Literature DB >> 29078279

Electron leak from NDUFA13 within mitochondrial complex I attenuates ischemia-reperfusion injury via dimerized STAT3.

Hengxun Hu1, Jinliang Nan1, Yong Sun1, Dan Zhu1, Changchen Xiao1, Yaping Wang1, Lianlian Zhu1,2, Yue Wu1,2, Jing Zhao1,2, Rongrong Wu1, Jinghai Chen1,3, Hong Yu1, Xinyang Hu1, Wei Zhu4, Jian'an Wang4.   

Abstract

The causative relationship between specific mitochondrial molecular structure and reactive oxygen species (ROS) generation has attracted much attention. NDUFA13 is a newly identified accessory subunit of mitochondria complex I with a unique molecular structure and a location that is very close to the subunits of complex I of low electrochemical potentials. It has been reported that down-regulated NDUFA13 rendered tumor cells more resistant to apoptosis. Thus, this molecule might provide an ideal opportunity for us to investigate the profile of ROS generation and its role in cell protection against apoptosis. In the present study, we generated cardiac-specific tamoxifen-inducible NDUFA13 knockout mice and demonstrated that cardiac-specific heterozygous knockout (cHet) mice exhibited normal cardiac morphology and function in the basal state but were more resistant to apoptosis when exposed to ischemia-reperfusion (I/R) injury. cHet mice showed a preserved capacity of oxygen consumption rate by complex I and II, which can match the oxygen consumption driven by electron donors of N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD)+ascorbate. Interestingly, at basal state, cHet mice exhibited a higher H2O2 level in the cytosol, but not in the mitochondria. Importantly, increased H2O2 served as a second messenger and led to the STAT3 dimerization and, hence, activation of antiapoptotic signaling, which eventually significantly suppressed the superoxide burst and decreased the infarct size during the I/R process in cHet mice.

Entities:  

Keywords:  NDUFA13; STAT3; hydroxyl peroxide; mitochondria; reactive oxygen species

Mesh:

Substances:

Year:  2017        PMID: 29078279      PMCID: PMC5692532          DOI: 10.1073/pnas.1704723114

Source DB:  PubMed          Journal:  Proc Natl Acad Sci U S A        ISSN: 0027-8424            Impact factor:   11.205


Mitochondria are the powerhouses of living cells, with generating ATP through oxidative phosphorylation as their main duty (1). However, mitochondria can become the major sites of reactive oxygen species (ROS) generation in the pathological process, causing significant cell damage, for example, in the process of ischemia-reperfusion (I/R) injury (2). Studies have shown that both complex I (3) and complex III (4) are the two important sites for ROS generation. There is mounting evidence that complex I might be the main source of ROS generation in intact mammalian mitochondria in vitro (5, 6). As the first segment of the electron transfer chain, complex I can be functionally dissected into several components, including a flavin mononucleotide (FMN) moiety, iron-sulfur clusters, and a ubiquinone-binding domain (7); each segment has a special structure and unique electrochemical potentials (7). Of note, the unique electrochemical potential pertaining to these components can determine the specific species of ROS generated through the related components of complex I (8). However, ROS are also important signaling molecules. Moderate levels of ROS have been reported to promote cell proliferation and survival (9, 10). Interestingly, inhibition of complex I activity could offer significant protection against I/R injury (2, 11), which can be attributed to decreased ROS generation during the reperfusion period (11). Given that knockdown of any component of the core subunit, such as NDUFS and NDUFV within complex I, in genetic mouse models can be lethal (7), it is tempting to determine to what extent a decrease in complex I activity can offer protection against stress by generating an appropriate amount of ROS without compromising energy transduction and the generation of ATP. Studies have shown decreased expression of NDUFA13, a supernumerary subunit of complex I, in various tumors (12). As an accessory subunit of complex I, NDUFA13 (GRIM-19) is, to the best of our knowledge, the only protein that contains a transmembrane helix (TMH) structure that can penetrate both Iα and Iλ, two important structures situated within complex I (13). Importantly, down-regulation of NDUFA13 expression can render the tumor cells more resistant to chemotherapy (14). In addition, monoallelic loss of NDUFA13 promotes tumorigenesis in mice, which is associated with decreased apoptosis (14). In contrast, administration of IFN/retinol can induce NDUFA13 expression in MCF-7 cells, which resulted in a 50% increase in apoptotic cells (15), indicating its proapoptotic effects (14). Despite an association between NDUFA13 expression and apoptosis level, it remains unknown whether ROS generation is involved in changes in tumor apoptosis activity when NDUFA13 is expressed at low levels. Of note, the location of NDUFA13 within complex I is very close to segments with lower electromechanical potentials (7); this special location might offer an opportunity to establish a unique profile of ROS generation within the mitochondria when NDUFA13 is down-regulated. It has also been reported that decreased NDUFA13 expression is associated with enhanced STAT3 signaling, which may also account for the augmented survival in tumor cells (14, 16–18). Again, it remains largely unknown whether and how STAT3 activation is related to ROS generation induced by down-regulated NDUFA13. In the present study, we generated cardiac-specific NDUFA13 knockout mice, which would allow us to investigate the profile of ROS generation when NDUFA13 was moderately down-regulated and how resultant ROS offer the protection for cells, specifically for the myocardium against I/R injury. Further, we aimed to elucidate whether and how the activated STAT3 signaling was also responsible for the protection of the heart.

Results

Moderate NDUFA13 Down-Regulation Confers Protection Against Hypoxia/Reoxygenation-Induced Cell Injury.

To test the roles of NDUFA13 in cardiomyocytes, we transfected H9C2 cells with NDUFA13-targeting siRNA and showed that a 100 μmol/L concentration of siRNA-NDUFA13 resulted in a 30% decrease and a 200 μmol/L siRNA-NDUFA13 resulted in a 60% decrease in NDUFA13 expression (Fig. 1). Note that mitochondrial membrane potential (MMP) was impaired at the high (200 μmol/L) dose of siRNA-NDUFA13, but not at the low dose (100 μmol/L) (Fig. S1). Interestingly, the resultant-moderate decrease in NDUFA13 expression was associated with a decrease in TUNEL-positive cells when these cells were exposed to hypoxia for 6 h followed by reoxygenation for 18 h (Fig. 1). However, a severe decrease in NDUFA13 expression failed to elicit any protection against hypoxia/reoxygenation (H/R)-induced apoptosis (Fig. 1). Consistent with TUNEL staining, the same pattern of changes was observed in cleaved caspase-3 and caspase-9 expression, with the protective effects being present only when NDUFA13 was moderately down-regulated (Fig. 1). However, cleaved caspase-8, which is involved in the extrinsic apoptotic pathway, did not show significant changes (Fig. 1). Meanwhile, phosphorylation level of apoptosis signal-regulating kinase at threonine 845 (pASK1Thr845) and its downstream target p-JNK level were not affected (Fig. S1). In summary, the data suggested that a moderate decrease in NDUFA13 expression conferred a significant protection against apoptosis obtained from H9C2 cells.
Fig. 1.

(A) H9C2 cells tr insulintransferrin-selenium ansfected with different concentrations of siRNA targeting rat NDUFA13 were exposed to normoxia or H/R. NDUFA13 and cleaved caspase-3, caspase-9, and caspase-8 expression levels were detected by Western blot, with β-actin as the loading control (n = 4 per group). (B) The percentage of TUNEL-positive cells (marked by white arrow) quantified and shown in the bar graph, **P < 0.01 vs. scramble (SCR) transfection (n = 3 per group). (Scale bars: 100 μm.)

Fig. S1.

(A) TMRM was used to measure mitochondrial membrane potential for H9C2 cells that were transfected with different concentrations of siRNA targeting rat NDUFA13 as described in Fig. 1. These siRNA-NDUFA13–treated H9C2 cells then exposed to either a normoxia culture condition or a H/R indult. (B) The cells were collected for the quantification of p-ASK1 at Thr845, or p-JNK levels by Western blotting where β-actin was used as a loading control (n = 3 mice per group).

(A) H9C2 cells tr insulintransferrin-selenium ansfected with different concentrations of siRNA targeting rat NDUFA13 were exposed to normoxia or H/R. NDUFA13 and cleaved caspase-3, caspase-9, and caspase-8 expression levels were detected by Western blot, with β-actin as the loading control (n = 4 per group). (B) The percentage of TUNEL-positive cells (marked by white arrow) quantified and shown in the bar graph, **P < 0.01 vs. scramble (SCR) transfection (n = 3 per group). (Scale bars: 100 μm.) (A) TMRM was used to measure mitochondrial membrane potential for H9C2 cells that were transfected with different concentrations of siRNA targeting rat NDUFA13 as described in Fig. 1. These siRNA-NDUFA13–treated H9C2 cells then exposed to either a normoxia culture condition or a H/R indult. (B) The cells were collected for the quantification of p-ASK1 at Thr845, or p-JNK levels by Western blotting where β-actin was used as a loading control (n = 3 mice per group).

Characterization of Tamoxifen-Inducible Cardiac-Specific NDUFA13 Transgenic Mice.

