragmented using a Covaris S-Series Focused-ultrasonicator (Covaris, Woburn, Massachusetts, USA) and a short-insert (300 bp) library was constructed with NEBNext DNA Library Prep Master Mix Set and NEBNext Multiplex oligos for Illumina (New England BioLabs, Ipswich, Massachusetts, USA), following the manufacturer’s protocol. The library concentration was diluted to 10 mM and sequenced (single end) on an Ilumina HiSeq 2000 system (Illumina, San Diego, California, USA) at the University of São Paulo (Escola Superior de Agricultura Luiz de Queiroz da Universidade de São Paulo [ESALq]) in Piracicaba, Brazil. A Perl script was used to filter for quality using a Phred score of 20 or more for the cleaned reads, with the exclusion of reads with more than three uncalled bases, or shorter than 40 bp. We used a combination of reference-guided and de novo assembly to construct the chloroplast genome of S. riparium following Nazareno et al. (2015). The chloroplast genome for S. riparium was annotated using DOGMA (Dual Organellar GenoMe Annotator; Wyman et al., 2004; http://dogma.ccbb.utexas.edu/). Start and stop codons were inspected and adjusted manually. The Imperfect Microsatellite Extractor (IMEx) interface (Mudunuri and Nagarajaram, 2007) was used to detect perfect microsatellites, with a threshold of 10 repeat units for mononucleotide and six repeats for di-, tri-, tetra-, penta-, and hexanucleotides. The annotated chloroplast genome was used to select markers located in noncoding regions exclusively. Primer pairs were designed from microsatellite sequence sites using Primer3web 4.0 (Rozen and Skaletsky, 1999), with the following parameters: primer size of 18–23 bp, temperature of 50–62°C with maximum difference between forward and reverse primers of 1°C, and GC content of 40–80%. In total, 36 primer pairs were designed. The PCR amplifications were performed in a final volume of 10 μL and contained 15 ng of genomic DNA, 0.5 μL (10 mM) of each primer with forward primers labeled with 6-FAM or JOE fluorescent dyes (Macrogen, Seoul, South Korea; Table 1), 0.6 μL (25 mM) MgCl2 (Promega Corporation, Madison, Wisconsin, USA), and 5 μL 1× of KAPA2G Fast ReadyMix (Kapa Biosytems, Wilmington, Massachusetts, USA). The cycling conditions were as follows: an initial denaturation step of 3 min at 94°C; followed by 30 cycles of 30 s at 94°C for denaturation, 30 s at the specific annealing temperature for each primer pair (Table 1), and 72°C for 60 s; and a final extension of 5 min at 72°C. To test the utility of the individual primers, PCR products were detected using a 1.0% agarose gel electrophoresis with a 100-bp range DNA ladder (Promega Corporation).
Table 1.

