Literature DB >> 29087937

Correction: KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer.

Elsa Beyer Krall, Belinda Wang, Diana M Munoz, Nina Ilic, Srivatsan Raghavan, Matthew J Niederst, Kristine Yu, David A Ruddy, Andrew J Aguirre, Jong Wook Kim, Amanda J Redig, Justin F Gainor, Juliet A Williams, John M Asara, John G Doench, Pasi A Janne, Alice T Shaw, Robert E McDonald Iii, Jeffrey A Engelman, Frank Stegmeier, Michael R Schlabach, William C Hahn.   

Abstract

Entities:  

Keywords:  cancer biology

Year:  2017        PMID: 29087937      PMCID: PMC5663476          DOI: 10.7554/eLife.33173

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


× No keyword cloud information.
Krall BE, Wang B, Munoz DM, Ilic N, Raghavan S, Niederst MJ, Yu K, Ruddy DA, Aguirre AJ, Kim JW, Redig AJ, Gainor JF, Williams JA, Asara JM, Doench JG, Janne PA, Shaw AT, McDonald III RE, Engelman JA, Stegmeier F, Schlabach MR, Hahn WC. 2017. KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer. eLife 6:e18970. doi: 10.7554/eLife.18970. Published 1, February 2017 In the published article, there is an error in the inline table for sgRNA sequences—the “Target sequence” for sgKEAP1-4is shown as “GAGGACACACTTCTCGCCCA”, which is a duplicate of the target sequence for sgKEAP1-3. The correct “Target sequence” for sgKEAP1-4is ACTGGGCGGCCGGTGCATCC. The Corrected Table is shown here: sgRNA Sequences The originally published Table is also shown for reference: sgRNA Sequences The article has been corrected accordingly.
NameTarget Sequence
sgGFPGGCGAGGGCGATGCCACCTA
sgKEAP1-1CTTGTGGGCCATGAACTGGG
sgKEAP1-2TGTGTCCTCCACGTCATGAA
sgKEAP1-3GAGGACACACTTCTCGCCCA
sgKEAP1-4ACTGGGCGGCCGGTGCATCC
sgLACZ-1AACGGCGGATTGACCGTAAT
sgLACZ-2CTAACGCCTGGGTCGAACGC
NameTarget Sequence
sgGFPGGCGAGGGCGATGCCACCTA
sgKEAP1-1CTTGTGGGCCATGAACTGGG
sgKEAP1-2GAGGACACACTTCTCGCCCA
sgKEAP1-3GAGGACACACTTCTCGCCCA
sgKEAP1-4GAGGACACACTTCTCGCCCA
sgLACZ-1AACGGCGGATTGACCGTAAT
sgLACZ-2CTAACGCCTGGGTCGAACGC
  15 in total

Review 1.  NRF2 and the Hallmarks of Cancer.

Authors:  Montserrat Rojo de la Vega; Eli Chapman; Donna D Zhang
Journal:  Cancer Cell       Date:  2018-05-03       Impact factor: 31.743

2.  ER Stress Signaling Promotes the Survival of Cancer "Persister Cells" Tolerant to EGFR Tyrosine Kinase Inhibitors.

Authors:  Hideki Terai; Shunsuke Kitajima; Danielle S Potter; Yusuke Matsui; Laura Gutierrez Quiceno; Ting Chen; Tae-Jung Kim; Maria Rusan; Tran C Thai; Federica Piccioni; Katherine A Donovan; Nicholas Kwiatkowski; Kunihiko Hinohara; Guo Wei; Nathanael S Gray; Eric S Fischer; Kwok-Kin Wong; Teppei Shimamura; Anthony Letai; Peter S Hammerman; David A Barbie
Journal:  Cancer Res       Date:  2017-12-19       Impact factor: 12.701

3.  A Functional Landscape of Resistance to MEK1/2 and CDK4/6 Inhibition in NRAS-Mutant Melanoma.

Authors:  Tikvah K Hayes; Flora Luo; Ofir Cohen; Amy B Goodale; Yenarae Lee; Sasha Pantel; Mukta Bagul; Federica Piccioni; David E Root; Levi A Garraway; Matthew Meyerson; Cory M Johannessen
Journal:  Cancer Res       Date:  2019-02-28       Impact factor: 12.701

4.  Concurrent Alterations in EGFR-Mutant Lung Cancers Associated with Resistance to EGFR Kinase Inhibitors and Characterization of MTOR as a Mediator of Resistance.

Authors:  Helena A Yu; Ken Suzawa; Emmet Jordan; Ahmet Zehir; Ai Ni; Ryan Kim; Mark G Kris; Matthew D Hellmann; Bob T Li; Romel Somwar; David B Solit; Michael F Berger; Maria Arcila; Gregory J Riely; Marc Ladanyi
Journal:  Clin Cancer Res       Date:  2018-03-12       Impact factor: 12.531

5.  Undermining Glutaminolysis Bolsters Chemotherapy While NRF2 Promotes Chemoresistance in KRAS-Driven Pancreatic Cancers.

Authors:  Suman Mukhopadhyay; Debanjan Goswami; Pavan P Adiseshaiah; William Burgan; Ming Yi; Theresa M Guerin; Serguei V Kozlov; Dwight V Nissley; Frank McCormick
Journal:  Cancer Res       Date:  2020-01-07       Impact factor: 12.701

6.  Combinatorial CRISPR-Cas9 Metabolic Screens Reveal Critical Redox Control Points Dependent on the KEAP1-NRF2 Regulatory Axis.

Authors:  Dongxin Zhao; Mehmet G Badur; Jens Luebeck; Jose H Magaña; Amanda Birmingham; Roman Sasik; Christopher S Ahn; Trey Ideker; Christian M Metallo; Prashant Mali
Journal:  Mol Cell       Date:  2018-02-15       Impact factor: 17.970

Review 7.  Co-occurring genomic alterations in non-small-cell lung cancer biology and therapy.

Authors:  Ferdinandos Skoulidis; John V Heymach
Journal:  Nat Rev Cancer       Date:  2019-08-12       Impact factor: 60.716

Review 8.  CRISPR/Cas9 for overcoming drug resistance in solid tumors.

Authors:  Ali Saber; Bin Liu; Pirooz Ebrahimi; Hidde J Haisma
Journal:  Daru       Date:  2019-01-21       Impact factor: 3.117

9.  Genetic Determinants of EGFR-Driven Lung Cancer Growth and Therapeutic Response In Vivo.

Authors:  Giorgia Foggetti; Chuan Li; Hongchen Cai; Jessica A Hellyer; Wen-Yang Lin; Deborah Ayeni; Katherine Hastings; Jungmin Choi; Anna Wurtz; Laura Andrejka; Dylan G Maghini; Nicholas Rashleigh; Stellar Levy; Robert Homer; Scott N Gettinger; Maximilian Diehn; Heather A Wakelee; Dmitri A Petrov; Monte M Winslow; Katerina Politi
Journal:  Cancer Discov       Date:  2021-03-11       Impact factor: 39.397

10.  α-Lipoic Acid Targeting PDK1/NRF2 Axis Contributes to the Apoptosis Effect of Lung Cancer Cells.

Authors:  Liduo Yue; Yanbei Ren; Qingxi Yue; Zhou Ding; Kai Wang; Tiansheng Zheng; Guojie Chen; Xiangyun Chen; Ming Li; Lihong Fan
Journal:  Oxid Med Cell Longev       Date:  2021-06-04       Impact factor: 6.543

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.