Literature DB >> 28814955

Characterization of Carbapenem-Resistant Acinetobacter baumannii Strains Isolated from Hospitalized Patients in Palestine.

Regeen Handal1,2, Lulu Qunibi3, Ibrahim Sahouri4, Maha Juhari5, Rula Dawodi1, Hiyam Marzouqa1, Musa Hindiyeh1,2,6.   

Abstract

The American Centers for Disease Control and Prevention (CDC) recognizes Acinetobacter baumannii as a source of global outbreaks and epidemics especially due to its increasing resistance to commercially available antibiotics. In this study, 69 single patient multidrug resistant isolates collected from all over Palestine, except Gaza, were studied. All the isolates were resistant to all the β-lactam antibiotics including the carbapenems. Of the 69 isolates, 82.6% were positive for blaOXA-23, 14.5% were positive for blaOXA-24, and 3% were positive for blaOXA-58. None were positive for blaOXA-143 and blaOXA-235. In addition, 5.8% and 0% were positive for blaNDM and blaKPC, respectively. Of the 69 isolates, none were positive for the aminoglycoside aphA6 gene while 93% were positive for the aphA1 gene. The acetyltransferases aacC1 and aacA4 genes tested positive in 22% and 13% of the isolates, respectively. The ompA biofilm-producing virulence gene was detected in all isolates. Finally, Multilocus Sequence Typing (MLST) of 13 isolates revealed that more than one strain of A. baumannii was circulating in Palestinian hospitals as results revealed that 7 isolates were of ST208, 2 isolates ST218, 1 isolate ST231, 1 isolate ST348, and 2 new Sequence Types. The detection of these drug resistant pathogens is a reminder of the importance of active surveillance for resistant bacteria in order to prevent their spread in hospital settings.

Entities:  

Year:  2017        PMID: 28814955      PMCID: PMC5549501          DOI: 10.1155/2017/8012104

Source DB:  PubMed          Journal:  Int J Microbiol


1. Introduction

Acinetobacter baumannii is a gram-negative, nonfermentative, oxidase-negative coccobacillus. The Centers for Disease Control and Prevention (CDC) recognizes multidrug resistant (MDR) A. baumannii as a source of global outbreaks and epidemics especially due to its effectiveness in colonizing hospital environments and due to its increasing resistance to commercially available antibiotics, including β-lactams, fluoroquinolones, tetracyclines, and aminoglycosides [1-3]. A. baumannii is associated with hospital-acquired infections which include ventilator-associated pneumonia, bloodstream infections, meningitis, and urinary tract infections (UTI's) [3]. Mechanisms of resistance in Acinetobacter strains include efflux pumps, β-lactamases, and modifications in porin proteins. A. baumannii expresses aminoglycoside-modifying enzymes (AMEs) making them resistant to aminoglycoside antibiotics. Moreover, mutations in the gyrA and parC genes make them resistant to quinolones [1]. Worthy of mention are the findings of Fournier et al. (2006) who identified AbaR1 resistance islands (86 kb region) encompassing a cluster of resistance genes, namely, ones coding for tetracycline efflux pumps, several AMEs, AmpC, and OXA-10 β-lactamases. Genetic analysis of this region also indicated the presence of transposons and genes formerly identified in Salmonella spp. and E. coli [4]. Enzymatic degradation by β-lactamases is the most prevalent mechanism of β-lactam resistance in A. baumannii. Serine oxacillinases (Ambler class D OXA-type) and metallo-β-lactamases (MBLs) (Ambler class B) are β-lactamases with carbapenemase activity. OXA-type carbapenemase genes in Acinetobacter can be classified into different phylogenetic subgroups: blaOXA-23, blaOXA-24, blaOXA-51, blaOXA-58, blaOXA-143, and blaOXA-235 [5, 6]. The emergence of carbapenem-resistant strains associated with OXA-type β-lactamases is increasing as well as their contribution to outbreaks and patient mortality [7]. Another group of recently discovered β-lactamases in Acinetobacter is the class B β-lactamase blaNDM and the class A serine carbapenemase blaKPC both have a great opportunity to spread to other bacteria due to their location on mobile genetic elements [8]. In addition, A. baumannii has other virulence factors that aid in its protection and survival. It has the ability to form biofilms, which are essentially aggregates in which the cells adhere to each other and to a surface in a self-produced matrix of extracellular DNA, polysaccharides and proteins [1]. In A. baumannii, outer membrane protein A (ompA) is involved in biofilm formation on abiotic surfaces [9]. Biofilm formation not only helps protect the bacteria against disinfection for instance, but also helps in trading resistance genes between the participating cells. In this study, we performed in-depth characterization of extremely resistant nonduplicated A. baumannii strains isolated from samples of hospitalized patients from all over Palestine except Gaza.