Characteristics of 28 intergenic chloroplast microsatellite markers developed for Stizophyllum riparium.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)Ta (°C)Fluorescent dyeaPositionGenBank accession no.
Stiz2F: CCTTGTTGGTTAGTTGAGTTCC(A)6(G)10211–21649.9JOEtrnK-UUU/rps16KP863512
R: GGGGTAGCGACTTGTATATAACT
Stiz3F: AGGAAGTTTTCTCCTCGTAC(T)10170–17654.0JOErps16/rps16KP863513
R: CTTGAGTTATGAGTACGAATGG
Stiz4F: ATCTAATGATCCGGGGCG(A)10160–16955.86-FAMpsbI/trns-GCUKP863514
R: TTCCCTTTCCGTTGATGACT
Stiz5F: CCCTTCCCGAACCAAACATG(A)11176–18157.4JOEatpF/atpFKP863515
R: TTGTCAGAAGAGTCCTCCAAGT
Stiz6F: GCCACACATACATTGCTTTGC(A)12143–15057.4JOEatpH/atpIKP863516
R: TCCCTGTCATGTTCCTTGGA
Stiz7F: TCCTAGTATGCTGGCCAACA(A)10164–17157.4JOErps2/rpsC2KP863517
R: AGAAGAGAAGGTTCCATCGGA
Stiz10F: CCAACCTAAAATTCTTCCGA(T)10165–17357.46-FAMpetN/psbMKP863519
R: CTTATAGAAAGTGCGGTGC
Stiz11F: CAGATTGCCTTTCCACTTCGA(A)10190–19954.0JOEpsbM/trnD-GUCKP863520
R: TCGAAGAAATCCCCAACCCT
Stiz12F: GGATTTCTTCGATGGGCCCT(A)11167–18056.96-FAMpsbM/trnD-GUCKP863521
R: GCCAGTCCCGACAGATCC
Stiz13F: CCTGTTCTTTCCATGACCCC(T)10201–21054.0JOEpsbC/trnS-UGAKP863522
R: AAAGAAAGGGGAATGGCTCG
Stiz14F: GCATAGCTAGCAATCCATTCT(A)13136–14954.0JOEpsaA/ycf3KP863523
R: GGAACAATTGGAATAGAATGCC
Stiz15F: CATTCCTCGGCTTTCATTCGT(A)1090–9651.76-FAMtrnT-UGU/trnL-UAAKP863525
R: TCTTCCTGCCATTTCTCCCA
Stiz18F: CATTCGTTCTTCAGCCTCA(T)10179–18454.7JOEycf4/cemAKP863527
R: TTGAGTTGCATGGATTTGGA
Stiz20F: TTCTAGGAGGCTTGTCTTCC(T)12183–19156.96-FAMpetA/psbJKP863528
R: TGTCCACTACTTTACTGTACGT
Stiz21F: TACTGCGTCAATTGCCAATT(T)10186–19748.66-FAMpetL/petGKP863529
R: TCACCACGCCTGTATTGTAA
Stiz22F: ACCCACCTATACAGTAACGGT(T)10161–16956.9JOErpl20/rpl1sKP863531
R: TCTCCATTGGTAGCAAATGGT
Stiz23F: GATTCTCTATCTGCTGTGTG(A)10153–16256.96-FAMClpP/psi_psbTKP863532
R: TCTTGAATGGAAAGTAAGGG
Stiz24F: AGTCGAGTATCTGAAACACGA(A)11179–18361.46-FAMpsbH/petBKP863534
R: AGAACCATTGGATCATCACGT
Stiz25F: TGGAGGAGAAACGATATTAG(T)11168–17561.4JOEinfA/rps8KP863535
R: CTTCTCGAGGTATAATGACA
Stiz26F: TCTAGCCATATCAGCATTTCGT(T)10168–17061.46-FAMrps8/rpl14KP863536
R: GTGTCTCACGGCATATACCT
Stiz27F: TCTTCTCATCCAGCTCCTCG(T)10243–24853.2JOErpl16/rps3KP863537
R: CGAATAAGCGCTACGACTGA
Stiz28F: GTCCTTTATCCAAGTTTACC(A)10168–16955.8JOErpl16/rps3KP863538
R: TCTTACTGATTCACTAGTCG
Stiz33F: TGGATCTCTCAGTCTAAGCAGG(T)13230–23849.96-FAMycf1/ycf1KP863539
R: CCACAAGCCGAGGAGATCTT
Stiz34F: GACACGCAGGATAATTCATA(T)10182–20656.9JOEycf1/ycf1KP863540
R: TCCCAGAATGAATACAGAAC
Stiz36F: ACATCCCTATTTCCTCCATTG(TA)6168–17056.96-FAMtrnP-UGG/psaJKP863530
R: TCTTAGCGAGTAGTTCCGA
Stiz39F: CTCTAACCTCTGAGCTAAGC(ATA)4175–17658.0JOEtrnT-UGU/trnL-UAAKP863524
R: CGAAATTCTATATCGCTGCA
Stiz40F: GATCCAAGAAATTACAGGAC(TAA)4130–13253.2JOEtrnL-UAA/trnF-GAAKP863526
R: TGAGCTATCCTGACCATT
Stiz45F: GAAATCCCATATGACCCA(TCTCTT)7156–17153.2JOEClpP/psi_psbTKP863533
R: CCCCAAAGAAAGAGAAAG

Note: Ta = annealing temperature.

Fluorescent label used for the forward primer sequence.

