Literature DB >> 29079620

Influence of cis Element Arrangement on Promoter Strength in Trichoderma reesei.

Daniel P Kiesenhofer1, Robert L Mach1, Astrid R Mach-Aigner2.   

Abstract

Trichoderma reesei can produce up to 100 g/liter of extracellular proteins. The major and industrially relevant products are cellobiohydrolase I (CBHI) and the hemicellulase XYNI. The genes encoding both enzymes are transcriptionally activated by the regulatory protein Xyr1. The first 850 nucleotides of the cbh1 promoter contain 14 Xyr1-binding sites (XBS), and 8 XBS are present in the xyn1 promoter. Some of these XBS are arranged in tandem and others as inverted repeats. One such cis element, an inverted repeat, plays a crucial role in the inducibility of the xyn1 promoter. We investigated the impact of the properties of such cis elements by shuffling them by insertion, exchange, deletion, and rearrangement of cis elements in both the cbh1 and xyn1 promoter. A promoter-reporter assay using the Aspergillus nigergoxA gene allowed us to measure changes in the promoter strength and inducibility. Most strikingly, we found that an inverted repeat of XBS causes an important increase in cbh1 promoter strength and allows induction by xylan or wheat straw. Furthermore, evidence is provided that the distances of cis elements to the transcription start site have important influence on promoter activity. Our results suggest that the arrangement and distances of cis elements have large impacts on the strength of the cbh1 promoter, whereas the sheer number of XBS has only secondary importance. Ultimately, the biotechnologically important cbh1 promoter can be improved by cis element rearrangement.IMPORTANCE In the present study, we demonstrate that the arrangement of cis elements has a major impact on promoter strength and inducibility. We discovered an influence on promoter activity by the distances of cis elements to the transcription start site. Furthermore, we found that the configuration of cis elements has a greater effect on promoter strength than does the sheer number of transactivator binding sites present in the promoter. Altogether, the arrangement of cis elements is an important factor that should not be overlooked when enhancement of gene expression is desired.
Copyright © 2017 Kiesenhofer et al.

Entities:  

Keywords:  Trichoderma reesei; Xyr1-binding site; cbh1; cis element; promoter inducibility; promoter strength; promoters; regulation of gene expression; xyn1

Mesh:

Substances:

Year:  2017        PMID: 29079620      PMCID: PMC5734013          DOI: 10.1128/AEM.01742-17

Source DB:  PubMed          Journal:  Appl Environ Microbiol        ISSN: 0099-2240            Impact factor:   4.792


INTRODUCTION

Trichoderma reesei is a saprotrophic fungus that is used for industrial enzyme production. Certain strains are able to produce up to 100 g/liter of protein that is secreted into the medium (M. Ward, unpublished data). The induction signals for the expression of cellulases and hemicellulases are related to their respective substrates: cellulose and its soluble degradation products induce cellulase-encoding gene expression, and xylan and its soluble degradation products induce hemicellulase-encoding gene expression. The industrially most relevant enzyme, cellobiohydrolase I (CBHI), can make up to 60% of the secreted protein (e.g., see references 1 to 3). Currently, the main research efforts focus on the transcriptional regulation of cellulase- and hemicellulase-encoding genes. Nonetheless, the impact of the arrangement of cis elements on promoter strength has hardly been investigated so far. Therefore, during this study, we investigated the role of cis elements composed of Xyr1-binding sites (XBS) in the promoters of the cbh1 and xyn1 genes. Xyr1 is the main and essential transactivator of cbh1 and xyn1 gene expression (4) and has the binding consensus sequence 5′-GGC(A/T)3-3′ (5). Corresponding schemes of the two promoters studied are depicted in Fig. 1.
FIG 1

Schematic representation of the cbh1 and xyn1 promoters. Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the cbh1 or xyn1 gene. The blue box indicates the cis element Z (direct repeat of three XBS), the orange box indicates the cis element Y (an inverted repeat of XBS), the purple box indicates the cis element X (direct repeat of three XBS), and the brown box indicates the cis element IR (inverted repeat of XBS). Numbers on top indicate the distance from the ATG in base pairs.

Schematic representation of the cbh1 and xyn1 promoters. Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the cbh1 or xyn1 gene. The blue box indicates the cis element Z (direct repeat of three XBS), the orange box indicates the cis element Y (an inverted repeat of XBS), the purple box indicates the cis element X (direct repeat of three XBS), and the brown box indicates the cis element IR (inverted repeat of XBS). Numbers on top indicate the distance from the ATG in base pairs. The xyn1 gene is positively transcriptionally regulated by Xyr1 (4). The promoter region spanning from position −1 to −850 bp contains eight XBS (Fig. 1). Gene transcription is induced by xylan and its degradation product d-xylose. Notably, d-xylose induction is concentration dependent: low concentrations at around 0.5 mM induce gene transcription, but high concentrations, e.g., 1% (wt/vol) (66.6 mM), repress xyn1 transcription (6). On the other hand, Ace1 and Cre1 act as repressors of xyn1 transcription (7, 8). A region between positions −321 and −538 bp in the xyn1 promoter was identified to be necessary for the induction of the gene (6), and later, it was reported that this fragment contains all cis elements for the regulation of the xyn1 gene (5). Rauscher and coworkers identified an important inverted repeat of XBS and observed that the deletion of Cre1-binding sites had no influence on the inducibility of xyn1 (5). These results encouraged us to investigate the impact of the identified inverted repeat of XBS (located between −405 and −426 bp) in greater detail. The corresponding sequence, 5′-GGCTAAATGCGACATCTTAGCC-3′ (XBS are underlined), is termed cis element IR in this study. The transcriptional activators for the cbh1 gene are Xyr1 and Ace2 (4, 9). Cellulose and its degradation products induce gene transcription to a certain extent, while the strongest known inducer of cellulase expression is the transglycosilation product sophorose, a disaccharide formed by two β-1,2-linked glucose residues. As sophorose is a very expensive compound, the search for an equivalent replacement is still an important issue (10). Another inducing signal for cbh1 expression is lactose, which is also mediated by Xyr1, but not by Ace2 (11, 12). The cbh1 core promoter from position −1 to −850 bp contains 14 XBS (Fig. 1). The regulatory proteins Cre1 and Ace1 are repressors of transcription of the cbh1 gene. Cre1 mediates carbon catabolite repression (CCR) by binding Cre1-binding sites (5′-SYGGRG-3′) (13) in the 5′ region of the cbh1 core promoter in the presence of d-glucose. Ace1 binds DNA motifs similar to those bound by Xyr1. There are eight confirmed target sites present in the cbh1 promoter (14). It is hypothesized that the regulation is based on competition for these sites between Xyr1 and Ace1 (7). Liu and coworkers deleted Cre1-binding sites in the cbh1 promoter of the T. reesei Rut-C30 strain M3 and inserted the cbh1 promoter sequence spanning from −620 to −820 bp three more times into the 5′ region (15). This approach yielded two-times-higher activity than the wild-type (WT) promoter construct using a glucuronidase reporter assay. Another approach was the exchange of Cre1-binding sites for Ace2-binding sites and binding sites for the Hap2/3/5 complex (16). This experiment was performed in the protease-deficient Rut-C30 strain RC30-8 and resulted in a 5.5-fold increase in enhanced green fluorescent protein (eGFP) expression on inducing medium by a single copy of the inserted reporter gene. The high abundance of XBS in the cbh1 makes these sites an interesting target for research (17). In the present study, we examined three different cis elements composed of XBS in the cbh1 promoter, including (i) a direct repeat of three XBS located at bp −173 of the cbh1 promoter, 5′-TTAGCCAAGAACAATAGCCGATAAAGATAGCC-3′ (termed cis element X in this study), (ii) an inverted repeat of XBS located at −733 bp of the cbh1 promoter, 5′-GGCTAAACGTACCGTAATTTGCC-3′ (termed cis element Y in this study), and (iii) three XBS located at −773 bp of the cbh1 promoter, 5′-GGCTAAAAGTACATAAGTTAATGCCTAAAGAAGTCATATACCAGCGGCTAA-3′ (termed cis element Z in this study). The cis elements Y and Z are located on the same sequence stretch that was used in the study of Liu et al. (15). cis element X is a direct repeat of three XBS; however, it is located much closer to the TATA signal (Fig. 1). There is only limited and rather general information about the impact of longer sequence stretches within the cbh1 and xyn1 core promoters, and there are no detailed investigations on the influence of cis elements on the inducibility and strength of these promoters. Therefore, we aimed to address the following questions during this study. (i) Is it possible to assign carbon source inducibility to certain cis elements and thereby modify promoter inducibility in a targeted manner by cis element rearrangement? (ii) What is the impact of the number of XBS on promoter inducibility and strength? (iii) Does the distance between cis elements and the transcription start site (TSS) have an influence on promoter activity? Certainly, the answers to these questions are important for improving the efficiency, cost-effectiveness, and productivity of target gene expression.

