Literature DB >> 28801998

Resistin-Like Molecule Beta (RELM-β) Regulates Proliferation of Human Diabetic Nephropathy Mesangial Cells via Mitogen-Activated Protein Kinases (MAPK) Signaling Pathway.

Yun-Qian Wang1, Cong-Cong Fan2, Bao-Ping Chen1, Jun Shi1.   

Abstract

BACKGROUND Resistin-like molecule beta (RELM-β) has been reported to be associated with diabetic nephropathy (DN). However, the role of RELM-β in DN is poorly understood. This study was conducted to delineate the underlying mechanisms of action and to investigate the role of RELM-β in the primitive development of DN via MAPK signaling pathways. MATERIAL AND METHODS Lentivirus-mediated vectors and RNAi technology were used to establish the model of RELM-β up-regulated and down-regulated expression in human mesangial cells (HMCs). The proliferation of HMCs was detected through CCK-8 method. The cell cycle and cell proliferation of HMCs was detected through flow cytometry. The MAPKs pathway protein activity was detected through Western blotting. RESULTS The HMCs with up-regulated and down-regulated expression of RELM-β increased or decreased significantly at 2-3 days. The HMCs with high glucose intervention reversed the proliferation inhibition. The HMCs with exogenous glucose or RELM-β protein intervention partially reversed the cell cycle inhibition. Among the MAPKs pathway, the phosphorylation activity of p38MAPK and JNK increased or decreased and ERK1/2 did not change in the overexpression or inhibition of RELM-β. The p38 MAPK pathway inhibitor SB202190 significantly inhibited the proliferation of HMCs caused by overexpression of RELM-β. Up-regulated expression of RELM-b induced the phosphorylation of p38 MAPK, JNK in HMCs and promoted HMCs proliferation and participated in early DN through the MAPKs pathway. CONCLUSIONS The results provide evidence that RELM-b is a potential molecular target for the treatment of DN.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28801998      PMCID: PMC5565234          DOI: 10.12659/msm.905381

Source DB:  PubMed          Journal:  Med Sci Monit        ISSN: 1234-1010


Background

Diabetic nephropathy (DN) is a lethal complication of diabetes and is the main cause of end-stage renal disease; the etiology is currently undefined and treatment options are limited [1]. DN is pathologically characterized by glomerular hypertrophy, albuminuria, and progressive accumulation of glomerular matrix, culminating in tubulointerstitial fibrosis, glomerulosclerosis, and progressive loss of renal function [2-4]. Mesangial cell proliferation and accumulation of mesangial extracellular matrix play important roles in DN [5]. Research has shown that several factors contribute to DN, such as reactive oxygen species (ROS), the renin angiotensin aldosterone system (RAAS), mechanical strain, and various growth factors and cytokines [6,7]. Studies in vitro have shown that high glucose is one of the major factors in the development of DN and promotes the proliferation of mesangial cells [8-10]. Signaling pathway mechanisms are critical elements in the pathogenesis and development of DN, such as MAPK, TGF-β, RhoA/ROCK, NF-κB, Wnt, and JAK- STAT [11]. Experiments in vivo showed that the accumulation of glomerular extracellular matrix is enhanced as long as the p38MAPK signaling pathway is activated in the diabetic state. RELM-β is a recently discovered member of the resistin-like molecule family; it was found in the mouse colon-expressed sequence tags EST database, and is also known as “found in inflammatory zone 2” (FIZZ2) with 117 30 Da molecular weight [12]. The 3 proteins homologous to resistin are termed resistin-like molecules alpha, beta, and gamma. Resistin is initially identified as a protein secreted by adipocytes, which inhibits insulin action and adipose differentiation [13]. RELMs is expressed in many tissues, and RELM-β is the most abundantly expressed among those, especially in the colon [14]. Investigators have found that RELM-β participates in intestinal epithelial cell differentiation, proliferation, immune response, and inflammatory reaction process and maintains the barrier function of the gastrointestinal tract. Based on animal studies, RELM-β is induced by high-fat diets, obesity, and certain intestinal microflora. Synthetically, we hypothesize that RELM-β plays an important role in the progression of DN. In the present study, we evaluated whether RELM-β regulates the proliferation of HMCs of DN via MAPK and other signaling pathways.