2. Materials and Methods

2.1. Ethical Considerations

This study was approved by the Medical Research Committee at Caritas Baby Hospital (MRC-014) in Bethlehem, Palestine.

2.2. Study Population

Extremely drug resistant A. baumannii isolates, all resistant to carbapenems, were collected from 69 patients from Palestinian hospitals all over Palestine with the exception of the Gaza strip. Isolates were collected from five Palestinian districts as follows: Jerusalem (N = 2), Bethlehem (N = 22), Hebron (N = 34), Nablus (N = 8), and Ramallah (N = 3). The isolates were collected between January 2006 and February 2014 from blood, urine, sputum, and rectal samples.

2.3. A. baumannii Species Identification

In order to identify A. baumannii from the collected Acinetobacter spp. isolates, all isolates were identified biochemically and screened for the naturally occurring carbapenemase gene (blaOXA-51) intrinsic to A. baumannii using polymerase chain reaction (PCR) as previously reported [10, 11].

2.4. Presence of ISAba1 Element and the Expression of blaOXA-51 Gene

The isolates were screened for the presence of the IS element, ISAba1, and analyzed for the potential expression of the blaOXA-51 gene by investigating the presence of the ISAba1 element upstream of the gene [12].

2.5. Antibiotic Susceptibility Testing

Antibiotic susceptibility testing (AST) by disk diffusion test was performed for the following antibiotics (ceftazidime 30 μg, cefotaxime 30 μg, ceftriaxone 30 μg, piperacillin-tazobactam 100/10 μg, cefepime 30 μg, sulfamethoxazole 25 μg, amikacin 30 μg, gentamycin 10 μg, ciprofloxacin 5 μg, meropenem 10 μg, and imipenem 10 μg). In addition, the minimal inhibitory concentration of the two antibiotics meropenem and colistin were determined by Etest (BioMérieux, Marcy-l'Étoile, France). AST was performed and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines [13].

2.6. Detection of Antibiotics Resistant Genes and the Biofilm-Producing ompA Gene

Carbapenem- and aminoglycoside-resistant determinants as well as biofilm-producing virulence factors were screened for using standard PCR assay using a PTC-100 Peltier Thermal Cycler (Bio-Rad, USA). The PCR products were then subjected to gel electrophoresis on 1.5% agarose gel for 45 minutes at 85 V and viewed under UV light using the Transilluminator imaging device (Dinco & Rhenium Industries Ltd., Israel). Target genes and their corresponding primers for PCR amplification are mentioned in Table 1. All PCR reactions were done in singleplex with the exception of the OXA-type class D carbapenemases (blaOXA-23, blaOXA-24, and blaOXA-58) which were done in a multiplex PCR reaction as reported in Mostachio et al. (2009). The assays were held in 25 μl volume reactions containing 2x ReddyMix PCR Master Mix with 1.5 mM MgCl2 (Thermo Fisher Scientific, USA) with a primer concentration of 20 pmol/μl at standard PCR conditions. A PTC-100 Peltier Thermal Cycler (Bio-Rad, USA) was used for the PCR amplification reactions.
Table 1

Summary of the target genes screened for using polymerase chain reaction (PCR).

Target genePrimer nameSequence (5′ to 3′)Annealing temperature (°C)Amplicon size(bp)
Class D carbapenemasesOXA-23F: GATCGGATTGGAGAACCAGA58501
R: ATTTCTGACCGCATTTCCAT
OXA-24F: GGTTAGTTGGCCCCCTTAAA58246
R: AGTTGAGCGAAAAGGGGATT
OXA-58F: AAGTATTGGGGCTTGTGCTG58599
R: CCCCTCTGCGCTCTACATAC
OXA-51F: TAATGCTTTGATCGGCCTTG58353
R: TGGATTGCACTTCATCTTGG
OXA-143F: TGGCACTTTCAGCAGTTCCT58180
R: TAATCTTGAGGGGGCCAACC
OXA-235F: TTGTTGCCTTTACTTAGTTGC58700
R: CAAAATTTTAAGACGGATCG