RESULTS

The cis element IR increases promoter strength.

At the beginning of our studies, we were interested in whether the cis element X is responsible for sophorose induction in the cbh1 promoter on the one hand and, on the other hand, whether the cis element IR is responsible for d-xylose induction in the xyn1 promoter. Therefore, we constructed expression cassettes bearing the deletion of the respective cis element in each promoter or a motif exchange where X was exchanged for IR in the cbh1 promoter and termed cis element X-IR and IR was exchanged for X in the xyn1 promoter and termed cis element IR-X. Schemes of these promoters are depicted in Fig. 2A. The modified and native promoters were fused to the Aspergillus niger goxA gene, which is an established reporter system in Trichoderma species (18–21), and subsequently transformed into T. reesei QM6aΔtmus53Δpyr4 (22). Using the reestablishment of pyr4 as a marker allowed the selection of uridine prototrophic strains. Correct genotypic modification, i.e., the insertion of one copy at the pyr4 locus, was tested by PCR and Southern blot hybridization (see Fig. S1A and B in the supplemental material). To validate the experimental design and as a first approach, we investigated these strains by a carbon source replacement experiment.
FIG 2

Promoter schemes and GoxA activities of recombinant T. reesei strains after a carbon source replacement experiment. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were pregrown, and then mycelia were transferred to MA medium without any carbon source (gray bars) or with 1% glycerol (blue bars), 1% d-glucose (red bars), 0.5 mM d-xylose (purple bars), 1% d-xylose (green bars), or 1.5 mM sophorose (orange bars), incubated for 8 h, and harvested, and GoxA activities were measured in the supernatants. GoxA activity is given in relation to biomass (dry weight). Symbols indicate results below quantification level (*) and results below the detection limit (#). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations.

Promoter schemes and GoxA activities of recombinant T. reesei strains after a carbon source replacement experiment. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were pregrown, and then mycelia were transferred to MA medium without any carbon source (gray bars) or with 1% glycerol (blue bars), 1% d-glucose (red bars), 0.5 mM d-xylose (purple bars), 1% d-xylose (green bars), or 1.5 mM sophorose (orange bars), incubated for 8 h, and harvested, and GoxA activities were measured in the supernatants. GoxA activity is given in relation to biomass (dry weight). Symbols indicate results below quantification level (*) and results below the detection limit (#). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations. Pc_WT, the strain expressing goxA under the native cbh1 promoter, had basal GoxA activity on medium without any carbon source and on glycerol (Fig. 2B). While we observed CCR on d-glucose, we detected slight induction on a low concentration of d-xylose and strong induction on sophorose (Fig. 2B). The results of the GoxA assays reproduce already published quantitative PCR (qPCR) data on cbh1 from similar carbon source replacement experiments (2). Together, these results confirmed the suitability of this reporter assay for our research objectives. The deletion of cis element X (strain Pc_ΔX) released the cbh1 promoter slightly from CCR. With regard to inducing conditions, the deletion had no effect using d-xylose and led to a minor decrease of activity on sophorose (Fig. 2B). The cis element exchange in strain Pc_X-IR led to a general increase of cbh1 promoter activity regardless of which condition (i.e., carbon source) was used (Fig. 2B). In testing the xyn1 promoter, the native one in strain Px_WT was only induced on a low concentration of d-xylose (Fig. 2B). Induction on sophorose was not observed. Deletion of the cis element IR in strain Px_ΔIR led to a loss of inducibility on low concentrations of d-xylose (Fig. 2B). This loss could also be observed in strain Px_IR-X, bearing the motif exchange IR for X in the xyn1 promoter. Neither was induction by sophorose observed in this strain (Fig. 2B). As mentioned above, the strain Pc_WT behaved as expected on all carbon sources. The deletion of the cis element X only led to minor changes, i.e., decreased GoxA expression under inducing conditions and a slight release from CCR under repressing conditions. Otherwise, the cis element exchange X-IR led generally to higher promoter activity; for example, 3.3-times-higher GoxA activity under inducing conditions than with the native promoter. The regulation of the xyn1 promoter is much tighter. Under several conditions, the GoxA activity was below quantification or detection limits (Fig. 2B). d-Xylose-mediated inducibility was lost when the cis element IR was absent, and the cis element X could not restore any inducibility. Therefore, we conclude that the cis element IR is necessary for inducibility of the xyn1 promoter on d-xylose, while the cis element X does not mediate sophorose inducibility in either of the two promoters. Interestingly, the presence of cis element IR in the cbh1 promoter led to a generally stronger promoter. These results raised the question of whether cis element modification allows the use of alternative carbon sources for the same or improved promoter activation as reached with known inducers.

The cis element IR mediates strong inducibility of the cbh1 promoter by wheat straw.