To further investigate how a slight decrease in NDUFA13 offers cardiac protection against apoptosis in vivo, we generated a cardiac-specific conditional NDUFA13 knockout mouse model (see details in ). Eight-week-old Myh6Cre+NDUFA13flox/flox (cHomo) mice and age-matched Myh6Cre+NDUFA13flox/- (cHet) mice were studied, and Myh6Cre−NDUFA13flox/- mice were used as controls (CON). i.p. injections of tamoxifen ( for detailed information) were administered to each mouse. To evaluate the time course of changes in NDUFA13 expression after tamoxifen treatment, on days 1, 4, 7, 10, 13, and 16 after tamoxifen administration, three mice from each group were killed, respectively, and the hearts were obtained to test the relationship between NDUFA13 expression and the ATP level. Tamoxifen time-dependently down-regulated NDUFA13 expression in both cHomo and cHet mice. A moderate decrease in NDUFA13 expression was observed on day 16 in cHet mice, whereas a moderate decrease was detected as early as day 1 in cHomo mice, and an almost 80% decrease was observed on day 16 after tamoxifen treatment (Fig. 2). Interestingly, cHet mice did not exhibit any changes in ATP level in the heart compared with CON mice (Fig. 2), whereas cHomo exhibited a significant time-dependent decrease in ATP content in the heart, with a significant change detected as early as 4 d after tamoxifen administration (Fig. 2). Being consistent with quantification of ATP levels in the heart tissue, cHomo mice experienced sudden death, whereas cHet and CON mice shared a similar survival rate as demonstrated by Kaplan–Meyer’s survival curves (Fig. 2). Based on these data, we used only cHet mice to test whether a moderate NDUFA13 down-regulation had cardioprotective effects against I/R-induced stress. To further confirm that cHet mice did not exhibit any abnormalities in cardiac structure and function, echocardiographic examinations were performed on nine cHet and nine CON mice on day 28 after tamoxifen administration, and the results demonstrated that normal cardiac structure and function were observed in the cHet mice compared with the CON mice (Fig. 2, Fig. S2, and Table S1). The mice were then killed for further analysis. Compared with CON mice, cHet mice did not exhibit any significant changes in cardiac ultrastructure as demonstrated by transmission electronic microscopy (TEM) examination (Fig. 2), and mitochondrial morphology (Fig. 2) was similar between cHet and CON mice. Protein expression of several key mitochondrial components, including ATP2A2, NDUFB8, and SDHC (for ATP generation); ATP5A (for ATP consumption); and PGC-1α (a key transcription factor that orchestrates mitochondrial biogenesis) were not altered (Fig. 2 and Fig. S2). NDUFA13 expression in other tissues, such as the brain, lung, and liver, was similar between cHet and CON mice (Fig. 2 and Fig. S2), further confirming a reliable cardiac-specific NDUFA13 knock-down mouse model. Using freshly isolated mitochondria from the hearts, substrate-driven mitochondrial respiratory function was analyzed. With the presence of ADP, substrate-driven oxygen consumption rate (OCR) was measured for complex I (addition of pyruvate and malate followed by rotenone, an inhibitor of complex I), complex II (succinate), and complex IV [N,N,N′,N′-tetramethyl-p-phenylenediamine (TMPD)/ascorbate followed by azide, an inhibitor of complex IV]. The data showed a decrease in substrate-driven OCR of complex I in cHet mice; however, OCR by combination of complex I and II could, in compensation, match OCR driven by the electron donor (TMPD/ascorbate) through complex IV (Fig. 2 and Fig. S2). In summary, we generated a conditional cardiac-specific NDUFA13 knockout mouse model; cHet mice exhibit normal cardiac structure and function at baseline, which was associated with a compensatory normal mitochondrial function and ATP production.
Fig. 2.

Three groups of mice, including cHet (Cre+flox/-), cHomo (Cre+flox/flox), and CON (Cre-flox/-), were studied. (A) The time course of changes in NDUFA13 expression in the heart were evaluated at the indicated time points by Western blot (representative bands shown with its expression level relative to that in Cre-flox/- mice. β-Actin as a loading control, n = 3 mice per group). (B) ATP levels (micromoles per liter) quantified at the indicated time points (*P < 0.05; #P < 0.05 vs. Cre-flox/- group, respectively); (C) Kaplan–Meier survival curves were generated for the three groups of mice over a prospective observation period of 240 d (n = 10 mice per group. *P < 0.05 vs. Cre-flox6/- group). “Injection” indicates the date of the completion of tamoxifen administration. (D) Echocardiography performed for both cHet and CON mice on day 28 after tamoxifen administration; ejection fraction (EF) and LVIDd quantified in the bar graphs (n = 9 mice per group). (E) TEM performed on samples from Cre+flox/- and Cre-flox/- mice on day 28 after tamoxifen administration. (Scale bars: Left, 5 μm; Center, 2 μm; Right, 0.5 μm.) (F) Different components of the mitochondrial respiratory complexes were quantified by Western blot in both group mice with representative bands shown (n = 3 per group). NDUFA13 expression levels were quantified in other tissue with β-actin as a loading control (n = 3 mice per group). (G) OCR was measured by O2k-Fluorometry (*P < 0.05 vs. Cre-flox/- mice; #P < 0.05, comparison within Cre-flox/- group mice).

Fig. S2.

(A) Both cHet (Cre+flox/-) and CON (Cre-flox/-) mice underwent echocardiographic examination at day 28 after tamoxifen therapy. Parasternal long axis view was shown and M-mode image acquired for assessing cardiac size and function (n = 9 mice per group). (B) Bar graphs for the densitometric quantification for all of the protein bands detected by Western blotting as described in Fig. 2 (n ≥ 3 mice per group). (C) Representative traces of oxygen consumption rate measured by O2k-Fluorometry (*P < 0.05 vs. Cre-flox/- mice). cHet (Cre+flox/-) denotes Myh6Cre+NDUFA13flox/- mice; CON (Cre-flox/-) denotes Myh6Cre−NDUFA13flox/- mice.

Table S1.

Parameters obtained from echocardiography

Cre- (n = 8)Cre+ (n = 8)P
NDUFA13 flox/-NDUFA13 flox/-
IVS;d, mm0.81 ± 0.220.97 ± 0.16NS
IVS;s, mm1.26 ± 0.221.39 ± 0.26NS
LVID;d, mm3.36 ± 0.333.12 ± 0.42NS
LVID;s, mm2.21 ± 0.342.12 ± 0.24NS
LVPW;d, mm0.79 ± 0.150.97 ± 0.32NS
LVPW;s, mm1.16 ± 0.211.35 ± 0.32NS
EF, %64.11 ± 8.6360.64 ± 9.92NS
FS, %34.35 ± 6.3731.80 ± 7.32NS
LV Mass, mg87.77 ± 16.69106.67 ± 33.70NS
LV Vol;d, μL46.71 ± 10.0339.57 ± 13.75NS
LV Vol;s, μL17.03 ± 6.4514.99 ± 3.94NS

Parameters of cardiac morphology and function were obtained by echocardiograph. EF, ejection fraction; FS, fractional shortening; IVS;d, denotes interventricular septum width at end diastole; IVS;s, interventricular septum width at end systole; LV Mass, left ventricular mass; LV Vol;d, left ventricular volume at end diastole; LV Vol;s, left ventricular volume at end systole; LVID;d, left ventricular inner diameter at end diastole; LVID;s, left ventricular inner diameter at end systole; LVPW;d, left ventricular posterior wall width at end diastole; LVPW;s, left ventricular posterior wall width at end systole; NS, not significant.

Three groups of mice, including cHet (Cre+flox/-), cHomo (Cre+flox/flox), and CON (Cre-flox/-), were studied. (A) The time course of changes in NDUFA13 expression in the heart were evaluated at the indicated time points by Western blot (representative bands shown with its expression level relative to that in Cre-flox/- mice. β-Actin as a loading control, n = 3 mice per group). (B) ATP levels (micromoles per liter) quantified at the indicated time points (*P < 0.05; #P < 0.05 vs. Cre-flox/- group, respectively); (C) Kaplan–Meier survival curves were generated for the three groups of mice over a prospective observation period of 240 d (n = 10 mice per group. *P < 0.05 vs. Cre-flox6/- group). “Injection” indicates the date of the completion of tamoxifen administration. (D) Echocardiography performed for both cHet and CON mice on day 28 after tamoxifen administration; ejection fraction (EF) and LVIDd quantified in the bar graphs (n = 9 mice per group). (E) TEM performed on samples from Cre+flox/- and Cre-flox/- mice on day 28 after tamoxifen administration. (Scale bars: Left, 5 μm; Center, 2 μm; Right, 0.5 μm.) (F) Different components of the mitochondrial respiratory complexes were quantified by Western blot in both group mice with representative bands shown (n = 3 per group). NDUFA13 expression levels were quantified in other tissue with β-actin as a loading control (n = 3 mice per group). (G) OCR was measured by O2k-Fluorometry (*P < 0.05 vs. Cre-flox/- mice; #P < 0.05, comparison within Cre-flox/- group mice). (A) Both cHet (Cre+flox/-) and CON (Cre-flox/-) mice underwent echocardiographic examination at day 28 after tamoxifen therapy. Parasternal long axis view was shown and M-mode image acquired for assessing cardiac size and function (n = 9 mice per group). (B) Bar graphs for the densitometric quantification for all of the protein bands detected by Western blotting as described in Fig. 2 (n ≥ 3 mice per group). (C) Representative traces of oxygen consumption rate measured by O2k-Fluorometry (*P < 0.05 vs. Cre-flox/- mice). cHet (Cre+flox/-) denotes Myh6Cre+NDUFA13flox/- mice; CON (Cre-flox/-) denotes Myh6Cre−NDUFA13flox/- mice. Parameters obtained from echocardiography Parameters of cardiac morphology and function were obtained by echocardiograph. EF, ejection fraction; FS, fractional shortening; IVS;d, denotes interventricular septum width at end diastole; IVS;s, interventricular septum width at end systole; LV Mass, left ventricular mass; LV Vol;d, left ventricular volume at end diastole; LV Vol;s, left ventricular volume at end systole; LVID;d, left ventricular inner diameter at end diastole; LVID;s, left ventricular inner diameter at end systole; LVPW;d, left ventricular posterior wall width at end diastole; LVPW;s, left ventricular posterior wall width at end systole; NS, not significant.

NDUFA13 Down-Regulation Protected Mouse Hearts from I/R Injury.