Class B carbapenemasesNDMF: CCAATATTATGCACCCGGTCG58812
R: ATGCGGGCCGTATGAGTGATTG

Class A carbapenemasesKPCF: ATGTCACTGTATCGCCGTCT58538
R: TTTTCAGAGCCTTACTGCCC

AME'saphA6F: ATGGAATTGCCCAATATTATTC55797
R: TCAATTCAATTCATCAAGTTTTA
aphA1F: CAACGGGAAACGTCTTGCTC58455
R: ATTCGTGATTGCGCCTGAG
aacA4F: ATGACTGAGCATGACCTTGCG65518
R: TTAGGCATCACTGCGTGTTCG
aadBF: ATGGACACAACGCAGGTCGC65524
R: TTAGGCCGCATATCGCGACC
aadA1F: ATGAGGGAAGCGGTGATCG65254
R: TTATTTGCCGACTACCTTGGTG
aacC1F: ATGGGCATCATTCGCACATGTAGG65456
R: TTAGGTGGCGGTACTTGGGTC

Biofilm-producing virulence factorsompAF: CGCTTCTGCTGGTGCTGAAT58531
R: CGTGCAGTAGCGTTAGGGTA
epsAF: AGCAAGTGGTTATCCAATCG58451
R: ACCAGACTCACCCATTACAT

Annealing temperature (°C) used in this study.

2.7. Multilocus Sequence Typing (MLST)

A. baumannii bacterial DNA was extracted from 13 representative A. baumannii isolates using the High Pure Nucleic Acid Extraction Kit (Roche, Basel, Switzerland). The isolates covered the time period of the study (between 2006 and 2014) such that one isolate was from the year 2006, two were from the year 2007, one was from the year 2008, one was from the year 2010, two were from the year 2011, two were from the year 2012, and four isolates were from the year 2013. PCR reactions were performed for the seven housekeeping genes: gltA, gyrB, gdhB, recA, cpn60, gpi, and rpoD as previously reported by Bartual et al. (2005). PCR reactions were performed in 50 μl volume reactions containing 2x ReddyMix PCR Master Mix with 1.5 mM MgCl2 (Thermo Fisher Scientific, USA) with a primer concentration of 20 pmol/μl. The PCR conditions were those described by Bartual et al. with an annealing temperature of 55°C for all genes. A PTC-100 Peltier Thermal Cycler (Bio-Rad, USA) was used for the PCR amplification reactions. PCR products were analyzed on a 1.5% agarose gel and visualized using UV light using the Transilluminator imaging device (Dinco & Rhenium Industries Ltd., Israel). Amplified PCR products with the appropriate size were purified using the High Pure PCR Product Purification Kit (Roche) and sequenced using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Life Technology, Carlsbad, USA). The sequences were analyzed and cleaned using Sequencher® software (Gene Codes, MI, USA) and the PubMLST database. Isolates were assigned sequence types (STs) as per the allelic profiles in the A. baumannii MLST database (https://pubmlst.org/abaumannii/). The eBURST V3 algorithm (http://eburst.mlst.net/) was used to show phylogenetic relationships among related STs.

3. Results

3.1. Acinetobacter Species Identification

bla OXA-51 PCR amplification confirmed that all 69 isolates were A. baumannii.

3.2. Presence of ISAba1 Element and the Expression of blaOXA-51 Gene

Of the 69 isolates, 68 (99%) carried the ISAba1 element. Of these, only 30 (43.5%) had the IS element upstream of the blaOXA-51 gene.

3.3. A. baumannii Susceptibility Testing

All isolates had a multidrug resistant profile, and they were all resistant to all β-lactam antibiotics including the carbapenems (Figure 1). The carbapenem resistance profile of all isolates was confirmed by determining the MIC value of meropenem by Etest method (BioMérieux, Marcy-l'Étoile, France). The only class of antibiotics to which the isolates were susceptible was colistin sulfate (100%) (Figure 1). In addition, the majority of A. baumannii isolates (>90%) were resistant to the aminoglycosides, macrolides, and cotrimoxazole.
Figure 1

Histogram showing the percent resistance of Acinetobacter isolates to each antibiotic tested according to the CLSI guidelines.