The results showing that the cbh1 promoter strength can be increased by the insertion of the cis element IR prompted us to study the impact of this cis element in detail. We investigated four different promoter versions, which are depicted in Fig. 3A. All four approaches have in common that the cis element Z was exchanged for the cis element IR (this exchange is termed Z-IR). Besides this, an additional cis element IR was inserted either downstream (termed IR-DI) or upstream (termed IR-UI) from the cis element X (maintaining the nucleotide distances between the cis elements X and IR and the surrounding elements) or the cis element IR was used to replace the sequences downstream (IR-DR) or upstream (IR-UR) from cis element X (Fig. 3A). Since CBHI is the T. reesei enzyme that is most relevant for industry-scale production, we chose to perform cultivations, which are more closely related to biotechnological approaches than carbon source replacement experiments. Consequently, we cultivated the recombinant strains directly on medium containing glycerol (considered a neutral carbon source), xylan (a complex substrate that preferentially induces xylanase expression), carboxymethylcellulose (CMC; pure, soluble cellulose that preferentially induces cellulase expression), lactose (induces cellulase expression), or pretreated wheat straw (a very complex, renewable so-called “biowaste”) as the carbon source.
FIG 3

GoxA activities of strains bearing modified cbh1 promoters after direct cultivation. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were grown on MA medium with 1% glycerol (dark blue bars), lactose (red bars), xylan (green bars), carboxymethylcellulose (purple bars), or pretreated wheat straw (light blue bars). GoxA activity is given in relation to biomass (NaOH-soluble protein). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations.

GoxA activities of strains bearing modified cbh1 promoters after direct cultivation. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were grown on MA medium with 1% glycerol (dark blue bars), lactose (red bars), xylan (green bars), carboxymethylcellulose (purple bars), or pretreated wheat straw (light blue bars). GoxA activity is given in relation to biomass (NaOH-soluble protein). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations. GoxA activity was increased among all strains carrying a modified cbh1 promoter on all carbon sources compared to the GoxA activity in the strain bearing the native promoter (Fig. 3B). Surprisingly, the highest levels were observed on pretreated wheat straw, followed by CMC, xylan, and lactose as substrates (Fig. 3B). In addition to the promoter strength, the inducibility, i.e., the GoxA activity obtained on a certain carbon source compared to the GoxA activity on glycerol, was affected. The levels of inducibility of the native cbh1 promoter (strain Pc_WT) were 46.9 ± 1.8 (mean ± standard deviation), 14.1 ± 0.6, 27.1 ± 2.3, and 99 ± 16.8 with lactose, xylan, CMC, and pretreated wheat straw, respectively, as the substrate. The biggest impact on promoter inducibility could be observed in strain Pc_IR-DR_Z-IR, for which the respective values increased to 260 ± 71.8, 318.8 ± 112.8, 430 ± 116.6, and 861.4 ± 226.1. Considering that the strong cbh1 promoter has a notably higher number of XBS than the weaker xyn1 promoter and that most of the strains investigated so far gained XBS by modifying the promoter, we decided to examine the question of whether the increase in the number of XBS alone causes the observed impacts on the inducibility and/or the strength of the cbh1 promoter.

Increasing distances of cis elements to TSS correlate positively with promoter inducibility.

In order to investigate the influence of the number of XBS on the cbh1 promoter activity, we deleted the XBS from each cis element (termed ΔX, ΔY, and ΔZ, respectively) and all of them together (termed ΔXYZ). Figure 4A displays the modified promoters and provides the names of the corresponding strains that were investigated.
FIG 4

GoxA activities of strains bearing modified cbh1 promoters after direct cultivation. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were grown on MA medium with 1% glycerol (dark blue bars), lactose (red bars), xylan (green bars), carboxymethylcellulose (purple bars), or pretreated wheat straw (light blue bars). GoxA activity is given in relation to biomass (NaOH-soluble protein). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations.

GoxA activities of strains bearing modified cbh1 promoters after direct cultivation. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were grown on MA medium with 1% glycerol (dark blue bars), lactose (red bars), xylan (green bars), carboxymethylcellulose (purple bars), or pretreated wheat straw (light blue bars). GoxA activity is given in relation to biomass (NaOH-soluble protein). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations. For all respective strains, the promoter activity decreased; however, it decreased to different extents depending on the particular cis element in which the XBS were deleted (Fig. 4B). What we observed was distinct losses of activity related to the lack of the native cis element in the following order: X, Y, Z (Fig. 4B). Notably, the pattern of induction (related to the carbon source used) remained the same. Finally, the strain that lacks the native cis element Z was only minimally inducible, and inducibility was completely lost in strain Pc_ΔXYZ, in which the XBS from all three cis elements are deleted (Fig. 4B). Obviously, the decrease in inducibility correlated directly with the distance from the cis element to the TSS of the reporter: the further upstream the cis element was located, the stronger was the decrease of promoter activity in the case of deletion of its XBS. Importantly, the strain lacking the native cis element Z had only a minimally higher GoxA activity than the strain lacking all three native elements, suggesting that just the number of XBS has a minor role compared to their position. Interestingly, the GoxA activity on the neutral carbon source glycerol is hardly affected by the deletion of XBS in any of these cis elements (Fig. 4B), which indicates a small impact of XBS in basal protein expression from this promoter. As we saw only a minor influence of the sheer number of XBS on promoter activity but a clear distance dependency, we decided to investigate whether the arrangement of cis elements can even overrule the number of XBS.

The configuration of cis elements is predominant over the sheer number of XBS.

Concerning the impact of cis elements on promoter activity, we aimed to identify the exact hierarchy of the following properties: number of XBS, arrangement of XBS, and distance of XBS from TSS. Therefore, in strain Pc_ΔX, cis element Z was exchanged for cis element IR (resulting in strain Pc_ΔX_Z-IR), and in strain Pc_ΔZ, cis element X was replaced with cis element IR (resulting in strain Pc_X-IR_ΔZ) (Fig. 5A).
FIG 5

GoxA activities of strains bearing modified cbh1 promoters after direct cultivation. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were grown on MA medium with 1% glycerol (dark blue bars), lactose (red bars), xylan (green bars), carboxymethylcellulose (purple bars), or pretreated wheat straw (light blue bars). GoxA activity is given in relation to biomass (NaOH-soluble protein). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations.

GoxA activities of strains bearing modified cbh1 promoters after direct cultivation. (A) Green arrows indicate XBS and their orientations, ‡ indicates the TATA signal, and ATG represents the start codon of the reporter gene goxA. Blue boxes indicate cis element Z, orange boxes indicate cis element Y, purple boxes indicate cis element X, and brown boxes indicate cis element IR. Numbers on top indicate the distance from the ATG in base pairs. (B) Indicated strains were grown on MA medium with 1% glycerol (dark blue bars), lactose (red bars), xylan (green bars), carboxymethylcellulose (purple bars), or pretreated wheat straw (light blue bars). GoxA activity is given in relation to biomass (NaOH-soluble protein). The mean values shown are calculated from the results of biological duplicates and technical triplicates. Error bars indicate standard deviations. Comparing the GoxA activities of Pc_ΔX and Pc_ΔX_Z-IR with that of the strain bearing the native promoter, we observed a similar induction pattern (Fig. 5B). However, strain Pc_ΔX_Z-IR, which bears four fewer XBS than the native cbh1 promoter, had higher activity than strain Pc_WT. The highest increase in GoxA levels was observed on xylan (2.51-fold ± 0.37-fold higher than in Pc_WT). Otherwise, strain Pc_ΔX, which has one more XBS than Pc_ΔX_Z-IR, could not reach the levels of Pc_WT (Fig. 5B). A similar observation was made in comparing Pc_ΔZ and Pc_X-IR_ΔZ: higher GoxA expression was observed when cis element X was exchanged for IR, even though the XBS number was lower. However, Pc_X-IR_ΔZ also did not reach the GoxA levels of Pc_WT. Finally, the best performing strain was Pc_ΔX_Z-IR, which has a rather low number of XBS. Interestingly, these XBS are located quite distant from the TSS. The promoter of strain Pc_X-IR_ΔZ, which bears the same number of XBS and the same cis elements but with the IR located close to the TSS, was much weaker. Besides this, GoxA expression on glycerol was again only slightly influenced by the promoter modifications (Fig. 5B). These results suggest that the three factors arrangement of cis element, distance of cis element to TSS, and number of XBS clearly have a descending order in their influence on promoter inducibility. Finally, we aimed to get a more complete picture of the cbh1 promoter variants by combining all available promoter fragments (i.e., modifications in the 5′ region and the 3′ region).