To test whether a moderate down-regulation of NDUFA13 could protect the heart from I/R injury, we generated an in vivo cardiac I/R injury model in both cHet and CON mice, by coronary artery ligation for 45 min followed by 3 h of reperfusion. Interestingly, we observed a significant decrease in the infarct size (IS) in cHet mice compared with CON mice (Fig. 3). Quantification of apoptotic level at the peri-infarct area showed that TUNEL-positive cardiomyocytes were significantly decreased in cHet mice that underwent I/R intervention compared with CON mice that experienced the same I/R insult (Fig. 3). The decrease in apoptosis was also confirmed when peri-infarct heart tissue was used for Western blot analysis, showing a significant decrease in cleaved caspase-3 expression in cHet mice compared with CON mice (Fig. 3). The same pattern of changes was also seen in cytochrome C (cytoC) release into the cytosol, showing much less leak in cHet mice following an I/R injury compared with CON mice that were exposed to I/R injury (Fig. 3). Taken together, these results strongly supported that moderate NDUFA13 down-regulation confers protection against I/R injury through the suppression of apoptosis.
Fig. 3.

(A) Both cHet (Cre+flox/-) and CON (Cre-flox/-) mice underwent either the I/R injury or the sham operation. IS was analyzed for both groups of mice with a representative 2,3,5-triphenyltetrazolium chloride (TTC) staining image and quantified in bar graph (n = 5 mice per group. **P < 0.01 vs. Cre-flox/- mice). (B) TUNEL staining performed (white arrow indicates TUNEL-positive nucleus) and the quantification is shown in the bar graph (**P < 0.01 vs. Cre-flox/- group). (C) Cleaved caspase-3 was also detected by Western blot with representative bands (α-tubulin was used as a loading control; **P < 0.01 vs. Cre-flox/- I/R group, n = 3 mice per group). (D) Cytochrome c release was quantified by Western blot; VDAC, a mitochondrial marker was used as a quality control for the cytosol isolation, and α-tubulin used as a cytosol loading control (n = 3 mice per group. *P < 0.05 vs. Cre-flox/- I/R mice).

(A) Both cHet (Cre+flox/-) and CON (Cre-flox/-) mice underwent either the I/R injury or the sham operation. IS was analyzed for both groups of mice with a representative 2,3,5-triphenyltetrazolium chloride (TTC) staining image and quantified in bar graph (n = 5 mice per group. **P < 0.01 vs. Cre-flox/- mice). (B) TUNEL staining performed (white arrow indicates TUNEL-positive nucleus) and the quantification is shown in the bar graph (**P < 0.01 vs. Cre-flox/- group). (C) Cleaved caspase-3 was also detected by Western blot with representative bands (α-tubulin was used as a loading control; **P < 0.01 vs. Cre-flox/- I/R group, n = 3 mice per group). (D) Cytochrome c release was quantified by Western blot; VDAC, a mitochondrial marker was used as a quality control for the cytosol isolation, and α-tubulin used as a cytosol loading control (n = 3 mice per group. *P < 0.05 vs. Cre-flox/- I/R mice).

Down-Regulated NDUFA13 Expression Is Associated with Increased Basal ROS Generation.

To investigated the profile of ROS generation by a partial loss of NDUFA13, we freshly isolated mitochondria from both cHet and CON mice that were treated with tamoxifen. We measured OCR and H2O2 levels simultaneously with the Oroboros O2k system. Using different substrates and blockers specific for complex I and complex III, we demonstrated that succinate caused a significant amount of H2O2 through reverse electron transport (RET) in the mitochondria from CON mice, this RET-induced ROS generation can be blocked by rotenone. In contrast, mitochondria from cHet mice exhibited a much smaller RET-induced H2O2, indicating an interrupted RET process. Importantly, however, further addition of pyruvate and malate resulted in an unexpected increase in H2O2 level in cHet mice, which was not observed in CON mice. A final addition of antimycin A resulted in a similar degree of increment in H2O2 in both CON and cHet mice (Fig. 4 and Fig. S3).
Fig. 4.

(A) H2O2 measured in freshly isolated mitochondria from Cre+ERtamNDUFA13flox/- or Cre-ERtamNDUFA13flox/- mice using Amplex Red as an indicator of fluorescence. Different substrates and blockers were used to differentiate the origin or mechanism of ROS generation induced by NDUFA13 down-regulation (*P < 0.05). (B) NMCMs isolated from NDUFA13flox/- mice were treated with either Ad-NC or Ad-Cre and then used for quantification of superoxide generation at both the basal state and after an exposure to the H/R injury. The fluorescence intensity by mitoSOX red was measured by a microplate reader (**P < 0.01, vs. Ad-NC–treated NMCMs exposed to H/R). (C) The same NMCMs used in B were infected with adenovirus containing either cyto-HyPer or mito-HyPer to measure H2O2 levels either at the basal state or after the H/R insult (**P < 0.01, vs. Ad-NC–treated NMCMs at the same condition).

Fig. S3.

(A) Mitochondria were freshly isolated from cHet (Cre+flox/-) and CON (Cre-flox/-) mice as shown in Fig. 3. H2O2 levels and OCR were simultaneously monitored for later analysis when different substrates and blockers for the mitochondrial respiratory complexes. Representative tracings were shown for both group mice (n = 3 mice per group). (B) Efficiency of infection for Ad-Cre or Ad-NC was tested in NMCMs that were obtained from NDUFA13flox/- mice by Western blotting to detect the expression levels of NDUFA13. (C) Representative imaging for NMCMs that were infected with adenovirus containing either cyto-HyPer or mito-HyPer, which can target the H2O2 in the cytosol and mitochondrion, respectively. (D) Fluorescence by mitoSOX red for measuring superoxide was also read at setting of excitation = 408 nm/emission = 560 nm (**P < 0.05 vs. Ad-NC–treated NMCMs after a H/R exposure).

(A) H2O2 measured in freshly isolated mitochondria from Cre+ERtamNDUFA13flox/- or Cre-ERtamNDUFA13flox/- mice using Amplex Red as an indicator of fluorescence. Different substrates and blockers were used to differentiate the origin or mechanism of ROS generation induced by NDUFA13 down-regulation (*P < 0.05). (B) NMCMs isolated from NDUFA13flox/- mice were treated with either Ad-NC or Ad-Cre and then used for quantification of superoxide generation at both the basal state and after an exposure to the H/R injury. The fluorescence intensity by mitoSOX red was measured by a microplate reader (**P < 0.01, vs. Ad-NC–treated NMCMs exposed to H/R). (C) The same NMCMs used in B were infected with adenovirus containing either cyto-HyPer or mito-HyPer to measure H2O2 levels either at the basal state or after the H/R insult (**P < 0.01, vs. Ad-NC–treated NMCMs at the same condition). (A) Mitochondria were freshly isolated from cHet (Cre+flox/-) and CON (Cre-flox/-) mice as shown in Fig. 3. H2O2 levels and OCR were simultaneously monitored for later analysis when different substrates and blockers for the mitochondrial respiratory complexes. Representative tracings were shown for both group mice (n = 3 mice per group). (B) Efficiency of infection for Ad-Cre or Ad-NC was tested in NMCMs that were obtained from NDUFA13flox/- mice by Western blotting to detect the expression levels of NDUFA13. (C) Representative imaging for NMCMs that were infected with adenovirus containing either cyto-HyPer or mito-HyPer, which can target the H2O2 in the cytosol and mitochondrion, respectively. (D) Fluorescence by mitoSOX red for measuring superoxide was also read at setting of excitation = 408 nm/emission = 560 nm (**P < 0.05 vs. Ad-NC–treated NMCMs after a H/R exposure). To confirm cHet mice mainly generated H2O2, we used mitoSOX red to detect the superoxide levels within the mitochondria. We cross-bred cHomo (NDUFA13flox/flox) mice with wild-type littermates (NDUFA13WT) to generate NDUFA13 heterozygous (NDUFA13flox/-) mice. The neonatal cardiomyocytes (NMCMs) were then obtained from these mice and transfected with adenovirus-containing Cre recombinase (Ad-Cre) or an empty vector as a normal control (Ad-NC). The effect of Cre recombinase on NDUFA13 expression in NMCMs was confirmed (Fig. S3). Using mitoSOX Red as a probe, we showed that at basal state, NMCMs treated with Ad-Cre or Ad-NC had a similar level of superoxide (Fig. 4), importantly, Ad-Cre–treated NMCMs exhibited much lower superoxide levels compared with Ad-NC–treated NMCMs when exposed to H/R (Fig. 4). NMCMs obtained from NDUFA13flox/- mice that had been treated with Ad-Cre or Ad-NC as described above were infected adenovirus containing mitochondrial targeting HyPer (mito-Hyper) or cytoplasm-targeting HyPer (cyto-HyPer) for measuring H2O2 in the mitochondria and in the cytoplasm, respectively (Fig. S3). At basal state, H2O2 level detected by cyto-HyPer was higher in Ad-Cre–treated NMCMs than that in Ad-NC–treated cells; however, the differences between the two cell groups were absent when measuring H2O2 levels in the mitochondria, further confirming that a leak was present within complex I when NDUFA13 was down-regulated. Interestingly, following H/R, a burst of H2O2 was present in both cytosol and mitochondria of Ad-NC–treated NMCMs, which was much less in the mitochondria in Ad-Cre–treated cells (Fig. 4).

The Molecular Structure of NDUFA13 in Maintaining the Integrity of Mitochondrial Membrane.

We then designed several adenoviruses that contained different truncated NDUFA13 mutants, including Ad-1 (with a deletion of amino acid 40–50), Ad-2 (a deletion of amino acids 70–80), Ad-3 (a deletion of amino acids 110–120), Ad-NDUFA13 (a wild-type full-length NDUFA13 as a normal control), and Ad-Vector (an empty vector as a negative control) (Fig. S4). By transfecting these various vectors respectively back into NDUFA13-depleted NMCMs (isolated from NDUFA13flox/flox mice and pretreated with Ad-Cre with the efficiency confirmed in Fig. S4), we can measure both MMP and H2O2 generation to test the role of the TMH in NDUFA13. The NMCMs transfected with Ad-Cre exhibited a significant decrease in MMP compared with NMCMs transfected with Ad-NC, as shown by measuring the fluorescence intensity (Fig. S4) or by flow cytometry (Fig. S4) following TMRM staining. Ad-NDUFA13, Ad-1, Ad-2, Ad-3, or Ad-Vector was then transfected into endogenous NDUFA13-depleted NMCMs (with the efficiency of transfection confirmed in Fig. S4). Ad-1 failed to colocalize with the mitochondria (Fig. S4) to maintain the MMP (Fig. S4), whereas Ad-2 and Ad-3 could fully mimic and compensate for wild-type NDUFA13 (Fig. S4 ). Importantly, the same pattern of changes was seen when cyto-Hyper was cotransfected into NDUFA13-depleted NMCMs to test if increased cytosolic H2O2 level in Ad-Cre–treated NMCMs was abolished by putting back different truncated NDUFA13 mutants (Fig. S4). These results strongly supported an essential role for TMH domain in maintaining the MMP, which also might serve as a main source of H2O2 generation.
Fig. S4.