3.4. Molecular Characterization

3.4.1. Detection of Carbapenem-Resistant Genes

Of the 69 A. baumannii isolates tested, 57 (82.6%) were positive for blaOXA-23, 10 (14.5%) tested positive for blaOXA-24, and 2 (3%) tested positive for blaOXA-58 (Figure 2). None of the isolates were positive for the class D β-lactamases blaOXA-143 and blaOXA-235. In addition, 3 (5.8%) tested positive for the class B carbapenemase blaNDM. Sequencing analysis of the blaNDM gene revealed that the three isolates carried the blaNDM-1 gene. None were positive for the class A carbapenemase blaKPC. It is worthy to note that one MDR A. baumannii isolate was a combination OXA-23/OXA-24.
Figure 2

Histogram showing the distribution of carbapenemases in the Acinetobacter isolates tested.

3.4.2. Detection of Aminoglycoside-Resistant Genes

Of the 69 isolates, 64 (93%) were positive for the aphA1 gene while none were positive for the aphA6 gene (Figure 3). On the other hand, the isolates were positive for the acetyltransferases aacC1 and aacA4 genes in 15 (22%) and 9 (13%) of the isolates, respectively. None were positive for the nucleotidyltransferases aadB or aadA1 genes (Figure 3).
Figure 3

Histogram showing the distribution of AME's genes in the Acinetobacter isolates tested.

3.4.3. Detection of Biofilm-Producing Virulence Factors

Of the 69 A. baumannii isolates tested, all (100%) tested positive for ompA gene.

3.4.4. Multilocus Sequence Typing (MLST)

Of the 13 A. baumannii strains evaluated by MLST, the following Sequence Types (STs) were obtained: ST208, ST218, ST231, ST348, and two new Sequence Types suggesting that more than one clone is circulating Palestinian hospitals. Two isolates did not have an exact ST match in the database. The nearest ST match yielded three and four possible STs for the A. baumannii isolates CBH|4248|2007 and CBH∖2D2∖2013, respectively. After assigning sequence types for each isolate, phylogenetic relationships among related STs were established using the eBURST V3 algorithm (http://eburst.mlst.net/), and a dendrogram was generated (Figure 4). The central primary founder is ST208 [CBH|152|2012] (bootstrap = 1000). There were 13 linked single locus variants (SLVs) of the founder (ST75, ST544, ST138, ST21, ST3, ST584, ST467, ST218, ST92, ST238, ST69, CBH|2D2|2013, and ST533). Six of the SLVs of the founder (ST533, ST218, ST238, ST584, ST21, and ST3) have diversified to produce double locus variants (DLVs). There were a total of five subgroup founders (ST533, ST1, ST187, ST109, and ST231 [CBH|3750|2007]) that diversified and produced their own SLVs. One of the new STs [CBH|2D2|2013] has only one out of seven of the MLST loci altered when compared to the primary founder genotype, ST208. Its allelic profile has a single locus variant (SLV) from that of the founder's, ST208. On the other hand, the other new ST [CBH|4248|2007] has two out of seven MLST loci altered in comparison to the founder ST208. Hence, its allelic profile has a double locus variant (DLV) from that of the founder's.
Figure 4

Population snapshot of the 13 A. baumannii isolates and existing reference isolates obtained from the PubMLST database, represented by the eBURST algorithm (http://eburst.mlst.net/). CBH|152|2012 (ST208) represents the primary founder with a bootstrap value = 1000, where CBH|2598|2006: ST348, CBH|4248|2007: New proposed ST, CBH|3750|2007: ST231, CBH|2A9|2013: ST218, CBH|152|2012: ST208, CBH|2D2|2013: New proposed ST.