The results for all possible cis element variations endorse the previous findings.

To obtain a full picture of the cis element influence on the cbh1 promoter, we investigated cis element variations within the cbh1 promoter by combining all available 5′ and 3′ fragments (compare Table 2 below and Fig. 6). The respective recombinant strains were grown on xylan, lactose, and pretreated wheat straw.
TABLE 2

Overview of promoter fragments used

Promoter fragmentPlasmid (reference)Remarks
ΔYpMA-T/Pcbh1_ΔYapcbh1 5′ fragments resulting from Cfr9I/Bsp120I double digest of the respective plasmid
ΔZpMA-T/Pcbh1_ΔZa
ΔYZpMA-T/Pcbh1_ΔYZa
Z-IRpMA-T/Pcbh1_Z-IRa
5′WTpDK/Pcbh1_WT (33)
IR-UIpMA-T/Pcbh1_IR-UIapcbh1 3′ fragments resulting from Bsp120I/BamHI double digest of the respective plasmid
IR-URpMA-T/Pcbh1_IR-URa
IR-DIpMA-T/Pcbh1_IR-DIa
IR-DRpMA-T/Pcbh1_IR-DRa
3′WTpDK/Pcbh1_WT (33)
X-IRpDK/Pcbh1_X-IR (33)
ΔXpDK/Pcbh1_ΔX

Plasmid was ordered from GeneArt (Thermo Fisher Scientific).

FIG 6

GoxA activities of strains bearing combinations of modified cbh1 promoter fragments after direct cultivation. Thirty-five recombinant strains bearing different combinations of 3′ and 5′ fragments of the cbh1 promoter (compare Table 3) were grown on MA medium with 1% xylan (A), lactose (42 h cultivation time) (B), or pretreated wheat straw (C). The top value in each table cell gives the GoxA activity relative to that in strain Pc_WT. The bottom value in each table cell gives the absolute GoxA activity in relation to biomass, i.e., U/mg NaOH-soluble protein (A, C) or U/mg dry weight (B). Color key: the GoxA activity values of Pc_WT are highlighted in yellow; blue indicates lower and green indicates higher GoxA activities. The mean values shown are calculated from the results of technical triplicates. Error bars indicate standard deviations.

GoxA activities of strains bearing combinations of modified cbh1 promoter fragments after direct cultivation. Thirty-five recombinant strains bearing different combinations of 3′ and 5′ fragments of the cbh1 promoter (compare Table 3) were grown on MA medium with 1% xylan (A), lactose (42 h cultivation time) (B), or pretreated wheat straw (C). The top value in each table cell gives the GoxA activity relative to that in strain Pc_WT. The bottom value in each table cell gives the absolute GoxA activity in relation to biomass, i.e., U/mg NaOH-soluble protein (A, C) or U/mg dry weight (B). Color key: the GoxA activity values of Pc_WT are highlighted in yellow; blue indicates lower and green indicates higher GoxA activities. The mean values shown are calculated from the results of technical triplicates. Error bars indicate standard deviations.
TABLE 3

Overview of the cbh1 promoter-reporter constructs and corresponding recombinant T. reesei strains

5′ fragment used3′ fragment useda
WTΔXX-IRIR-UIIR-URIR-DIIR-DR
WTPcbh1::goxAPcbh1_ΔX::goxAPcbh1_X-IR::goxAPcbh1_IR-UI::goxAPcbh1_IR-UR::goxAPcbh1_IR-DI::goxAPcbh1_IR-DR::goxA
Pc_WTbPc_ΔXbPc_X-IRbPc_IR-UIPc_IR-URPc_IR-DIPc_IR-DR
KY780446KY780447KY780448KY780449KY780450KY780451KY780452
ΔYPcbh1_ΔY::goxAPcbh1_ΔXY::goxAPcbh1_X-IR,ΔY::goxAPcbh1_IR-UI,ΔY::goxAPcbh1_IR-UR,ΔY::goxAPcbh1_IR-DI,ΔY::goxAPcbh1_IR-DR,ΔY::goxA
Pc_ΔYcPc_ΔXYPc_X-IR_ΔYPc_IR-UI_ΔYPc_IR-UR_ΔYPc_IR-DI_ΔYPc_IR-DR_ΔY
KY780453KY780454KY780455KY780456KY780457KY780458KY780459
ΔZPcbh1_ΔZ::goxAPcbh1_ΔXZ::goxAPcbh1_X-IR,ΔZ::goxAPcbh1_IR-UI,ΔZ::goxAPcbh1_IR-UR,ΔZ::goxAPcbh1_IR-DI,ΔZ::goxAPcbh1_IR-DR,ΔZ::goxA
Pc_ΔZcPc_ΔXZPc_X-IR_ΔZdPc_IR-UI_ΔZPc_IR-UR_ΔZPc_IR-DI_ΔZPc_IR-DR_ΔZ
KY780460KY780461KY780462KY780463KY780464KY780465KY780466
ΔYZPcbh1_ΔYZ::goxAPcbh1_ΔXYZ::goxAPcbh1_X-IR,ΔYZ::goxAPcbh1_IR-UI,ΔYZ::goxAPcbh1_IR-UR,ΔYZ::goxAPcbh1_IR-DI, ΔYZ::goxAPcbh1_IR-DR, ΔYZ::goxA
Pc_ΔYZPc_ΔXYZcPc_X-IR_ΔYZPc_IR-UI_ΔYZPc_IR-UR_ΔYZPc_IR-DI_ΔYZPc_IR-DR_ΔYZ
KY780467KY780468KY780469KY780470KY780471KY780472KY780473
Z-IRPcbh1_Z-IR::goxAPcbh1_ΔX,Z-IR::goxAPcbh1_X-IR,Z-IR::goxAPcbh1_IR-UI,Z-IR::goxAPcbh1_IR-UR,Z-IR::goxAPcbh1_IR-DI,Z-IR::goxAPcbh1_IR-DR, Z-IR::goxA
Pc_Z-IRPc_ΔX_Z-IRdPc_X-IR_Z-IRPc_IR-UI_Z-IRePc_IR-UR_Z-IRePc_IR-DI_Z-IRePc_IR-DR_Z-IRe
KY780474KY780475KY780476KY780477KY780478KY780479KY780480

Promoter-reporter constructs were obtained by combining the 3′ fragments and 5′ fragments. Table provides the name of the promoter-reporter construct (upper term) and the GenBank accession number of the respective construct (lower term) that was transformed into the fungal genome, yielding the respective recombinant strain (middle term).