(A) Schematic illustration of various truncated NDUFA13 mutants with a deletion of different segment of NDUFA13. Adenoviruses containing various HA-tagged truncated NDUFA13 mutants, including Ad-1 (a segment for amino acid 40–50 deleted), Ad-2 (a segment for amino acid 70–80 deleted), and Ad-3 (a segment for amino acid 110–120 deleted), wild-type full-length NDUFA13 (Ad-NDUFA13) as normal control, and an empty vector as a negative control (Ad-Vector) were designed and constructed. To test the role for each segment of NDUFA13 in maintaining MMP, NMCMs were isolated from NDUFA13flox/flox mice and then infected with either Ad-Cre to deplete the endogenous NDUFA13 or Ad-NC as controls. (B) The efficiency of Ad-Cre was confirmed by Western blot. (C) TMRM staining was then performed for these NMCMs with representative images, demonstrating that the depletion of endogenous NDUFA13 in NMCMs resulted in a loss of mitochondrial membrane potential, which was then confirmed by the flow cytometry (D). (E) After NDUFA13-depleted NMCMs were infected with adenovirus containing different mutants as described above, the efficiency for the infection was also confirmed by measuring the levels of NDUFA13. (F) Immunofluorescence imaging showed subcellular colocalization of the mitochondrial component TOMM20 (green) with the truncated NDUFA13 mutant protein (detected by HA in red; DAPI-stained nuclei in blue); the colocalization was only absent when Ad-1 was put back into NDUFA13-depleted NMCMs, indicating the importance of the α-helix structure of NDUFA13 for this molecule attached to the mitochondria. (G) The membrane potential was also tested in knockdown and restored NMCMs by flow cytometry using TMRM, further confirming that only Ad-1 failed to recapitulate a normal mitochondrial membrane potential. (H) The NMCMs obtained from NDUFA13flox/flox mice were treated with Ad-Cre (Ad-NC as a control) to deplete endogenous NDUFA13, exogenous wild-type NDUFA13, and truncated NDUFA13 mutants including Ad-1, Ad-2, and Ad-3 were then put back via adenovirus transfection the same way as shown above, with Ad-Vector and DMEM as controls. These cells were finally measured for cytoplasmic H2O2 levels using the Cyto-Hyper method as described above. *P < 0.05 vs. Ad-NC; #P < 0.05, vs. Ad-Cre treated with DMEM.

(A) Schematic illustration of various truncated NDUFA13 mutants with a deletion of different segment of NDUFA13. Adenoviruses containing various HA-tagged truncated NDUFA13 mutants, including Ad-1 (a segment for amino acid 40–50 deleted), Ad-2 (a segment for amino acid 70–80 deleted), and Ad-3 (a segment for amino acid 110–120 deleted), wild-type full-length NDUFA13 (Ad-NDUFA13) as normal control, and an empty vector as a negative control (Ad-Vector) were designed and constructed. To test the role for each segment of NDUFA13 in maintaining MMP, NMCMs were isolated from NDUFA13flox/flox mice and then infected with either Ad-Cre to deplete the endogenous NDUFA13 or Ad-NC as controls. (B) The efficiency of Ad-Cre was confirmed by Western blot. (C) TMRM staining was then performed for these NMCMs with representative images, demonstrating that the depletion of endogenous NDUFA13 in NMCMs resulted in a loss of mitochondrial membrane potential, which was then confirmed by the flow cytometry (D). (E) After NDUFA13-depleted NMCMs were infected with adenovirus containing different mutants as described above, the efficiency for the infection was also confirmed by measuring the levels of NDUFA13. (F) Immunofluorescence imaging showed subcellular colocalization of the mitochondrial component TOMM20 (green) with the truncated NDUFA13 mutant protein (detected by HA in red; DAPI-stained nuclei in blue); the colocalization was only absent when Ad-1 was put back into NDUFA13-depleted NMCMs, indicating the importance of the α-helix structure of NDUFA13 for this molecule attached to the mitochondria. (G) The membrane potential was also tested in knockdown and restored NMCMs by flow cytometry using TMRM, further confirming that only Ad-1 failed to recapitulate a normal mitochondrial membrane potential. (H) The NMCMs obtained from NDUFA13flox/flox mice were treated with Ad-Cre (Ad-NC as a control) to deplete endogenous NDUFA13, exogenous wild-type NDUFA13, and truncated NDUFA13 mutants including Ad-1, Ad-2, and Ad-3 were then put back via adenovirus transfection the same way as shown above, with Ad-Vector and DMEM as controls. These cells were finally measured for cytoplasmic H2O2 levels using the Cyto-Hyper method as described above. *P < 0.05 vs. Ad-NC; #P < 0.05, vs. Ad-Cre treated with DMEM.

STAT3 Is Responsible for the Cardioprotective Effects Caused by Moderate NDUFA13 Down-Regulation.

To test the role of STAT3, NMCMs were isolated from the following mice: NDUFA13WTSTAT3WT (wild-type), NDUFA13flox/-STAT3WT (NDUFA13 heterozygous), and NDUFA13flox/-STAT3flox/- (double heterozygous) knock-down mice (for mice cross-breeding, see ) and then transfected with Ad-Cre. Native blue PAGE followed by Western blot analysis detected the formation of STAT3 dimers in NMCMs obtained from NDUFA13 heterozygous mice, which was absent when NMCMs were treated with N-acetyl-l-cysteine (NAC) or when STAT3 was simultaneously down-regulated (Fig. 5). The expression of peroxiredoxin 2 (PRX2), which can cause STAT3 dimerization (19), was increased in NMCMs from NDUFA13 heterozygous mice. The increased PRX2 expression can be attenuated by NAC, indicating the essential roles of ROS. In contrast, no changes in GPX expression levels were detected in these NMCMs (Fig. 5). STAT3 dimerization was responsible for up-regulated Bcl-2 expression as attenuation of STAT3 dimerization abolished the Bcl2 up-regulation (Fig. 5). Of note, the Ad-Cre–treated NMCMs isolated from STAT3flox/- mice exhibited a moderate decrease in STAT3 expression; however, it did not affect the dimerized level of STAT3 (Fig. S5) compared with Ad-Cre–treated NMCMs isolated from STAT3WT mice (Fig. S5). The same were true with the levels of Bcl2 and PRX2 expression (Fig. S5).
Fig. 5.

NB-PAGE assay detected STAT3 oligomerization in heterozygous mice (Myh6Cre+NDUFA13flox/-STAT3WT) that could be abolished by either NAC (ROS scavenger) or simultaneous STAT3 knockdown (Myh6Cre+NDUFA13flox/-STAT3flox/-). NDUFA13, STAT3, GPX, PRX2, and Bcl2 expression levels were also quantified in each group of mice by Western blot, with β-actin as a loading control. **P < 0.01 vs. Myh6Cre+NDUFA13WTSTAT3WT mice.

Fig. S5.

NB-PAGE assay detected Stat3 oligomerization in heart tissue obtained from cardiac-specific STAT3 heterozygous (Myh6Cre+STAT3-lox/-) and control (Myh6Cre+STAT3WT) mice that were treated with tamoxifen. STAT3 expression level was significantly down-regulated in STAT3 heterozygous knockout mice, but no significant differences in polymerized or dimerized STAT3 were detected, the same was true for PRX and Bcl2 expression levels measured by Western blot.

NB-PAGE assay detected STAT3 oligomerization in heterozygous mice (Myh6Cre+NDUFA13flox/-STAT3WT) that could be abolished by either NAC (ROS scavenger) or simultaneous STAT3 knockdown (Myh6Cre+NDUFA13flox/-STAT3flox/-). NDUFA13, STAT3, GPX, PRX2, and Bcl2 expression levels were also quantified in each group of mice by Western blot, with β-actin as a loading control. **P < 0.01 vs. Myh6Cre+NDUFA13WTSTAT3WT mice. NB-PAGE assay detected Stat3 oligomerization in heart tissue obtained from cardiac-specific STAT3 heterozygous (Myh6Cre+STAT3-lox/-) and control (Myh6Cre+STAT3WT) mice that were treated with tamoxifen. STAT3 expression level was significantly down-regulated in STAT3 heterozygous knockout mice, but no significant differences in polymerized or dimerized STAT3 were detected, the same was true for PRX and Bcl2 expression levels measured by Western blot. Both cardiac-specific NDUFA13 heterozygous (Myh6Cre+NDUFA13flox/-STAT3WT) and cardiac-specific double heterozygous (Myh6Cre+NDUFA13flox/-STAT3flox/-) mice were treated with tamoxifen the same way as described above. Two weeks later, these mice were exposed to I/R injury. The cardiac protection against I/R injury offered by a moderate NDUFA13 was abolished when STAT3 was simultaneously down-regulated in mice as evidenced by an increase in IS (Fig. 6), which also resulted in a reversal in TUNEL-positive cells in the peri-infarct area (Fig. 6), as well as the cleaved caspase-3 expression (Fig. 6). Of note, cardiac-specific STAT3 heterozygous knockout (Myh6Cre+ERtamSTAT3flox/-) and Myh6Cre+ERtamSTAT3WT mice that received tamoxifen treatment exhibited a similar degree of I/R injury as evidenced by IS (Fig. S6), percentage of TUNEL staining-positive cells at peri-infarct area, and levels of cleaved caspase-3 (Fig. S6 ). Taken together, these data suggest that STAT3 is responsible for the cardioprotective effects against I/R injury when NDUFA13 expression is moderately down-regulated.
Fig. 6.