4. Discussion

A. baumannii has acquired a huge genetic repertoire via horizontal gene transfer that makes it virulent and resistant to any environmental pressures [1, 4]. Antibiotic susceptibility testing in this study showed that all A. baumannii isolates were resistant to the commercially available antibiotics with the exception of colistin. All isolates had an extremely drug resistant profile and they were resistant to carbapenems. MDR A. baumannii outbreaks were reported in hospitals worldwide including the Middle East [14, 15] and this is consistent with the increase in the incidence of health care associated A. baumannii infections reported in Palestinian and Israeli hospitals [2, 14, 15]. A. baumannii isolates from other geographical regions had a similar antimicrobial profile [16]. MIC tests also showed a similar result since most isolates were resistant to meropenem and sensitive to colistin. There are, however, A. baumannii isolates that are becoming resistant to colistin [3]. Studying the carbapenem-resistant mechanisms of this pathogen was necessary in order to better control the spread of A. baumannii and devise a better antibiotics treatment plan. Carbapenem resistance was mainly attributed to the presence of blaOXA genes that produce carbapenem-hydrolyzing enzymes [5]. Since the blaOXA-51 gene is an oxacillinase naturally occurring mainly in A. baumannii, it was present in all A. baumannii isolates tested, and the potential expression of this gene in 43.5% of the isolates is facilitated by the ISAba1 element present upstream of the gene. The production of blaOXA-23 by an A. baumannii strain is enough to confer resistance to the carbapenems, and 82.6% of the isolates in this study carried this gene. This gene is plasmid-borne suggesting the mobility of this genetic segment facilitating horizontal gene transfer [5]. blaOXA-23 was also reported in neighboring countries including Iraq, Greece, Italy, and Turkey [16]. Molecular class D β-lactamases confer resistance to the carbapenems and narrow-spectrum cephalosporins. 14.5% of the isolates also carried the blaOXA-24 gene, and 3% of them carried the recently identified blaOXA-58 gene. This is also the case in neighboring countries as those class D β-lactamases have been reported in Iraq, Kuwait, Lebanon, Turkey, Italy, Greece, and the UK [16]. Enzymatic degradation by β-lactamases is the most prevalent mechanism of β-lactam resistance in A. baumannii [7], and this is clearly shown in our sampled A. baumannii isolates in the West Bank. About 6% of our A. baumannii isolates tested positive for the class B carbapenemase blaNDM-1. This is consistent with regional and global results as there are reports in Israel, India, China, United Kingdom, Canada, France, Sweden, Morocco, South Africa, United Arab Emirates, and Iran among many others [8]. The multidrug resistant profile of the isolates was also heightened by the presence of aminoglycoside-resistant determinants, namely, the phosphotransferase aphA1 and the acetyltransferases aacC1 and aacA4. Almost all our isolates carried the aphA1 gene, and 22% and 13% were positive for aacC1 and aacA4 genes, respectively. In comparison to other studies, Aliakbarzade et al. (2014) reported the following aminoglycoside-resistant genes in Iran: aacC1, aadA1, aphA6, and aadB. Only aacC1 was detected in our Palestinian isolates, and none of our isolates carried the phosphotransferase aphA6. The aminoglycoside-resistant gene aphA6 was reported in Egypt [17]. On a more international scale, the following aminoglycoside-resistant genes were reported in Poland in 2013: aphA1, aphA6, and aacC1 [18]. Our isolates are equipped with not only enzymatic resistance mechanisms, but also the ompA biofilm-producing virulence factor. It is unfortunate that our A. baumannii isolates in the West Bank produce biofilms: 100% tested positive for ompA. There is an apparent global outbreak of carbapenem-resistant A. baumannii especially in the last decade. MLST is a discriminative typing method whose data are in concordance with other typing results produced by PFGE and AFLP analysis [5]. We sequence typed 13 isolates that are representative samples from different areas and different time periods throughout the West Bank. Sequence analysis of Palestinian genotypes showed a similarity with the global genotypes. Our MLST results reveal that more than one strain of A. baumannii is circulating in our Palestinian hospitals; the resulting STs were ST208, ST218, ST231, ST348, and two new STs. We correlated the STs with the timeline of their isolation and preliminary results show that there is a successful spread of clone. To illustrate, ST208 is evident throughout the studied time period, starting in 2008 up till 2014, indicating a successful spread of that particular strain. Internationally, ST208 was reported in the US in 2009, then in Egypt the following year, and then in China in 2012 [19]. Interestingly, the seven ST208 isolates came from the same Palestinian geographical district, Hebron. There are reports of ST218 in the PubMLST database in the year 2000. But, locally in Palestine, our MLST results show that the two isolates, isolated in 2013 from urine and sputum samples, were of ST218. ST231 was first reported in Brazil in 2000 and later again in 2007 in the same country [19]. Our results report ST231 that belongs to a 2007 isolate. Internationally, there are reports of ST348 in the US in 2008 according to the PubMLST database. But this particular ST was detected in Palestine earlier in 2006 as per our MLST results. Worthy of mention is the fact that the isolates carrying the blaNDM-1 gene did not belong to the same clone. Moreover, new strains are emerging. According to our MLST results, there is a new strain that emerged in 2007, and another new one in 2013. Over time, the frequent use of antibiotics will result in the emergence of new resistant strains of A. baumannii bacteria. The eBURST V3 algorithm [20] shows the relationship between the closely related isolates in which the founding genotype starts to diversify producing a cluster of closely related genotypes as it increases in frequency in the population. In summary, there is more than one clone of A. baumannii circulating worldwide as shown by the sequence analysis of our Palestinian genotypes and the global genotypes. Resistance to antibiotics, resistance to disinfectants, and resistance to desiccation accompanied by the presence of drug resistant and biofilm-producing genes all contribute to the persistence of A. baumannii as a hospital pathogen. Resistant A. baumannii strains have a selective advantage in environments like the ICU's where antimicrobials and surface disinfectants are extensively used. Selection for resistant forms can take place during antimicrobial treatment or after treatment. There is a sense of altered microbial ecology with regard to resistant and susceptible bacteria as well as the types of microorganisms surviving after treatment. Epidemiologically, A. baumannii is of concern due to its dissemination mostly in a clonal fashion whether it is within health care institutions and cities or globally between countries. Since A. baumannii is easily transmitted and can, therefore, cause outbreaks, certain control measures have to be taken into account. To start with, health care facilities and personnel should follow the CDC's infection control guidelines and protocols, which attempt to control and prevent the transmission of MDR organisms, such as active surveillance, hand hygiene, and contact precautions [19]. Molecular epidemiological studies should be implemented to determine the presence or absence of a clonal outbreak strain such as A. baumannii ST208 which appears to be a very successful clone. Proper environmental cleaning of potential reservoir sources present in hospital environments such as ventilators, catheters, containers, and moist articles is highly recommended to prevent the spread of Acinetobacter. Moreover, antibiotic stewardship programs must be initiated in order to properly manage treatment and spread of this deadly pathogen.
  16 in total