A promoter scheme is provided in Fig. 2.

A promoter scheme is provided in Fig. 4.

A promoter scheme is provided in Fig. 5.

A promoter scheme is provided in Fig. 3.

On xylan, the GoxA expression of the majority of strains carrying a cbh1 promoter containing an additional cis element IR in the vicinity of cis element X (IR-UI, IR-UR, IR-DI, and IR-DR) was induced (Fig. 6A). In strains in which the cis element Z is exchanged for cis element IR (Z-IR), the induction was even stronger. The deletion of XBS in the cis elements led to a distance-dependent decrease in promoter activity (ΔX, ΔY, ΔZ, ΔYZ, and ΔXYZ). For the combinations of XBS deletions and the addition of cis element IR, we found a clear potential of the latter to compensate for the loss of XBS (Fig. 6A). Similar observations were made on lactose (Fig. 6B). The addition of cis element IR and/or cis element exchanges increased the strength of the promoter, and the deletion of XBS from cis elements decreased the strength of the promoter in a manner dependent on the distance from the TSS. Overall, the effects were a bit less pronounced than on xylan. Finally, strains were cultured on pretreated wheat straw and analyzed for cbh1 promoter strength (Fig. 6C). The addition of cis element IR and/or cis element exchanges increased the strength of the respective cbh1 promoter and led to very high levels of GoxA activity. Deletions of XBS from cis elements led to decreases in promoter activity. Again, the combinations of XBS deletions and the addition of cis element IR had a tendency to compensate for the loss of the native cis elements. Summarizing the results from the latter detailed approach, which allowed us to investigate a greater number of variations of cis elements in the cbh1 promoter, this demonstrated the strong influence of the cis element IR on promoter strength. The comparison of the variations supported the finding that the number of XBS has only a secondary effect on promoter strength. All combinations of cis element deletions pointed to decreased promoter strength with increased distance from the TSS. Notably, the GoxA activity patterns of the strains carrying modified cbh1 promoter constructs are very constant when comparing different substrates.

DISCUSSION

In the past, relevant regions and motifs for the regulation of the xyn1 gene were identified (5, 6). In this study, we present results demonstrating that the previously identified cis element IR, an inverted repeat of XBS, conveys transcriptional induction on xylan and wheat straw. We studied the role of this cis element by deleting only this specific motif and not by classic deletion analysis of the promoter. Phenotypic analysis was initially performed by carbon source replacement experiments because growth effects can be excluded and this allowed us to focus on the impact of a single carbon source on the promoter activity. As Xyr1 is the essential transactivator not only of the xyn1 gene but also of the industrially more relevant cbh1 gene (4), we extended our study to investigate the cis element IR in both promoters. In the case of the cbh1 promoter, Ilmén and coworkers performed a first deletion mapping (23) and found that CCR was abolished when a sequence upstream from −500 bp was removed and that the modification of a DNA motif at −720 bp was enough to trigger derepression. Furthermore, they found that sophorose induction still worked when the promoter sequence upstream from position −161 bp was removed. Years later, two reports on the cbh1 promoter were published by Liu et al. (15) and Zou et al. (16): the first study inserted the sequence stretch from −620 to −820 bp of the cbh1 promoter multiple times in the 5′ end of this promoter, leading to increased reporter activity. In the other study, Cre1-binding sites were exchanged with binding sites for Ace2 or the Hap2/3/5 complex, which also resulted in increased reporter gene expression. In both studies, the promoter-reporter constructs were randomly integrated into the genomes of Rut-C30 descendant strains. In the present study, we used targeted integration at the pyr4 locus of the wild-type T. reesei strain QM6a (22) in order to ensure genotypic comparability of all recombinant strains. Besides this, we specifically modified the cis elements instead of deleting or inserting longer sequence stretches. This strategy has the advantage that the core promoter does not become shorter and the effects of unknown regulatory sequences are not observed unintentionally. In Saccharomyces cerevisiae, Gal4 binds inverted repeats of the sequence 5′-CGG(N11)CCG-3′ as a dimer in the upstream activating sequence (UAS) of the gal1 gene (24). The Gal4 DNA-binding consensus is very conservative concerning the spacer between the inverted repeats. In the present study, we investigated binding sites that are contacted by Xyr1, a Gal4-like transcription factor. Xyr1 is also supposed to bind DNA as a dimer; however, the spacer between the target sequences does not seem to be restricted (25). As Ace1 contacts DNA sequences similar to those contacted by Xyr1, there could also be heterodimerization involved in the transcriptional regulation. Strikingly, in the present study, the exchange of a direct for an inverted repeat of XBS caused different substances to become strong inducers of gene expression (e.g., wheat straw in the case of the cbh1 gene). From a scientific point of view, it is an interesting consideration that genes whose expression is triggered by different inducing substances, although activated by the same transactivator, respond to another inducer as a result of another arrangement of the binding sites of the transactivator. And from an application-oriented point of view, this finding could support the reduction of operating costs by allowing cheaper, more easily available or more sustainable inducer substances to be used. Murphy and coworkers investigated the impact of the position of cis elements by modifying the gal1 promoter in S. cerevisiae (26). They inserted one to three tetO2 operators between the TATA signal and the TSS and analyzed the influence of the different promoters on yeast eGFP expression. This approach involved the addition of different concentrations of an inhibitor of the TetR repressor protein. When the tetO2 operator was inserted near the TSS, the promoter was active even at low concentrations of the TetR inhibitor. Otherwise, when the tetO2 operator was inserted near the TATA signal, the promoter became active only at higher concentrations of the inhibitor. Even if the strength of the promoter did not change significantly, the inducibility of the systems concerning dependence on dosage was modified. In our study, modifying the positions of relevant cis elements enhanced the general strength and the inducibility of the promoter. This might be due to the fact that we changed the positions of binding sites for a transactivator, while in S. cerevisiae, a repressor/inhibitor system was investigated. Blazeck and coworkers investigated hybrid promoters in S. cerevisiae (27). They used synthetic promoters composed of five different core promoters (of the cyc, gal1, gpd, leu3, and tef genes) and fused the UASs of the cit1, clb2, gal1, and tef genes to their 5′ ends. The hybrid promoter combining the leu3 core promoter and three cbl2 UASs was 10 times stronger than the native leu3 promoter. They also complemented the leu3 promoter with inhibitory regions or Gal4p-binding sites. Altogether, they observed only active induction in the case of promoter-reporter strains containing the Gal4p-binding sites. From these and our findings, it can be assumed that for the aim of increasing promoter strength, the targeting of binding sites for the respective transactivator is the most straightforward strategy. It should be noted that the reporter gene goxA, which was used in this study, originates from another filamentous fungus (namely, A. niger). Even if we cannot safely assume that any other heterologous target protein can be produced with the same efficiency as GoxA, the strategy of using the cbh1 promoter and T. reesei as the host organism suggests itself as a promising one. In particular, the option to use wheat straw as a cheap and sustainable substrate to provide high yields of a target protein adds attractiveness to this approach.