(A) The NDUFA13 heterozygous (Myh6Cre+NDUFA13flox/-STAT3WT) and NDUFA13 and STAT3 double heterozygous (Myh6Cre+NDUFA13flox/-STAT3flox/-) mice were studied the same way as described in Fig. 3 and IS quantified (**P < 0.01 between the two groups). (B) TUNEL staining performed in the peri-infarct area and the percentage of TUNEL-positive cells (marked by white arrows) over total nuclei shown in the bar graph (n = 5 mice per group; **P < 0.01 vs. NDUFA13 heterozygous I/R group). (C) STAT3 and cleaved caspase-3 expression levels measured by Western blot using the tissue of peri-infarct area from both group mice with α-tubulin as a loading control (n = 3 mice per group).

Fig. S6.

Cardiac-specific STAT3 heterozygous (Myh6Cre+STAT3-lox/-, Cre+STAT3flox/-) and control (Myh6Cre+STAT3WT, Cre+STAT3WT) mice, that had been treated with tamoxifen, experienced an I/R insult or underwent a sham-operated procedure as described above. (A) The IS was then measured the same way as described above for the two group mice. (B) TUNEL staining was performed in the peri-infarct area, and the percentage of TUNEL-positive cells (marked by white arrows) over total nuclei is shown in the bar graph (n = 5 mice per group). (C) Cleaved caspase-3 and STAT3 expression levels were measured by Western blot in both groups, and β-actin was used as a loading control (n = 3 mice per group).

(A) The NDUFA13 heterozygous (Myh6Cre+NDUFA13flox/-STAT3WT) and NDUFA13 and STAT3 double heterozygous (Myh6Cre+NDUFA13flox/-STAT3flox/-) mice were studied the same way as described in Fig. 3 and IS quantified (**P < 0.01 between the two groups). (B) TUNEL staining performed in the peri-infarct area and the percentage of TUNEL-positive cells (marked by white arrows) over total nuclei shown in the bar graph (n = 5 mice per group; **P < 0.01 vs. NDUFA13 heterozygous I/R group). (C) STAT3 and cleaved caspase-3 expression levels measured by Western blot using the tissue of peri-infarct area from both group mice with α-tubulin as a loading control (n = 3 mice per group). Cardiac-specific STAT3 heterozygous (Myh6Cre+STAT3-lox/-, Cre+STAT3flox/-) and control (Myh6Cre+STAT3WT, Cre+STAT3WT) mice, that had been treated with tamoxifen, experienced an I/R insult or underwent a sham-operated procedure as described above. (A) The IS was then measured the same way as described above for the two group mice. (B) TUNEL staining was performed in the peri-infarct area, and the percentage of TUNEL-positive cells (marked by white arrows) over total nuclei is shown in the bar graph (n = 5 mice per group). (C) Cleaved caspase-3 and STAT3 expression levels were measured by Western blot in both groups, and β-actin was used as a loading control (n = 3 mice per group).

Discussion

In the present study, we generated a conditional cardiac-specific moderately down-regulated NDUFA13 mice, which were more tolerant to I/R injury, exhibited a smaller IS, and lower apoptotic activity. We then investigated ROS profile induced by mitochondria NDUFA13 down-regulation and detected a moderate increase in the levels of hydrogen peroxide, but not superoxide, in these mice. We have provided strong evidence to show that partial loss of NDUFA13 constitutes a structural substrate allowing for an electron leak such that a small amount of H2O2 would be continuously generated. As a result of a mild increase in hydrogen peroxide, up-regulated PRX2 expression occurred, leading to STAT3 dimerization and, hence, enhanced Bcl-2 expression, which were responsible for the protection offered by NDUFA13 down-regulation. Thus, we have not only elucidated a novel molecular mechanism of cardiac protection for which H2O2 functions as an important second messenger, more importantly we also have linked a unique profile of ROS to the specific molecule, NDUFA13, with its own molecular structure situated within the mitochondrial complex I. Electron transfer across the different segments of mitochondrial complexes serves as a form of energy transduction, creating an electrochemical gradient across the inner membrane. It also dictates the form of ROS generated in both physiological and pathological states, such as the procession of I/R injury, due to the different electrochemical potentials pertaining to the different respiratory moieties (2, 3, 11). With normal oxygen supply, the short electronic effect of FMN is usually surpassed by the strong electron-withdrawing ability of its downstream FeS clusters (7). However, under oxygen deprivation conditions, the failure of electrons to react with their acceptor, oxygen, within complex IV sequentially saturates the FeS clusters and the FMN of complex I with electrons. Once the oxygen supply is restored, O2 then can react with FMNH2/FSQ, which is filled with electrons, to generate superoxides (in the form of •O2−). This is a typical hypoxia-reperfusion scenario. •O2− is highly reactive, and the unpaired electrons on •O2− will capture any available electrons from molecules they may encounter, thus producing the relatively more stable H2O2. Although coenzyme Q is also filled with electrons, its reduction potential is +0.113 (7), which is insufficient for the production of •O2− (O2/•O2− −0.13 V) but not H2O2 (O2/H2O2 +0.70 V). H2O2 is a milder type of ROS than •O2−. Under normal physiological conditions, a low level of H2O2 generation can mediate a variety of signaling events (20, 21). Compared with prokaryotic cells, eukaryotic mitochondrial complex I has more nuclear-encoded subunits, which play essential roles in ensuring energy transduction along the mitochondria in a safe and efficient way (22). NDUFA13 is regarded as one of these accessory subunits and located at the heel position of mitochondrial complex I, with its helix segment inserted obliquely into hydrophobic chains ND1 and ND2 of complex I and TMH segment further anchored into the mitochondrial inner membrane (13). Using MOE software and the available database (PDB ID code: 5LDX), we did further analysis and noticed that the first 33 amino acids of NDUFA13 extend along the dorsal side of the CoQ binding chamber after penetrating the inner membrane and are parallel to the last three FeS clusters (N2, N6b, and N6a), which are ∼31 Å apart. The enlarged tail of NDUFA13 remains on the intermembrane side of ND1 and ND2 (Fig. S7). The unique location and structure of NDUFA13 suggest that it may form a channel within complex I that interconnects the matrix with membrane interstitium (23). In the present study, we were mainly focused on elucidating the profile of ROS generated when NDUFA13 were down-regulated. Our data showed that moderate NDUFA13 knockdown resulted in an increase in H2O2 without involving in changes in MMP. We applied sequential experiments to test this notion that partial loss of NDUFA13 mainly resulted in an increase in H2O2. Data obtained from isolated mitochondria with Amplex red provided direct evidence of H2O2 generation secondary to NDUFA13 knockdown, which was confirmed by measuring superoxide within the mitochondria using mitoSOX red, showing no increase in superoxide generation at the basal state. Site-specific detection of H2O2 using cyto-HyPer and mito-HyPer further validated that H2O2 generated by partial loss of NDUFA13 was localized in the cytosol, but not in the mitochondria. Most importantly, a mild increase in H2O2 at the basal state can prevent the burst of superoxide generation following I/R injury. Taken together, we would propose our preliminary idea of a “spillhole theory” for which NDUFA13 serves as a guardian that gauges electron flow across the electron transfer chain, which should be closely related to the location and functional structure of NDUFA13 within mitochondrial respiratory complex I (Fig. S7).
Fig. S7.

Schematic mechanisms of NDUFA13, demonstrating the major components of the electron transfer chain in complex I and the location where NDUFA13 is anchored. In wild-type mice (the left CI of ETC), the usual response to I/R injury involves a significant amount of superoxide production, leading to cell damage. In mice with a moderate loss of NDUFA13 (moderate knockdown, shown on the right CI), a decent amount of electron leak occurs. Due to the specific location of NDUFA13, where a lower electrochemical potential exists at segments of complex I, a moderate amount of hydroxyl peroxide is generated in the basal state. This, in turn, activates PRX2 and results in STAT3 dimerization. Of note, there was no change in GPX expression. Based on the database (PDB ID code: 5LDX), the first 33 aa of NDUFA13 extend along the dorsal side of the CoQ binding chamber after penetrating the inner membrane and are parallel to the last three FeS clusters (N2, N6b, and N6a), being ∼31 Å apart. The enlarged tail of NDUFA13 remains on the intermembrane side of ND1 and ND2.

Schematic mechanisms of NDUFA13, demonstrating the major components of the electron transfer chain in complex I and the location where NDUFA13 is anchored. In wild-type mice (the left CI of ETC), the usual response to I/R injury involves a significant amount of superoxide production, leading to cell damage. In mice with a moderate loss of NDUFA13 (moderate knockdown, shown on the right CI), a decent amount of electron leak occurs. Due to the specific location of NDUFA13, where a lower electrochemical potential exists at segments of complex I, a moderate amount of hydroxyl peroxide is generated in the basal state. This, in turn, activates PRX2 and results in STAT3 dimerization. Of note, there was no change in GPX expression. Based on the database (PDB ID code: 5LDX), the first 33 aa of NDUFA13 extend along the dorsal side of the CoQ binding chamber after penetrating the inner membrane and are parallel to the last three FeS clusters (N2, N6b, and N6a), being ∼31 Å apart. The enlarged tail of NDUFA13 remains on the intermembrane side of ND1 and ND2. Our present study also provided additional evidence that H2O2 promotes the formation of disulfide-linked STAT3 oligomers with the help of PRX2, which regulates the transcriptional activity of STAT3 to up-regulate Bcl2 expression (24), and renders tumor cells more resistant to chemotherapy (15). The protection offered by down-regulated NDUFA13 through STAT3 signaling did not affect the extrinsic apoptotic pathway, as we did not observe significant changes in cleaved caspase-8 levels. In addition, the key components of the upstream molecule of intrinsic mitochondria-dependent apoptosis signaling pathway, such as ASK and JNK, were not affected. These changes indicate that the protection was mainly targeting the mitochondria. In conclusion, a mild defective structure related to subunits of mitochondrial complex I, such as N2 with low electrochemical potential, can produce only H2O2, which can serve as a second messenger to activate STAT3/Bcl2, an important antiapoptotic signaling pathway. Thus, our study provided another protective mechanism against apoptosis induced by I/R injury.