Material and Methods

HMC cell culture

Normal HMCs (ATCC Cell Bank, USA) were cultured in MEM medium containing 10% FBS, 100 U/ml gentamicin, and 100 μg/ml streptomycin), centrifuged at low speed (1000 rpm) for 5 min, and passage cultured. The cells were washed in PBS solution and 0.25% of trypsin and 0.02% EDTA were added. Then, the cultures were completed by MEM medium. Cells were centrifuged at 1000 rpm for 5 min and maintained at 37°C in 5% CO2 and 95% air.

Fabrication of up-regulated and down-regulated RELM-β expression lentivirus plasmid

RELM-β up-regulated expression lentivirus plasmid: Lentivirus vector was pCDH-CMV-MCS-Efl-copGFP (Sangon, Shanghai, China). The primer sequence of RELM-β was obtained from NCBI, as follows: RELM-β forward: CGGAATTC TCTCCCAGCCCCAGGACACTG; reverse: CGGGATCCCAGCCTCC TCCCTGTCAGGTCA. Forward and reverse primers were added to BamHI and EcoRI restriction sites, respectively. The empty control vector was pCDH-CMV-MCS-Efl-copGFP empty plasmid. The annealing reaction system was forward primer 10 μl 100 nmol/μl, forward primer 10 μl 100 nmol/μl. The reaction condition was 95°C water bath for 2 min, with natural cooling to room temperature and then on ice for 5 min. RNA was extracted from human colorectal cancer cells and fabricated cDNA through reverse transcription. The RELM-β gene (383bp, including CDS RELM-β area 336bp) was made from the above primers through amplification. RELM-β fragments were obtained through gel electrophoresis. BamHI and EcoRI were added to enzyme-digest RELM-β fragments. RELM-β fragments were recycled through gel electrophoresis. The subsequent steps were coupled reaction, conversion, plasmid extraction, and enzyme identification. The stable transfection was screened by drug resistance. RELM-β down-regulated expression lentivirus plasmid: Lentivirus vector was PLKO.1 (Lonetech, America). The RNAi sequence was: RELM-β forward: CCGGTAGACTCCG TTATGGATAAGACTCGAGTCTTATCCATAACGGAGTCTATTTTG; reverse: AATTCAAAAATAGACTCCGTTATGGATAAGACTCGAGTC TTATCCATAACGGAGTCTA. The empty control was scramble sequence. PLKO.1 TRC restriction site was added. Other steps were similar to those in the above experiments. The stable transfection was screened by 2 μg/ml puromycin culture medium.

Transfection of HMC

The target cells were inoculated in 6-cm2 petri dishes when cell confluence was 30% to 45% and we added 3 ml virus supernatant and 2 ml of 10% FBS culture solution. Afterwards, polybrene was joined to concentration of 4.8 ug/ml. Cells were replaced to normal culture medium 24 h later, and 48 h later the cell culture medium was removed and we added the final concentration of 21 ug/ml puromycin medium until all control cells were dead. Then, dishes were changed to normal culture medium.

Western blotting analysis

The glue included 10 ml of 16.5% acrylamide glue and 4 ml of 5% enrichment glue. Then, the glue, PVDF membrane, filter paper, and sponge were put in the buffer. The material was arranged in the order of clamp black surface, 3 levels of filter paper, glue, and PVDF membrane, and 3 levels of filter paper and clamp white surface, and transferred to the electrolytic slot. The slot was buried in ice with a constant current of 280 mA for 1.5 h. The member was drifted with ultra-pure water and rinsed in TPS for 5 min, and fixed in 0.2% glutaraldehyde TBS for 45 min. The PVDF member was incubated in the sealing liquid on horizontal rotators at room temperature for 1 h, and washed 3 times with TBST for 5 min each time. The PVDF member was shaken in the RELM-β antiserum or 13-actin antibody for 2 h, and washed 3 times with TBST for 5 min each time. The PVDF member was fixed in the X-ray film clips and exposed in a dark room with X-ray film.