MATERIALS AND METHODS

Strains and cultivation conditions.

T. reesei strains QM6aΔtmus53Δpyr4 (28), QM6a Pc_WT (33) (termed QM6aΔtmus53_pc1g therein), QM6a Pc_X-IR (33) (termed QM6aΔtmus53_pcxg therein), and all other strains used in this study were maintained on malt extract agar at 30°C. Mandels-Andreotti (MA) medium (29) without peptone was used as a minimal medium. All strains were derived from QM6aΔtmus53Δpyr4 (28). An overview is provided in Table S1 in the supplemental material. For carbon source replacement experiments, mycelia were precultured in 200 ml MA medium supplemented with 0.1% peptone and 1% (wt/vol) glycerol as the sole carbon source on a rotary shaker at 180 rpm at 30°C for 24 h. A total of 109 conidia per liter (final concentration) was used as the inoculum. Pregrown mycelia were washed, and equal amounts were resuspended in 20 ml MA medium containing either no carbon source or 1% (wt/vol) glycerol, 1% (wt/vol) d-glucose, 0.5 mM d-xylose, 1% (wt/vol) d-xylose, or 1.5 mM sophorose as the sole carbon source and were incubated for 8 h. Culture supernatants were derived from biological duplicates. For direct cultivation experiments, mycelia were cultured in 20 ml MA medium supplemented with 0.1% peptone and either 1% (wt/vol) glycerol, 1% (wt/vol) lactose, 1% xylan (wt/vol) (Lenzing AG, Lenzing, Austria), 1% (wt/vol) carboxymethylcellulose, or 1% (wt/vol) pretreated wheat straw as the sole carbon source on a rotary shaker at 180 rpm at 30°C for 48 h if not indicated otherwise in the figure legends. The mycelia growing on pretreated wheat straw were incubated for 72 h. Samples were derived from biological duplicates. Escherichia coli strain Top10 (Invitrogen, Life Technologies, Paisley, United Kingdom) was used for all cloning purposes throughout this study and maintained on LB at 37°C. If applicable, ampicillin or spectinomycin was added to a final concentration of 100 mg/ml or 100 mg/ml, respectively.

Plasmid construction.

PCRs for cloning purposes were performed with Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. All primers used are listed in Table 1.
TABLE 1