Materials and Methods

Reagents.

See for details.

Animals.

Mice with a pair of loxP sites flanking exon3 of NDUFA13 (Fig. S8 and Table S2) were generated at the Shanghai Biomodel Organisms Center using standard methods and mated with FLP mice to excise the Neo cassette. MYH6-CreERtam mice (25) (no. 005657) and STAT3flox/flox mice (no. 016923) from The Jackson Laboratory used for breeding various genotyping mice (see for detailed procedures). All procedures were approved by the Zhejiang University Institutional Animal Care and Use Committee and are in compliance with NIH Publication no. 85-23 (revised 1996). All mice were housed, bred, and maintained under specific pathogen-free (SPF) conditions.
Fig. S8.

(A) A vector was generated where the exon 3 of NDUFA13 was flanked by one pair of loxPs, with one site loxP following a Frt-Pgk-Neo-polyA-Frt cassette. The linearized targeting vector was then introduced into SCR012 ES cells by electroporation, and G418-resistant clones were screened for homologous recombination. Targeted ES clones were microinjected into ICR eight-cell stage embryos and transferred into pseudo pregnant ICR females. The resulting chimeras were bred with C57BL/6 mice, and heterozygous offsprings were mated with FLP mice to get neo-free NDUFA13flox/- mice. (B) PCR analysis of the genomic DNA derived from mouse tail for Myh6-CreERtam, NDUFA13, and STAT3.

Table S2.

Sequences of primers for mice genotyping and siRNA targeting rat NDUFA13

Name for the target genesSequence
Primers
 ndufa13 (mice)5′CCCAGACTGCCTAGTACCCTAACA3′
5′GGGCCTTCTTCCACTGTTCTTATT3′
 stat3 (mice)5′TTGACCTGTGCTCCTACAAAAA3′
5′CCCTAGATTAGGCCAGCACA3′
 myh6-creER (mice)5′AGGTGGACCTGATCATGGAG3′
5′CTAGGCCACAGAATTGAAAGATCT3′
5′GTAGGTGGAAATTCTAGCATCATCC3′
5′ATACCGGAGATCATGCCAGC3′
siRNA
 ndufa13 (rats)5′GCCUUGAUCUUUGGCUACUTT3′
(A) A vector was generated where the exon 3 of NDUFA13 was flanked by one pair of loxPs, with one site loxP following a Frt-Pgk-Neo-polyA-Frt cassette. The linearized targeting vector was then introduced into SCR012 ES cells by electroporation, and G418-resistant clones were screened for homologous recombination. Targeted ES clones were microinjected into ICR eight-cell stage embryos and transferred into pseudo pregnant ICR females. The resulting chimeras were bred with C57BL/6 mice, and heterozygous offsprings were mated with FLP mice to get neo-free NDUFA13flox/- mice. (B) PCR analysis of the genomic DNA derived from mouse tail for Myh6-CreERtam, NDUFA13, and STAT3. Sequences of primers for mice genotyping and siRNA targeting rat NDUFA13

Animal Model of I/R Injury.

In brief, using a surgical approach, I/R injury was induced with 45 min of ischemia followed by 3 h of reperfusion. Sham surgical procedures were performed on the control group. IS was expressed as the percentage of the infarct area compared with the area at risk (for details, see ).

NMCMs with NDUFA13 Knockdown and Putback.

NMCMs obtained from NDUFA13flox/flox mice were transfected with adenovirus containing Myh6-Cre to deplete endogenous NDUFA13, then infected with recombinant adenoviruses that expressed truncated mouse NDUFA13 cDNAs. The overexpression of various NDUFA13 mutants was confirmed by Western blot (for details, see ).

High-Resolution Respirometry.

The Oxygraph-2k (O2k; OROBOROS Instruments) was used for measuring mitochondria respiration (26). Substrates and inhibitors were added sequentially to determine complex I, II, and IV respiration as indicated in the figure (for details, see ).

Detection of H2O2 and •O2− Production.

H2O2 flux was measured simultaneously with respirometry in the O2k-Fluorometer using the H2O2-sensitive probe (10 μM Amplex UltraRed; Thermo Fisher A36006). For measurements of H2O2 production in intact cells, Ad-Cre or Ad-NC were infected with adenovirus carrying either Cyto-HyPer or Mito-Hyper (27). The intensity of fluorescence was measured by microplate reader. For superoxide measurements (28), the same designated NMCMs were studied and loaded with MitoSOX Red (5 mM for 10 min; Thermo Fisher M36008), and the intensity of fluorescence was measured by microplate reader (for details, see ). For detailed information regarding Western blot, TUNEL staining, siRNA transfection mitochondria isolation, immunostaining, echocardiography, TEM, MMP determination, the quantification of H2O2 and •O2−, native blue PAGE, H/R injury NMCM isolation (29), high-resolution respirometry, and NDUFA13 knockdown and putback, please refer to .

Statistical Analysis.

Data are presented as the mean ± SD. After confirming that all variables were normally distributed using the Kolmogorov–Smirnov test, unpaired Student’s t test was used to determine the differences between two groups. *P < 0.05 was considered as statistically significant.

SI Sequence of Truncated NDUFA13 (Mouse) Plasmids

Full Length: NM_023312.

atggcggcgtcgaaggtgaagcaggacatgcccccgccagggggctacggccccatcgactacaagcggaacctgccccgccggggactgtcggggtacagcatgtttgctgtgggcatcggggccttgatctttggctactggagaatgatgaggtggaaccaggagcgcaggcgcctgctgattgaggacttggaggccaggatcgccctcatgccgctcttccaggcagagaaggaccggaggaccctgcagattctccgggaaaacctggaggaggaagccatcatcatgaaggatgtgcccaactggaaggtgggcgagtctgtgttccataccacacgatgggtgccacccctcattggcgagatgtatgggttgcgcaccaaggaggagatgagcaatgccaacttcggcttcacctggtacacttag

Plasmid1:Δ40–49AA, C’-HA Tag.

atggcggcgtcgaaggtgaagcaggacatgcccccgccagggggctacggccccatcgactacaagcggaacctgccccgccggggactgtcggggtacagcatgtttgctgtgggcatgatgaggtggaaccaggagcgcaggcgcctgctgattgaggacttggaggccaggatcgccctcatgccgctcttccaggcagagaaggaccggaggaccctgcagattctccgggaaaacctggaggaggaagccatcatcatgaaggatgtgcccaactggaaggtgggcgagtctgtgttccataccacacgatgggtgccacccctcattggcgagatgtatgggttgcgcaccaaggaggagatgagcaatgccaacttcggcttcacctggtacacttag

Plasmid2:Δ70–79AA, C’-HA Tag.

atggcggcgtcgaaggtgaagcaggacatgcccccgccagggggctacggccccatcgactacaagcggaacctgccccgccggggactgtcggggtacagcatgtttgctgtgggcatcggggccttgatctttggctactggagaatgatgaggtggaaccaggagcgcaggcgcctgctgattgaggacttggaggccaggatcgaccggaggaccctgcagattctccgggaaaacctggaggaggaagccatcatcatgaaggatgtgcccaactggaaggtgggcgagtctgtgttccataccacacgatgggtgccacccctcattggcgagatgtatgggttgcgcaccaaggaggagatgagcaatgccaacttcggcttcacctggtacacttag

Plasmid3:Δ110–119AA, C’-HA Tag.

atggcggcgtcgaaggtgaagcaggacatgcccccgccagggggctacggccccatcgactacaagcggaacctgccccgccggggactgtcggggtacagcatgtttgctgtgggcatcggggccttgatctttggctactggagaatgatgaggtggaaccaggagcgcaggcgcctgctgattgaggacttggaggccaggatcgccctcatgccgctcttccaggcagagaaggaccggaggaccctgcagattctccgggaaaacctggaggaggaagccatcatcatgaaggatgtgcccaactggaaggtgggcgagtctctcattggcgagatgtatgggttgcgcaccaaggaggagatgagcaatgccaacttcggcttcacctggtacacttag

HA Sequence.