Characteristics of 28 intergenic chloroplast microsatellite markers developed for Stizophyllum riparium. Note: Ta = annealing temperature. Fluorescent label used for the forward primer sequence. Of the 36 primer pairs tested, 28 successfully amplified (Table 1) and were checked for polymorphism in 59 individuals from three S. riparium populations (ranging from 18 to 22 individuals; Appendix 1). All samples tested were also extracted using fresh leaf material dried in silica gel or from herbarium specimens using the Invisorb Spin Plant Mini Kit, following the manufacturer’s instructions. The amplicons with fluorescent labels were resolved to genotype on an ABI 3500 XL automated DNA sequencer with GeneScan 500 ROX Size Standard (Applied Biosystems, Foster City, California, USA). The microsatellite marker profiles were analyzed using GeneMarker (Holland and Parson, 2011). For each cpSSR, the number of alleles (A) and unbiased haploid diversity index (h) were obtained using GenAlEx 6.41 (Peakall and Smouse, 2006). In addition, we calculated chloroplast haplotype variation within populations by estimating the total number of haplotypes and the unbiased haplotype diversity as He = [n/(n − 1)](1 − ∑pi2), where n is the number of individuals analyzed in each population and p is the frequency of the ith haplotype in the respective population (Nei, 1978). Cross-amplification of polymorphic cpSSRs was tested in six individuals of S. inaequilaterum and S. perforatum using the same PCR conditions described above. A partial chloroplast genome (128,239 bp) was obtained and used to develop a set of 28 polymorphic cpSSRs (Table 2). The number of alleles ranged from two to 12, and unbiased haplotype diversity varied from 0.037 (Stiz40) to 0.905 (Stiz45) (Table 2). When alleles at each of the 28 loci were jointly analyzed, we observed 18, 19, and 22 haplotypes for EAM (i.e., east of Amazonia), CAM (i.e., Central America), and SAM (i.e., south of Amazonia) populations, respectively. Furthermore, the maximum unbiased haplotype diversity (He = 1.00) was observed for all S. riparium populations. All polymorphic cpSSR markers successfully amplified for S. inaequilaterum and S. perforatum (Table 3).
Table 2.

Characteristics of 28 polymorphic chloroplast microsatellite markers in three populations of Stizophyllum riparium.

LocusCAM (n = 19)SAM (n = 22)EAM (n = 18)All (n = 59)
AhAhAhAh
Stiz230.36840.61440.65460.660
Stiz340.55120.52440.57560.671
Stiz450.71930.62630.45190.773
Stiz530.55020.09520.12540.533
Stiz630.43340.72620.20960.668
Stiz740.61830.51120.52960.719
Stiz1050.69320.50520.11860.633
Stiz1120.52930.42640.80250.653
Stiz1250.68340.67140.71260.760
Stiz1340.41960.76630.38570.584
Stiz1470.85080.88440.600100.893
Stiz1540.57520.46740.58260.627
Stiz1830.60840.63330.22860.588
Stiz2030.34280.83320.29490.780
Stiz2170.59650.74530.60180.717
Stiz2210.00020.41640.46750.703
Stiz2340.64240.67630.58260.698
Stiz2420.44130.70620.11140.665
Stiz2520.52530.55220.52340.732
Stiz2630.63220.39510.00030.420
Stiz2740.60830.38630.60040.625
Stiz2820.12520.23310.00020.458
Stiz3340.41950.73720.30990.796
Stiz3420.48530.33820.47650.725
Stiz3620.26430.45120.11130.516
Stiz3930.54220.52110.00030.493
Stiz4010.00020.10010.00020.037
Stiz4550.78890.90030.621120.905
Mean3.40.5003.60.5512.60.3815.70.644

Note: A = number of alleles; h = unbiased haploid diversity.

Voucher and locality information are provided in Appendix 1.

Table 3.

Transferability of 28 chloroplast microsatellite markers developed for Stizophyllum riparium across two related Stizophyllum species.

LocusRepeat motifS. perforatumS. inaequilaterum
Stiz2(A)6(G)10++
Stiz3(T)10++
Stiz4(A)10++
Stiz5(A)11++
Stiz6(A)12++
Stiz7(A)10++
Stiz10(T)10++
Stiz11(A)10++
Stiz12(A)11++
Stiz13(T)10++
Stiz14(A)13++
Stiz15(A)10++
Stiz18(T)10++
Stiz20(T)12++
Stiz21(T)10++
Stiz22(T)10++
Stiz23(A)10++
Stiz24(A)11++
Stiz25(T)11++
Stiz26(T)10++
Stiz28(T)10++
Stiz27(A)10++
Stiz33(T)13++
Stiz34(T)10++
Stiz36(TA)6++
Stiz39(ATA)4++
Stiz40(TAA)4++
Stiz45(TCTCTT)7++

Successful amplification (+) evidenced by the occurrence of a distinct single band on the sequencing gel.

Characteristics of 28 polymorphic chloroplast microsatellite markers in three populations of Stizophyllum riparium. Note: A = number of alleles; h = unbiased haploid diversity. Voucher and locality information are provided in Appendix 1. Transferability of 28 chloroplast microsatellite markers developed for Stizophyllum riparium across two related Stizophyllum species. Successful amplification (+) evidenced by the occurrence of a distinct single band on the sequencing gel.

CONCLUSIONS

We developed and characterized 28 chloroplast microsatellite markers for S. riparium. Due to the high rate of cross-amplification (100%), these chloroplast microsatellite markers will be useful for genetic studies involving Stizophyllum as a whole.
Appendix 1.