List of primers used

NameSequence (5′ → 3′)
5pyr4_fwd3CCAGACGGTGATTCACATATACG
goxa_fw_BamGGATCCATGCAGACTCTCCTTGTGAGCTCG
goxa_rv_Bcu-NheGCTAGCACTAGTTCACTGCATGGAAGCATAATCTTCC
pcbh1_fw_CfrCCCGGGACTGGAAAATACAAACCAATGGCTAAAAG
pcbh1_rv_Bam_NheGCTAGCATTAGGATCCGATGCGCAGTCCGCGG
pcbh1_delta_x_rv_(soe)CGTTTAATGAGCTTCTCTTTCTATTCGAAACC
pcbh1_delta_x_rv_(soe)AAAGAGAAGCTCATTAAACGGAATGAGCTAGTAGG
pxyn1_fw_CfrCCCGGGCTGCAGCAAATGGCCTCAAGC
pxyn1_rv_Bam-NheGCTAGCATGCGGATCCGATGATTATTTGTGCGTGTTTTCCTTG
pxyn1_delta_ir_rv_(soe)TCTGGGGTGCATCCTGCCAATCAAGTCAAGGGGC
pxyn1_delta_ir_fw_(soe)TTGATTGGCAGGATGCACCCCAGATCTG
pxyn1_ir-x_fw_(soe)TTAGCCAAGAACAATAGCCGATAAAGATAGCCGGATGCACCCCAGATCTG
pxyn1_ir-x_rv_(soe)GCTATCTTTATCGGCTATTGTTCTTGGCTAATGCCAATCAAGTCAAGGGG
pyr4_3fwdAGACGAGGACCAGCAGACC
Tpyr4_rev2CAGGAAGCTCAGCGTCGAG
List of primers used For the construction of pDK/Pxyn1 (Pxyn1::goxA; GenBank accession number KY780443), a PCR product was created with primers pxyn1_fw_Cfr and pxyn1_rv_Bam_Nhe using chromosomal DNA from T. reesei QM6a as the template. The fragment was inserted into the EcoRV-digested vector pJET1.2 (Thermo Fisher Scientific), yielding pDK/Pxyn1. pDK/GoxA was created analogously with primers goxa_fwd-Bam and goxa_rv_Bcu-Nhe, using pLW-WT (30) as the template in the PCR. The goxA structural gene was inserted into pDK/Pxyn1 using BamHI and NheI digestion of pDK/GoxA, resulting in pDK/Pxyn1::goxA. The promoter-reporter construct was excised using BcuI and Cfr9I and ligated into pCD-RPyr4T (22) (GenBank accession number KT176093), which was digested beforehand using BcuI and Kpn2I, yielding pRPyr/Pxyn1::goxA. For the construction of pDK/Pxyn1_ΔIR (Pxyn1_ΔIR::goxA; GenBank accession number KY780444), two PCR products were created with primers pxyn1_fw_Cfr and pxyn1_delta_ir_rv_(soe), as well as pxyn1_delta_ir_fw_(soe) and pxyn1_rv_Bam-Nhe, using chromosomal DNA from T. reesei QM6a as the template. Both fragments were purified using an agarose gel extraction kit (Thermo Fisher Scientific). Thereafter, a splicing by overlap extension (SOE) PCR was performed with primers pxyn1_fw_Cfr and pxyn1_rv_Bam-Nhe, using the two fragments as the template. The resulting fragment was inserted into the EcoRV-digested vector pJET1.2 (Thermo Fisher Scientific), yielding pDK/Pxyn1_ΔIR. Plasmids pDK/Pxyn1_ΔIR::goxA and pRPyr/Pxyn1_ΔIR::goxA were created analogously to pDK/Pxyn1::goxA and pRPyr/Pxyn1::goxA. For the construction of pDK/Pxyn1_IR-X (Pxyn1_IR-X::goxA; GenBank accession number KY780445), two PCR products were created with primers pxyn1_fw_Cfr and pxyn1_ir-xr_rv_(soe), as well as pxyn1_ir-x_fw_(soe) and pxyn1_rv_Bam-Nhe, using chromosomal DNA from T. reesei QM6a as the template. Both fragments were purified using an agarose gel extraction kit (Thermo Fisher Scientific). Thereafter, an SOE PCR was performed with primers pxyn1_fw_Cfr and pxyn1_rv_Bam-Nhe using the two fragments as the template. The resulting fragment was inserted into the EcoRV-digested vector pJET1.2 (Thermo Fisher Scientific), yielding pDK/Pxyn1_IR-X. Plasmids pDK/Pxyn1_IR-X::goxA and pRPyr/Pxyn1_IR-X::goxA were created analogously to pDK/Pxyn1::goxA and pRPyr/Pxyn1::goxA. For the construction of pDK/Pcbh1_ΔX, two PCR products were created with primers pcbh1_fw_Cfr and pcbh1_delta_x_rv_(soe), as well as pcbh1_delta_x_fw_(soe) and pcbh1_rv_Bam-Nhe, using chromosomal DNA from T. reesei QM6a as the template. Both fragments were purified using an agarose gel extraction kit (Thermo Fisher Scientific). Thereafter, an SOE PCR was performed with primers pcbh1_fw_Cfr and pcbh1_rv_Bam-Nhe using the two fragments as the template. The resulting fragment was inserted into the EcoRV-digested vector pJET1.2 (Thermo Fisher Scientific), yielding pDK/Pcbh1_ΔX. Plasmids pDK/Pcbh1_ΔX::goxA and pRPyr/Pcbh1_ΔX::goxA were created analogously to pDK/Pcbh1_ΔX::goxA and pRPyr/Pxyn1::goxA. The cbh1 promoter can be cut with Bsp120I, yielding a 5′ and a 3′ fragment; in the case of fragments Pcbh1_WT, Pcbh1_X-IR (33), and Pcbh1_ΔX, this digestion yields the 5′ fragment 5′WT, as well as 3′ fragments 3′WT, 3′X-IR, and 3′ΔX, respectively. Additional promoter fragments were obtained by custom order from GeneArt (Thermo Fisher Scientific). Table 2 provides an overview of the promoter fragments used and the plasmids carrying them. Overview of promoter fragments used Plasmid was ordered from GeneArt (Thermo Fisher Scientific). Table 3 provides an overview of the different combinations of native and modified 5′ and 3′ fragments of the cbh1 promoter. In the case of ΔX, the whole cis element was deleted from the cbh1 promoter, and in the case of ΔY and ΔZ, just the XBS were destroyed. Overview of the cbh1 promoter-reporter constructs and corresponding recombinant T. reesei strains Promoter-reporter constructs were obtained by combining the 3′ fragments and 5′ fragments. Table provides the name of the promoter-reporter construct (upper term) and the GenBank accession number of the respective construct (lower term) that was transformed into the fungal genome, yielding the respective recombinant strain (middle term). A promoter scheme is provided in Fig. 2. A promoter scheme is provided in Fig. 4. A promoter scheme is provided in Fig. 5. A promoter scheme is provided in Fig. 3. In a first step, plasmids pDK/Pcbh1_IR-UI::goxA, pDK/Pcbh1_IR-UR::goxA, pDK/Pcbh1_IR-DI::goxA, and pDK/Pcbh1_IR-DR::goxA were created. The pMA-T plasmids carrying the corresponding 3′ fragments and pDK/Pcbh1_WT::goxA (33) were cut using Bsp120I and BamHI. The 3′ fragments and the target vector were gel eluted and ligated, yielding the respective pDK/Pcbh1_*::goxA constructs (where * is a “wild card”). In order to create all other constructs, pMA-T/Pcbh1_ΔY, pMA-T/Pcbh1_ΔZ, pMA-T/Pcbh1_ΔYZ, and pMA-T/Pcbh1_Z-IR and pDK/Pcbh1_WT::goxA, pDK/Pcbh1_ΔX::goxA, pDK/Pcbh1_IR-UI::goxA, pDK/Pcbh1_IR-UR::goxA, pDK/Pcbh1_IR-DI::goxA, and pDK/Pcbh1_IR-DR::goxA were digested using Cfr9I and Bsp120I. The fragments (originating from pMA-T plasmids) and the target vectors (digested pDK/Pcbh1_*::goxA plasmids) were gel eluted. Each fragment was inserted into each vector to create the remaining pDK/Pcbh1_*::goxA plasmids. Afterwards, each promoter-reporter construct was inserted into pCD/RPyr4T analogously to pRPyr/Pxyn1::goxA, yielding a series of pRPyr/Pcbh1_*::goxA plasmids. All intermediate and final plasmids were sequenced by Microsynth (Balgach, Switzerland).

Fungal transformation.

The protoplast transformation of T. reesei was performed as described by Gruber et al. (31). Typically, 50 μg of linearized plasmid DNA was used for transformation of 107 protoplasts (in 200 μl). For selection of prototrophy, 500 μl of the transformation reaction mixture was added to 20 ml melted, warm (50°C) minimal medium agar containing 1.2 M sorbitol and 1% (wt/vol) d-glucose. This mixture was poured into sterile petri dishes, and after solidification, was incubated at 30°C for 3 to 7 days until colonies were visible. Table 3 provides an overview of the constructs that were transformed into the fungal genome and the resulting recombinant strains.

Isolation of chromosomal DNA and PCR screening.

Chromosomal DNA was isolated from fungal mycelium by grinding in liquid nitrogen followed by a phenol-chloroform extraction (31). RNA was degraded using RNase A (Thermo Fisher Scientific). DNA was precipitated with isopropanol, washed with 70% (vol/vol) ethanol, and dissolved in 100 μl sterile bidistilled H2O. For testing the genotype, 10 ng of chromosomal DNA was used as the template in a 25-μl PCR mixture using GoTaq G2 polymerase (Promega, Madison, WI, USA) according to the manufacturer's instructions. All primers used are listed in Table 1. For subsequent agarose gel electrophoresis of DNA fragments, a GeneRuler 1-kb DNA ladder (Thermo Fisher Scientific) was applied to estimate fragment size.

Southern blot analysis.

Fifteen micrograms of chromosomal DNA was digested with 30 U of SacII (New England BioLabs, Ipswich, MA, USA). The resulting DNA fragments were separated by electrophoresis on an 0.8% (wt/vol) agarose gel, denatured in 0.4 M NaOH, and transferred by capillary force onto a Biodyne B 0.45-μm nylon membrane (Pall Corporation, Port Washington, NY, USA) using 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). A 1.5-μg quantity of biotinylated DNA probe was used for hybridization at 65°C overnight. Labeling of the probe was performed by using the Klenow fragment (exo−) (Thermo Fisher Scientific), random hexamer primers, and biotin-11-dUTP (Jena Bioscience, Jena, Germany). Signals were visualized by using poly-horseradish peroxidase (poly-HRP; Pierce) conjugated to streptavidin and ECL plus Western blotting substrate (Life Technologies) (both from Thermo Fisher Scientific) on a ChemiDoc MP (Bio-Rad Laboratories, Hercules, CA, USA).

Glucose oxidase assay.