TACCCATACGATGTTCCAGATTACGCT(Y P Y D V P D Y A)

SI Materials and Methods

MiR05 [110 mM sucrose, 60 mM K-lactobionate (Sangon)], 0.5 mM EGTA, 3 mM MgCl2, 20 mM taurine (Sigma), 10 mM KH2PO4, 20 mM Hepes (Sigma), pH 7.1 at 30 °C, and 0.1% BSA essentially fatty acid free), sodium pyruvate (Sigma), l-malic acid (Life Technologies), N-phenylthiourea (Sigma), 6-propyl-2-thiouracil (Sigma), cytochrome c from equine heart (Sigma), carbonyl cyanideo 3-chlorophenyl-hydrazone (Sigma), Rotenone (Fluka), ADP (Sigma), and antimycin A (Santa Cruz) were used for measurements of mitochondria respiration. All procedures were approved by the Zhejiang University Institutional Animal Care and Use Committee and are in compliance with NIH Publication no. 85–23 (revised 1996). All mice were housed, bred, and maintained under specific pathogen-free (SPF) conditions. Mice with a pair of loxP sites flanking exon3 of NDUFA13 (Fig. S1) were generated at the Shanghai Biomodel Organisms Center using standard methods; then, they were mated with FLP mice to excise the Neo cassette. The offspring were mated with MYH6-CreERtam transgenic mice (25) (no. 005657; from The Jackson Laboratory) to generate tamoxifen-inducible cardiomyocyte-specific NDUFA13 heterozygous knockout mice (Myh6-Cre+NDUFA13flox/-). Myh6-Cre+NDUFA13flox/flox mice were then generated. Cardiac-specific conditional NDUFA13 and STAT3 double heterozygous mice (Myh6-Cre+NDUFA13flox/-STAT3flox/-) were generated by crossing cardiac-specific Myh6-Cre+NDUFA13flox/flox mice with STAT3flox/flox mice (stock no. 016923; The Jackson Laboratory). Tamoxifen-inducible cardiomyocyte-specific STAT3 heterozygous knockout mice (Myh6-Cre+STAT3flox/-) were used for study in comparison with Myh6-Cre+STAT3WT. Cre recombinase was activated by tamoxifen injection (45 mg/kg, i.p.) for 5 d. To investigate the detailed mechanisms by which NDUFA13-mediated H2O2 generation is responsible for STAT3 dimerization and Bcl2 up-regulation, NDUFA13flox/-STAT3flox/- mice were generated by cross-breeding NDUFA13flox/flox mice with STAT3flox/flox mice, and NMCMs obtained from these mice were treated with Ad-Cre to simultaneously down-regulate both NDUFA13 and STAT3. Male mice were anesthetized by injection of sodium pentobarbital (60 mg/kg, i.p.) followed by tracheal intubation aided by a rodent ventilator. Body temperature was maintained at 37 °C with a heating pad and monitored with a thermometer. With a sterile surgical procedure, left thoracotomy was performed through the third intercostal space, and the ribs were gently retracted to expose the heart. After pericardiotomy, the left anterior descending coronary artery was encircled by a 8-0 Prolene suture just distal to its first branch, and its ends were threaded through polyethylene tubing to form a snare for reversible coronary artery occlusion. Before coronary artery occlusion, the animals were anticoagulated (150 U/kg sodium heparin) and received an injection of lidocaine (4 mg/kg) that has been shown to prevent malignant arrhythmia without affecting the cardioprotective effects. Cardiac ischemia was confirmed by a pale area below the suture or ST-T elevation shown in ECG that gradually became cyanotic, while reperfusion was characterized by rapid disappearance of cyanosis followed by vascular blush. Sham group underwent the same surgical procedures except coronary artery ligation. After the mice were killed, the coronary artery was reoccluded and 2% Evans blue dye was retrogradely injected into the ascending aorta to delineate the area at risk. The heart was then cut into four transverse slices, followed by incubation for 15 min at 37 °C in a phosphate-buffered 1% TTC solution to determine infracted myocardium. The extent of the area of necrosis was quantified by computerized planimetry and corrected for the weight of the tissue slices. IS was expressed as the percentage of total weight of the left ventricle (LV) of area at risk.

Neonatal Mice Myocytes Isolation and Cell Culture.

NMCMs were isolated from the mice of indicated genotype by collagenase II [0.05% (wt/vol) (Invitrogen)] and trypsin [0.05% (wt/vol), Genom] treatment as previously described (29). NMCMs and H9C2 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Corning) that was supplemented with 10% (vol/vol) FBS (Life Technologies) and 100 U/mL penicillin/streptomycin (vol/vol) at a density of 1 × 106 cells per milliliter. All cells were cultured in an atmosphere of 5% CO2 at 37 °C.

H/R Injury.

The method of the introduction of H/R injury to the cells has been described previously in our laboratory (31). Briefly, hypoxia was achieved by incubating the cells in a hypoxia chamber in the absence of serum and glucose with an atmosphere of 0.5% O2/5% CO2 at 37 °C for 6 h. Cells were then reoxygenated under normoxic conditions in a 95% N2/5% CO2 humidified atmosphere at 37 °C for 18 h in DMEM containing normal glucose. The cells as normal controls were incubated at 37 °C under normoxic conditions.

siRNA Transfection.

Either siRNA (Ribobio) targeting rat NDUFA13 (sequence 5′GCCUUGAUCUUUGGCUACUTT3′) or scramble siRNA (as negative control) were transfected into H9C2 cells according to the manufacturer’s instructions. Briefly, cells were transfected with 50 (100, 200) nM siRNA in serum-free and antibiotics-free DMEM containing 5 μL of Lipofectamine 2000 (Invitrogen). The medium was changed 6 h later with normal growth medium supplemented with FBS (Gibco). After 24-h transfection, cells were harvested to measure the expression levels of NDUFA13.

TUNEL Staining.

Using a commercially available kit (Roche), TUNEL staining was performed following manufacturer’s instruction. For each heart tissue, at least 100 cells at reperfused area were counted in 10 fields (Leica).

Western Blot.

Proteins were isolated from cultured cells and snap-frozen hearts, extracted in RIPA solution (Beyotime) with protease inhibitor mixture (Roche). Mitochondria and cytoplasmic protein fractions were obtained using Mitochondria Isolation Kit (Beyotime) according to the manufacturer’s instruction. Proteins were quantified using BCA Protein Assay Kit (Thermo Fisher). Ten-microgram proteins were loaded on 12% SDS/PAGE gel and transferred to PVDF membrane (Millipore). Membranes were incubated with primary antibodies as follows: STAT3 (CST), Cyto-C (CST), cleaved caspase-3 (CST), cleaved caspase-8 (CST), cleaved caspase-9 (CST), ASK1 (CST), p-ASK1-Thr845 (CST), JNK (CST), p-JNK (CST), Bcl-2 (CST), SDHC (Abcam), NDUFA13 (Abcam), NDUFB8 (Abcam), PGC-1α (Abcam), ATP5A (Abcam), ATP2A2 (Abcam), GPX (Abcam), PRX2 (Abcam), VDAC (Abcam), β-Actin (Santa Cruz), α-Tubulin (Santa Cruz). Immunoblots were quantified by analyzing bands using ImageLab software.

Isolation of Mouse Heart Mitochondria.

Mitochondria were isolated from freshly harvested heart. Heart tissue of 100 mg was washed and minced in 1 mL of ice-cold PBS. The tissue was transferred to a precooled glass potter homogenizer with 1 mL of isolation buffer (Beyotime), homogenized with 20 strokes at medium speed, and then centrifuged for 5 min at 600 × g, 4 °C. The supernatant was transferred to a new tube and centrifuged for 10 min at 3,500 × g, 4 °C. After centrifugation, the supernatant was carefully transferred to a new tube for cytoplasmic protein and the remaining mitochondrial pellet was washed in 1 mL of isolation buffer and resuspended in 100 µL of isolation buffer. Isolated heart mitochondria were stored on ice for further analysis.

Immunostaining.

Cardiomyocytes were plated on eight-well culture slide (Falcon). For immunofluorescence staining, cells were incubated with primary antibody against Troponin I, NDUFA13, TOMM20, or HA overnight at 4 °C, followed by incubation for 1 h at room temperature with Dylight 488 or 550-conjugated goat anti-rabbit and Dylight 650-conjugated goat anti-mouse secondary antibody (Abcam), respectively. Coverslips were mounted with mounting medium with DAPI (Vector). Images were acquired using Leica microscope.

Echocardiography.

Transthoracic echocardiography (vevo 2100; VisualSonics) was performed at day 14 after Tamoxifen injection. Two-dimensional parasternal long axis and short axis view at papillary muscle level were obtained and M-mode imaging captured to analyze the cardiac structure and function. Mice were anesthetized by isoflurane inhalation.

TEM.

Mice heart specimens of the indicated genotype were fixed in glutaraldehyde, followed by treatment with osmium tetroxide, and further staining with ranyl acetate. After dehydration by ethanol solutions, the heart was embedded in epoxy resin. Thereafter, the tissue blocks were trimmed and ultra-thin sections (120 nm) were cut. Samples were examined under a transmission electron microscope (H7500TEM; Hitachi). Images were randomly captured for assessing the morphological changes of the heart.

Determination of the Mitochondrial Membrane Potential.

TMRM staining solution was prepared at 100 nM concentration according to the manufacturer’s instructions. Cells were grown in conditions described as previously. After completion of H/R intervention, the cell growth medium was removed and TMRM solution was then added to the cells. After 30-min incubation at 37 °C, cells were treated with trypsin for flow cytometry measurement (BD FACSCanto II flow cytometer; BD Biosciences) at 579 nm wavelength.

Native Blue PAGE.

Mitochondrial proteins were solubilized in 250 μL of cold 1× NativePAGE Sample Buffer containing 3% Digitonin. Lysates were centrifuged at 20,000 × g for 30 min at 4 °C, and supernatant was transferred to sterile microcentrifuge tubes. Before electrophoresis, protein concentration of each sample was determined using BCA protein assay and 44 μL of NativePAGE 5% G-250 Sample Additive (Life Technologies) was added. Sample of 40 μg was loaded onto the precast gel (Thermo Fisher) and performed Blue Native Electrophoresis Using XCell SureLock Mini-Cell (Thermo Fisher). After electrophoresis, proteins were transferred to PVDF membrane (Millipore) and underwent Western blot the same as SDS/PAGE.

Detection of H2O2 and -O2• Production.