Voucher and locality information for all individuals of Stizophyllum sampled.

SpeciesPopulation codeLocalityGeographic coordinatesVoucher no.a
Stizophyllum riparium (Kunth) SandwithCAZ Brazil, Amazonas, Manaus3°00′14″N, 59°55′07″WA. Nogueira 170*
CAMMexico, Campache, Calakmul18°48′39″N, 89°18′28″WD. Álvarez 50271
CAMMexico, Quintana Roo, Playa del Carmen20°36′58″N, 87°03′58″WE. Cabrera 64501
CAMMexico, Yucatan, Buctzotz21°12′60″N, 88°45′60″WE. Cabrera 137161
CAMMexico, Quintana Roo, Adolfo de la Huerta19°34′45″N, 89°03′31″WD. Álvarez 94691
CAMMexico, Campache, Calakmul18°32′27″N, 89°54′53″WD. Álvarez 51681
CAMBelize, Toledo, Maya Mts.16°24′25″N, 89°06′07″WB. K. Holst 43191
CAMBelize, Cayo17°21′05″N, 88°55′12″WD. E. Atha 10401
CAMMexico, Chipas, Ocosingo16°54′18″N, 92°02′17″WE. Martinez 124991
CAMMexico, Chipas, Ocosingo17°01′39″N, 91°16′31″WJ. P. Abascal 791
CAMMexico, Chipas, Ocosingo17°01′30″N, 91°18′22″WG. Aguilar 16881
CAMMexico, Veracruz, Los Tuxtla18°34′60″N, 95°05′60″WC. S. Sinaca 15611
CAMMexico, Veracruz, San Andres Tuxtla18°26′60″N, 95°12′58″WC. S. Sinaca 3391
CAMGuatemala, Peten, San Jose17°01′39″N, 89°52′60″WB. Wallnöfer 59071
CAMCosta Rica, Puntarenas, Peninsula de Osla8°24′01″N, 83°17′30″WR. Aguilar 19601
CAMCosta Rica, Guanacaste, Nandayure9°50′57″N, 85°20′26″WA. Estrada 871
CAMCosta Rica, Puntareans, Palmar Norte8°58′60″N, 83°27′60″WA. H. Gentry 788031
CAMCosta Rica, San José, Tircoles9°47′29″N, 84°31′37″WJ. F. Morales 40121
CAMCosta Rica, Puntarenas, Golfito8°33′03″N, 83°20′60″WA. Azofeifa 7191
CAMCosta Rica, Puntarenas, Bueno Aires9°02′04″N, 83°25′49″WL. González 8971
EAMBrazil, Pará, Parauapebas06°10′12″S, 50°21′02″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°09′46″S, 50°20′52″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°10′13″S, 50°21′04″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°09′45″S, 50°20′51″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°09′48″S, 50°20′52″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°10′08″S, 50°21′01″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°10′04″S, 50°21′02″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°10′04″S, 50°21′02″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°10′02″S, 50°21′02″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°09′46″S, 50°20′51″WM. Beyer 295
EAMBrazil, Pará, Parauapebas06°09′48″S, 50°20′53″WM. Beyer 301
EAMBrazil, Pará, Parauapebas06°09′36″S, 50°25′21″WM. Beyer 302
EAMBrazil, Pará, Parauapebas06°04′10″S, 50°14′46″WM. Beyer 303
EAMBrazil, Pará, Parauapebas06°03′55″S, 50°12′57″WM. Beyer 303
EAMBrazil, Pará, Parauapebas06°04′14″S, 50°14′44″WM. Beyer 303
EAMBrazil, Pará, Novo Repartimento04°19′57″S, 49°56′57″WM. Beyer 315
EAMBrazil, Pará, Altamira03°12′20″S, 51°14′56″WM. Beyer 317
EAMBrazil, Pará, Moju03°50′25″S, 46°06′40″WM. Beyer 318
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°35′28″S, 56°30′49″WM. Beyer 353
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°23′13″S, 56°30′07″WM. Beyer 354
SAMBrazil, Mato Grosso, Paranaíta9°31′48″S, 9°31′48″WM. Beyer 356
SAMBrazil, Mato Grosso, Paranaíta9°31′48″S, 9°31′48″WM. Beyer 356
SAMBrazil, Mato Grosso, Paranaíta9°31′48″S, 9°31′48″WM. Beyer 356
SAMBrazil, Mato Grosso, Paranaíta9°31′48″S, 9°31′48″WM. Beyer 356
SAMBrazil, Mato Grosso, Paranaíta9°31′48″S, 9°31′48″WM. Beyer 356
SAMBrazil, Mato Grosso, Paranaíta9°31′48″S, 9°31′48″WM. Beyer 356
Stizophyllum perforatum (Cham.) MiersBrazil, São Paulo, Candido Mota22°45′27″S, 50°22′06″WJ. P. Souza 9703
Brazil, Paraná, Londrina23°34′12″S, 50°57′42″WL. H. M. Fonseca 105
Brazil, Paraná, Londrina23°34′12″S, 50°57′42″WL. H. M. Fonseca 103
Brazil, Minas Gerais, Belo Horizonte11°54′S, 71°22′WJ. Lombardi 24311
Brazil, Rio de Janeiro, São Pedro de Aldeia22°50′10″S, 42°06′13″WJ. A. Kallunki s.n.
Brazil, Piauí, Eliseu Martins08°05′27″S, 43°39′42″WP. Martins & E. Nunes s.n.4
Stizophyllum inaequilaterum Bureau & K. Schum.Brazil, Acre, Marechal Taumaturgo08°56′29″S, 72°47′33″WL. G. Lohmann 454
Equador, Amazonia, Orellana0°40′59″S, 76°24′WH. Romero-Saltos 2831
Peru, Ucayali, Pedro Abad09°09′02″S, 75°47′20″WJ. Schunke-Vigo 15997
French Guiana, Saul03°37′22″N, 53°12′34″WS. A. Mori 242422
Peru, San Martin, Tocache08°11′22″S, 76°30′57″WJ. Schunke-Vigo 146093
Brazil, Amazonas, Letícia04°12′19″S, 69°55′58″WA. H. Gentry 18302