Glucose oxidase activity was assayed as described previously (18) using ABTS [2,2′-azino-di-(3ethyl-benzthiazoline sulfonate)] (Molekula Ltd., Gillingham, United Kingdom) and HRP (Sigma-Aldrich, St. Louis, MO, USA). One unit of activity is defined as the amount of enzyme that oxidizes 1 μmol of d-glucose per min at pH 5.8 and 25°C. Measurements were carried out in technical triplicates. For determination of the biomass, the mycelium was separated from the culture supernatant by filtration using a predried piece of Miracloth and subsequently dried at 120°C for 24 h. Table S4 provides the biomass of strains grown on lactose. In the case of water-insoluble substrates, NaOH-soluble protein was determined and was used as an alternative reference to biomass.

NaOH-soluble protein extraction.

Mycelia were separated from the culture supernatant by filtration (supernatant was used for glucose oxidase assays). Afterwards, each mycelium sample was washed using 30 ml deionized H2O and filtered again. The extraction of NaOH-soluble protein from the remaining biomass was performed as previously described (32). Twenty milliliters of 1 M NaOH was added to each mycelium sample and then fixed in a rotary shaker for 3 h. Samples were transferred into 1.5-ml tubes and centrifuged for 10 min at 20,000 × g to separate the extracted protein from the remaining solids. The protein concentration of the extract was determined using the Bio-Rad protein assay (Bio-Rad) against a bovine serum albumin (BSA) standard. Tables S2, S3, and S5 provide the concentrations of NaOH-soluble protein for T. reesei QM6a and recombinant strains cultivated on water-insoluble substrates.

Accession number(s).

The data sets generated and analyzed during the current study are available in the GenBank repository (https://www.ncbi.nlm.nih.gov/GenBank/) under accession numbers KY780443 through KY780480; further information can be found in Table 3.
  29 in total

1.  Regulation of chitinase 33 (chit33) gene expression in Trichoderma harzianum.

Authors:  M de las Mercedes Dana; M C Limón; R Mejías; R L Mach; T Benítez; J A Pintor-Toro; C P Kubicek
Journal:  Curr Genet       Date:  2001-01       Impact factor: 3.886

2.  The development of a heterologous transformation system for the cellulolytic fungus Trichoderma reesei based on a pyrG-negative mutant strain.

Authors:  F Gruber; J Visser; C P Kubicek; L H de Graaff
Journal:  Curr Genet       Date:  1990-07       Impact factor: 3.886

3.  Different inducibility of expression of the two xylanase genes xyn1 and xyn2 in Trichoderma reesei.

Authors:  S Zeilinger; R L Mach; M Schindler; P Herzog; C P Kubicek
Journal:  J Biol Chem       Date:  1996-10-11       Impact factor: 5.157

4.  Functional analysis of the cellobiohydrolase I promoter of the filamentous fungus Trichoderma reesei.

Authors:  M Ilmén; M L Onnela; S Klemsdal; S Keränen; M Penttilä
Journal:  Mol Gen Genet       Date:  1996-12-13

5.  Applications of cellulases.

Authors:  M Mandels
Journal:  Biochem Soc Trans       Date:  1985-04       Impact factor: 5.407

6.  New-to-nature sophorose analog: a potent inducer for gene expression in Trichoderma reesei.

Authors:  Tom Tao Huang; John M Wages
Journal:  Enzyme Microb Technol       Date:  2016-01-18       Impact factor: 3.493

7.  Carbon catabolite repression of xylanase I (xyn1) gene expression in Trichoderma reesei.

Authors:  R L Mach; J Strauss; S Zeilinger; M Schindler; C P Kubicek
Journal:  Mol Microbiol       Date:  1996-09       Impact factor: 3.501

8.  Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization.

Authors:  Ti Liu; Tianhong Wang; Xian Li; Xuan Liu
Journal:  Acta Biochim Biophys Sin (Shanghai)       Date:  2008-02       Impact factor: 3.848

Review 9.  Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei).

Authors:  Astrid R Stricker; Robert L Mach; Leo H de Graaff
Journal:  Appl Microbiol Biotechnol       Date:  2008-01-16       Impact factor: 4.813

10.  Xyr1 (xylanase regulator 1) regulates both the hydrolytic enzyme system and D-xylose metabolism in Hypocrea jecorina.

Authors:  Astrid R Stricker; Karin Grosstessner-Hain; Elisabeth Würleitner; Robert L Mach
Journal:  Eukaryot Cell       Date:  2006-10-20
View more
  8 in total

1.  Application of the human estrogen receptor within a synthetic transcription factor in Trichoderma reesei.

Authors:  Christian Derntl; Robert Mach; Astrid Mach-Aigner
Journal:  Fungal Biol Biotechnol       Date:  2020-08-03

2.  Gene Co-expression Network Reveals Potential New Genes Related to Sugarcane Bagasse Degradation in Trichoderma reesei RUT-30.

Authors:  Gustavo Pagotto Borin; Marcelo Falsarella Carazzolle; Renato Augusto Corrêa Dos Santos; Diego Mauricio Riaño-Pachón; Juliana Velasco de Castro Oliveira
Journal:  Front Bioeng Biotechnol       Date:  2018-10-22

3.  Redesigning the Aspergillus nidulans xylanase regulatory pathway to enhance cellulase production with xylose as the carbon and inducer source.

Authors:  Patrick Ballmann; Jorge Lightfoot; Michael Müller; Stephan Dröge; Rolf Prade
Journal:  Microb Cell Fact       Date:  2019-11-07       Impact factor: 5.328

4.  Synthetic control devices for gene regulation in Penicillium chrysogenum.

Authors:  László Mózsik; Zsófia Büttel; Roel A L Bovenberg; Arnold J M Driessen; Yvonne Nygård
Journal:  Microb Cell Fact       Date:  2019-11-18       Impact factor: 5.328

5.  Development of a powerful synthetic hybrid promoter to improve the cellulase system of Trichoderma reesei for efficient saccharification of corncob residues.

Authors:  Yifan Wang; Ruiyan Liu; Hong Liu; Xihai Li; Linjing Shen; Weican Zhang; Xin Song; Weifeng Liu; Xiangmei Liu; Yaohua Zhong
Journal:  Microb Cell Fact       Date:  2022-01-04       Impact factor: 5.328

Review 6.  Systems and Synthetic Biology Approaches to Engineer Fungi for Fine Chemical Production.

Authors:  Leonardo Martins-Santana; Luisa C Nora; Ananda Sanches-Medeiros; Gabriel L Lovate; Murilo H A Cassiano; Rafael Silva-Rocha
Journal:  Front Bioeng Biotechnol       Date:  2018-10-03

Review 7.  The Promoter Toolbox for Recombinant Gene Expression in Trichoderma reesei.

Authors:  Elisabeth Fitz; Franziska Wanka; Bernhard Seiboth
Journal:  Front Bioeng Biotechnol       Date:  2018-10-11

Review 8.  Inducible promoters and functional genomic approaches for the genetic engineering of filamentous fungi.

Authors:  Janina Kluge; Dominik Terfehr; Ulrich Kück
Journal:  Appl Microbiol Biotechnol       Date:  2018-06-02       Impact factor: 4.813

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.