1.  The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii.

Authors:  Jane F Turton; M Elaina Ward; Neil Woodford; Mary E Kaufmann; Rachel Pike; David M Livermore; Tyrone L Pitt
Journal:  FEMS Microbiol Lett       Date:  2006-05       Impact factor: 2.742

2.  Multiplex PCR for rapid detection of genes encoding oxacillinases and metallo-beta-lactamases in carbapenem-resistant Acinetobacter spp.

Authors:  Anna Karina Mostachio; Inneke van der Heidjen; Flavia Rossi; Anna Sara Levin; Silvia F Costa
Journal:  J Med Microbiol       Date:  2009-07-02       Impact factor: 2.472

3.  High prevalence of bla(NDM-1) carbapenemase-encoding gene and 16S rRNA armA methyltransferase gene among Acinetobacter baumannii clinical Isolates in Egypt.

Authors:  Mohamed Abd El-Gawad El-Sayed-Ahmed; Magdy Ali Amin; Wael Mustafa Tawakol; Lotfi Loucif; Sofiane Bakour; Jean-Marc Rolain
Journal:  Antimicrob Agents Chemother       Date:  2015-03-23       Impact factor: 5.191

Review 4.  Colistin resistance of Acinetobacter baumannii: clinical reports, mechanisms and antimicrobial strategies.

Authors:  Yun Cai; Dong Chai; Rui Wang; Beibei Liang; Nan Bai
Journal:  J Antimicrob Chemother       Date:  2012-03-22       Impact factor: 5.790

Review 5.  New Delhi Metallo-beta-lactamase around the world: an eReview using Google Maps.

Authors:  M Berrazeg; Sm Diene; L Medjahed; P Parola; M Drissi; D Raoult; Jm Rolain
Journal:  Euro Surveill       Date:  2014-05-22

Review 6.  OXA (beta)-lactamases in Acinetobacter: the story so far.

Authors:  Susan Brown; Sebastian Amyes
Journal:  J Antimicrob Chemother       Date:  2005-12-06       Impact factor: 5.790

7.  Molecular epidemiology of sequential outbreaks of Acinetobacter baumannii in an intensive care unit shows the emergence of carbapenem resistance.