Using freshly isolated mitochondria from indicated group mice, H2O2 flux was measured simultaneously with respirometry in the O2k-Fluorometer using the H2O2-sensitive probe (10 μM Amplex UltraRed; Thermo Fisher A36006; 1 U/mL horseradish peroxidase and 5 U/mL superoxide dismutase) (26). The intensity of fluorescence was continuously recorded when different substrate for complex I and II was added, and pharmacological blockers for complex I and III were added. Only the stable portions of the apparent fluxes were selected, and artifacts induced by additions of chemicals or reoxygenations were excluded. For measurements of H2O2 production in intact cells, designated NMCMs that were plated on 25-mm coverslips coated with laminin (20 mg/mL) and had been treated with either Ad-Cre or Ad-NC were infected with adenovirus carrying either cytoplasm-targeted HyPer (cyto-HyPer, for detecting cytosolic hydrogen peroxide) or mitochondria-targeted HyPer (Mito-Hyper, for mitochondrial hydrogen peroxide) at a multiplicity of infection of 50. NMCMs were cultured in M199 medium (Sigma-Aldrich) supplemented with 0.02% BSA, 5 mM creatine, 2 mM l-carnitine, 5 mM taurine, 5 mM Hepes, and insulintransferrin-selenium X. Myocytes were kept in culture for 48 h to allow adequate indicator expression before the measurement. The intensity of fluorescence given by MitoHyper or Cyto-Hyper was measured by a microplate reader (Ex500/Em535, SpectraMax M5; Molecular Devices) (27). The reading obtained from NMCMs without HyPer indicator was used as background controls. For superoxide measurements, the same designated NMCMs as described above were loaded with MitoSOX Red (5 mM for 10 min; Thermo Fisher M36008). The intensity of fluorescence was measured by a microplate reader (SpectraMax M5; Molecular Devices) both at 510 nm and 405 nm (28) of excitation, and emission was collected at 560 nm. The fluorescent intensity reading was normalized by protein concentration. The Oxygraph-2k (O2k; OROBOROS Instruments) was used for measuring mitochondria respiration (26). A 5-µL volume of mitochondrial suspension that was freshly isolated was added to each chamber filled with 2 mL of 37 °C MiR05 (). Cytochrome C (10 μM) and ADP (2.5 mM) were added to saturate OXPHOS capacity before substrates and inhibitors were injected into the system. Pyruvate (P, 5 mM) and malate (M, 0.5 mM) (Fig. S2) were used to determine complex I respiration; complex I inhibitor Rotenone (0.5 μM) and succinate (10 mM) were used to determine complex II respiration; the complex III inhibitor antimycin A (2.5 μM), and TMPD (100 μM) plus ascorbate (10 mM) were added sequentially to determine complex IV respiration as indicated in the figure. Freshly isolated NMCMs were transfected with adenovirus-containing Myh6-Cre (provided by Hanbio Biotechnology Company) to deplete endogenous NDUFA13. Recombinant adenoviruses that expressed truncated mouse NDUFA13 cDNAs [including Ad-1, Ad-2, and Ad-3 with the deletion of various segments within NDUFA13, as shown in ] and an HA tag were all provided by the Hanbio Biotechnology Company. Adenoviruses containing wild-type full-length NDUFA13 (Ad-NDUFA13) or empty vector (Ad-vector, as a control) were also generated. NMCMs obtained from NDUFA13flox/flox mice that were infected with adenoviruses containing Myh6-Cre were also infected with the purified virus overnight at a multiplicity of infection of 50 with polybrene (final concentration of 8 μg/mL, Sigma). The viral suspension was replaced with fresh medium the day after infection, and then, after 48 h, gene expression was evaluated. The efficiency of NDUFA13 knockout by Myh6-Cre infection was confirmed by Western blot analysis for NDUFA13 protein expression; additionally, the overexpression of various NDUFA13 mutants was also confirmed.
  29 in total

1.  Redox biology: signaling via a peroxiredoxin sensor.

Authors:  Christine C Winterbourn; Mark B Hampton
Journal:  Nat Chem Biol       Date:  2014-12-17       Impact factor: 15.040

2.  Cardiac ankyrin repeat protein attenuates cardiomyocyte apoptosis by upregulation of Bcl-2 expression.

Authors:  Na Zhang; Feiming Ye; Wei Zhu; Dexing Hu; Changchen Xiao; Jinliang Nan; Sheng'an Su; Yingchao Wang; Mingfei Liu; Kanglu Gao; Xinyang Hu; Jinghai Chen; Hong Yu; Xiaojie Xie; Jian'an Wang
Journal:  Biochim Biophys Acta       Date:  2016-10-03

3.  A proton relay enhances H2O2 sensitivity of GAPDH to facilitate metabolic adaptation.

Authors:  David Peralta; Agnieszka K Bronowska; Bruce Morgan; Éva Dóka; Koen Van Laer; Péter Nagy; Frauke Gräter; Tobias P Dick
Journal:  Nat Chem Biol       Date:  2015-01-12       Impact factor: 15.040

4.  Peroxiredoxin-2 and STAT3 form a redox relay for H2O2 signaling.

Authors:  Mirko C Sobotta; Willy Liou; Sarah Stöcker; Deepti Talwar; Michael Oehler; Thomas Ruppert; Annette N D Scharf; Tobias P Dick
Journal:  Nat Chem Biol       Date:  2014-11-24       Impact factor: 15.040

5.  Downregulation of GRIM-19 promotes growth and migration of human glioma cells.

Authors:  Yanmin Zhang; Hongbo Hao; Shidou Zhao; Qian Liu; Qiuhuan Yuan; Shilei Ni; Fuwu Wang; Shangming Liu; Liyan Wang; Aijun Hao
Journal:  Cancer Sci       Date:  2011-09-22       Impact factor: 6.716

6.  Hydrogen peroxide stimulates c-Src-mediated big mitogen-activated protein kinase 1 (BMK1) and the MEF2C signaling pathway in PC12 cells: potential role in cell survival following oxidative insults.

Authors:  Yuki Suzaki; Masanori Yoshizumi; Shoji Kagami; A Hajime Koyama; Yutaka Taketani; Hitoshi Houchi; Koichiro Tsuchiya; Eiji Takeda; Toshiaki Tamaki
Journal:  J Biol Chem       Date:  2002-01-08       Impact factor: 5.157

Review 7.  GRIM-19: A master regulator of cytokine induced tumor suppression, metastasis and energy metabolism.

Authors:  Shreeram C Nallar; Dhan V Kalvakolanu
Journal:  Cytokine Growth Factor Rev       Date:  2016-09-15       Impact factor: 7.638

8.  Monoallelic loss of tumor suppressor GRIM-19 promotes tumorigenesis in mice.

Authors:  Sudhakar Kalakonda; Shreeram C Nallar; Sausan Jaber; Susan K Keay; Ellen Rorke; Raghava Munivenkatappa; Daniel J Lindner; Gary M Fiskum; Dhananjaya V Kalvakolanu
Journal:  Proc Natl Acad Sci U S A       Date:  2013-10-21       Impact factor: 11.205

9.  Selective fluorescent imaging of superoxide in vivo using ethidium-based probes.

Authors:  Kristine M Robinson; Michael S Janes; Mariana Pehar; Jeffrey S Monette; Meredith F Ross; Tory M Hagen; Michael P Murphy; Joseph S Beckman
Journal:  Proc Natl Acad Sci U S A       Date:  2006-10-02       Impact factor: 11.205

10.  Crystal structure of the entire respiratory complex I.

Authors:  Rozbeh Baradaran; John M Berrisford; Gurdeep S Minhas; Leonid A Sazanov
Journal:  Nature       Date:  2013-02-17       Impact factor: 49.962

View more
  16 in total

Review 1.  Use the Protonmotive Force: Mitochondrial Uncoupling and Reactive Oxygen Species.

Authors:  Brandon J Berry; Adam J Trewin; Andrea M Amitrano; Minsoo Kim; Andrew P Wojtovich
Journal:  J Mol Biol       Date:  2018-04-04       Impact factor: 5.469

Review 2.  Mitochondrial complex I deficiency and cardiovascular diseases: current evidence and future directions.

Authors:  Maurizio Forte; Silvia Palmerio; Franca Bianchi; Massimo Volpe; Speranza Rubattu
Journal:  J Mol Med (Berl)       Date:  2019-03-12       Impact factor: 4.599

3.  Identification of Lactate-Related Gene Signature for Prediction of Progression and Immunotherapeutic Response in Skin Cutaneous Melanoma.

Authors:  Yalin Xie; Jie Zhang; Mengna Li; Yu Zhang; Qian Li; Yue Zheng; Wei Lai
Journal:  Front Oncol       Date:  2022-02-21       Impact factor: 6.244

4.  Expressions and clinical significances of STAT3 and Grim19 in epithelial ovarian cancer.

Authors:  Yiru Wang; Ying Yan; Mengying Yang; Zhijun Yang
Journal:  3 Biotech       Date:  2020-05-11       Impact factor: 2.406

Review 5.  Targeting mitochondrial dysfunction with small molecules in intervertebral disc aging and degeneration.

Authors:  Morteza Saberi; Xiaolei Zhang; Ali Mobasheri
Journal:  Geroscience       Date:  2021-02-26       Impact factor: 7.713

6.  [Pathogenic role of NDUFA13 inactivation in spontaneous hepatitis in mice and the mechanism].

Authors:  Xiaohui Xu; Rui Li; Xin Zeng; Xin Wang; Bingqian Xue; Daochao Huang; Yi Huang
Journal:  Nan Fang Yi Ke Da Xue Xue Bao       Date:  2021-01-30

Review 7.  STAT3 and Endothelial Cell-Cardiomyocyte Dialog in Cardiac Remodeling.

Authors:  Fouad A Zouein; George W Booz; Raffaele Altara
Journal:  Front Cardiovasc Med       Date:  2019-04-24

Review 8.  Recent Developments on the Crosstalk Between STAT3 and Inflammation in Heart Function and Disease.

Authors:  Mazen Kurdi; Carlos Zgheib; George W Booz
Journal:  Front Immunol       Date:  2018-12-19       Impact factor: 7.561

9.  Chronic Pressure Overload Results in Deficiency of Mitochondrial Membrane Transporter ABCB7 Which Contributes to Iron Overload, Mitochondrial Dysfunction, Metabolic Shift and Worsens Cardiac Function.

Authors:  Vikas Kumar; Aneesh Kumar A; Rahul Sanawar; Abdul Jaleel; T R Santhosh Kumar; C C Kartha
Journal:  Sci Rep       Date:  2019-09-11       Impact factor: 4.379

10.  Identification of recurrence marker associated with immune infiltration in prostate cancer with radical resection and build prognostic nomogram.

Authors:  Xin Rui; Siliang Shao; Li Wang; Jiangyong Leng
Journal:  BMC Cancer       Date:  2019-12-03       Impact factor: 4.430

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.