Note: CAM = Central America; CAZ = Central Amazonia; EAM = east of Amazonia; SAM = south of Amazonia.

aMost specimens are deposited at the Herbarium of the University of São Paulo (SPF), São Paulo, Brazil, except for 20 samples (1) that are deposited at the Missouri Botanical Garden Herbarium (MO), St. Louis, Missouri, USA; one sample (2) that is deposited at the Herbarium of the Muséum National d’Histoire Naturelle (P), Paris, France; one sample (3) that is deposited at the New York Botanical Garden Herbarium (NY), Bronx, New York, USA; and one sample (4) that is deposited at the Herbarium of the Federal University of Ceará (EAC), Fortaleza, Ceará, Brazil.

Sample used for DNA extraction.

  12 in total

1.  Automatic annotation of organellar genomes with DOGMA.

Authors:  Stacia K Wyman; Robert K Jansen; Jeffrey L Boore
Journal:  Bioinformatics       Date:  2004-06-04       Impact factor: 6.937

Review 2.  Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences.

Authors:  Juan E Zalapa; Hugo Cuevas; Huayu Zhu; Shawn Steffan; Douglas Senalik; Eric Zeldin; Brent McCown; Rebecca Harbut; Philipp Simon
Journal:  Am J Bot       Date:  2011-12-20       Impact factor: 3.844

3.  GeneMarker® HID: A reliable software tool for the analysis of forensic STR data.

Authors:  Mitchell M Holland; Walther Parson
Journal:  J Forensic Sci       Date:  2010-09-30       Impact factor: 1.832

4.  Estimation of average heterozygosity and genetic distance from a small number of individuals.

Authors:  M Nei
Journal:  Genetics       Date:  1978-07       Impact factor: 4.562

5.  Untangling the phylogeny of neotropical lianas (Bignonieae, Bignoniaceae).

Authors:  Lúcia G Lohmann
Journal:  Am J Bot       Date:  2006-02       Impact factor: 3.844

6.  Chloroplast simple sequence repeats (cpSSRs): technical resources and recommendations for expanding cpSSR discovery and applications to a wide array of plant species.

Authors:  Daniel Ebert; Rod Peakall
Journal:  Mol Ecol Resour       Date:  2009-01-28       Impact factor: 7.090

Review 7.  Sequencing technologies - the next generation.

Authors:  Michael L Metzker
Journal:  Nat Rev Genet       Date:  2009-12-08       Impact factor: 53.242

8.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

9.  Complete Chloroplast Genome of Tanaecium tetragonolobum: The First Bignoniaceae Plastome.

Authors:  Alison Gonçalves Nazareno; Monica Carlsen; Lúcia Garcez Lohmann
Journal:  PLoS One       Date:  2015-06-23       Impact factor: 3.240

10.  A genomic approach for isolating chloroplast microsatellite markers for Pachyptera kerere (Bignoniaceae).

Authors:  Jessica N C Francisco; Alison G Nazareno; Lúcia G Lohmann
Journal:  Appl Plant Sci       Date:  2016-09-19       Impact factor: 1.936

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.