Authors:  Raffaele Zarrilli; Margherita Crispino; Maria Bagattini; Elena Barretta; Anna Di Popolo; Maria Triassi; Paolo Villari
Journal:  J Clin Microbiol       Date:  2004-03       Impact factor: 5.948

Review 8.  Acinetobacter baumannii: emergence of a successful pathogen.

Authors:  Anton Y Peleg; Harald Seifert; David L Paterson
Journal:  Clin Microbiol Rev       Date:  2008-07       Impact factor: 26.132

9.  Comparative genomics of multidrug resistance in Acinetobacter baumannii.

Authors:  Pierre-Edouard Fournier; David Vallenet; Valérie Barbe; Stéphane Audic; Hiroyuki Ogata; Laurent Poirel; Hervé Richet; Catherine Robert; Sophie Mangenot; Chantal Abergel; Patrice Nordmann; Jean Weissenbach; Didier Raoult; Jean-Michel Claverie
Journal:  PLoS Genet       Date:  2006-01-13       Impact factor: 5.917

10.  Multidrug-resistant Acinetobacter baumannii.

Authors:  Aharon Abbo; Shiri Navon-Venezia; Orly Hammer-Muntz; Tami Krichali; Yardena Siegman-Igra; Yehuda Carmeli
Journal:  Emerg Infect Dis       Date:  2005-01       Impact factor: 6.883

View more
  7 in total

1.  Combating Multidrug-Resistant Pathogens with Host-Directed Nonantibiotic Therapeutics.

Authors:  Jourdan A Andersson; Jian Sha; Michelle L Kirtley; Emily Reyes; Eric C Fitts; Sara M Dann; Ashok K Chopra
Journal:  Antimicrob Agents Chemother       Date:  2017-12-21       Impact factor: 5.191

2.  Detection of Antimicrobial Resistance Genes Associated with Carbapenem Resistance from the Whole-Genome Sequence of Acinetobacter baumannii Isolates from Malaysia.

Authors:  Mohan Rao; Fairuz A Rashid; Surianti Shukor; Rohaidah Hashim; Norazah Ahmad
Journal:  Can J Infect Dis Med Microbiol       Date:  2020-04-02       Impact factor: 2.471

3.  Biofilm formation in Acinetobacter baumannii was inhibited by PAβN while it had no association with antibiotic resistance.

Authors:  Lihua Chen; Haixia Li; Haichu Wen; Binyu Zhao; Yujia Niu; Qianqian Mo; Yong Wu
Journal:  Microbiologyopen       Date:  2020-07-22       Impact factor: 3.139

4.  Seasonal and Technological Shifts of the WHO Priority Multi-Resistant Pathogens in Municipal Wastewater Treatment Plant and Its Receiving Surface Water: A Case Study.

Authors:  Łukasz Jałowiecki; Jakub Hubeny; Monika Harnisz; Grażyna Płaza
Journal:  Int J Environ Res Public Health       Date:  2021-12-29       Impact factor: 3.390

5.  Detection of metallo-beta lactamases and oxacillinase genes in carbapenem-resistant Acinetobacter baumannii strains isolated in Morocco.

Authors:  Abdelhamid Massik; Lahbib Hibaoui; Btissam Arhoune; Ghita Yahyaoui; Bouchra Oumokhtar; Mustapha Mahmoud
Journal:  Pan Afr Med J       Date:  2021-12-07

6.  Molecular Characterization Identifies Upstream Presence of IS Aba1 to OXA Carbapenemase Genes in Carbapenem-Resistant Acinetobacter baumannii.

Authors:  Nageswari Gandham; Neetu Gupta; Chanda Vyawahare; Shahzad Beg Mirza; Rabindra Nath Misra
Journal:  J Lab Physicians       Date:  2021-08-31

7.  Multidrug-resistant Acinetobacter baumannii outbreaks: a global problem in healthcare settings.

Authors:  Mariana Neri Lucas Kurihara; Romário Oliveira de Sales; Késia Esther da Silva; Wirlaine Glauce Maciel; Simone Simionatto
Journal:  Rev Soc Bras Med Trop       Date:  2020-11-06       Impact factor: 1.581

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.