Real-time quantitative PCR

The concentration of RNA met the requirements when the OD value at 260–280 nm was 1.8–2.0. The extracted RNA from the cells by TRIzol reagent kit (Invitrogen, CA) was treated with DNAse. We used 0.5 μg of treated RNA to synthesize cDNA using the SuperScript First-Stand Synthesis system (Invitrogen, CA). PCR amplification was carried out using an ABI PRISM 7900 thermocycler with SYBR Premix Taq (Applied Biosystems). The primer pairs of PCR amplification were as follows (Invitrogen, CA): RELM-β forward: 5′-CGGAATTCTCTCCCAGCCCCAGGACACTG-3′; reverse: 5′-CGGGATCCCAGCCTCCTCCCTGTCAGGTCA-3′. β-actin forward: 5′-GGGAAATCGTGCGTGACATTAAGG-3′; reverse: 5′-CAGGAAGGAAGGCTGGAAGAGTG-3′. The reaction conditions were as follows: an initial denaturation step at 94°C for 2 min, followed by 40 cycles at 94°C for 30 seconds, 56°C for 30 s, 72°C for 2 min, and a final elongation step at 72°C for 10 min. Relative levels of gene expression was expressed relative to actin and calculated using the 2−ΔΔCt method.

Cell proliferation assay

Cell proliferation was calculated using Cell Counting Kit-8 (CCK-8, Beyotime Biotech, China). Single-cell suspensions were seeded into 96-well plates (1×103 cells/well) and incubated at 37°C and 5% CO2, with 2 mg/ml CCK-8 solution added every 24 h. Finally, DMSO (150 ul/well) was added to every well. The optical density (OD) value of each well was measured at 450 nm.

Flow cytometry

The cells digested with pancreatic enzyme were centrifuged and washed twice with precooled PBS, which were joined with precooled 70% ethanol and fixed overnight at 4°C. In cell staining, the centrifuged cells were washed with 1 ml PBS once and joined with 500 μl PBS (containing 50 μg/ml propidium iodide PI, 100μg/ml RNase A, 0.2% Triton X-100) and incubated overnight at 4°C for 30 min. Flow cytometry analysis was conducted using standard program testing and counted 20 000 to 30 000 cells.

Statistical analysis

Experiments were carried out at least in triplicate and quantitative date are expressed as mean ± standard deviation. The differences were analyzed by the t test. p<0.05 was considered to be statistically significant.

Results

Fabrication of RELM-β stable expression in HMCs

We screened and established RELM-β stable up-regulated and down-regulated expression cell lines through lentivirus. The expression of RELM-β was detected with Western blotting and expression of mRNA was detected with RT-qPCR. Figure 1A shows the mRNA expression in the up-regulated and down-regulated expression groups of HMCs. Figure 1B shows the RELM-β expression in the up-regulated and down-regulated groups. The similar results suggest that the RELM-β up-regulated and down-regulated expression models of HMCs were built successfully.
Figure 1

Lentivirus-mediated RELM-β expression in HMC. (A) The expression of RELM-β mRNA was detected by RT-qPCR. (B) The expression of RELM-β protein was analyzed by Western blotting. Data represent means ±SD of 3 experiments. * P<0.05.

Activity of HMCs induced by RELM-β

The vitality of HMCs was detected by CCK-8 assay. Figure 2A shows that the activity of HMCs mediated with RELM-β up-regulation expression was more active than in the control group at 2–3 days. Figure 2B shows that the activity of HMCs mediated with RELM-β down-regulated expression was less active than in the control group and scrambled group. However, HMCs reversed the proliferation inhibition when high glucose was added.
Figure 2

Activity of HMCs induced by RELM-β. (A) Proliferation of HMCs mediated by up-regulation expression of RELM-β. (B) Proliferation of HMCs mediated by down-regulation expression of RELM-β. Data represent means ± SD of 3 experiments, * P<0.05, ** P<0.01.

Regulation of HMCs cycle by RELM-β

The cell cycle of HMCs was detected by flow cytometry. Figure 3A shows that, in the up-regulated expression of RELM-β group, cell number decreased in G0–G1 phase and increased obviously in S phase compared with the control group. Figure 3B shows that, in the down-regulated expression of RELM-β group, cell number increased at G0–G1 phase and decreased obviously at S phase compared with the control group. Furthermore, the inhibition was reversed as RELM-β and glucose were added. The results indicate that RELM-β protein and high glucose regulate the cell cycle.
Figure 3

The cell cycle of HMCs was detected by flow cytometry. (A) Cell cycle of HMCs mediated by up-regulated expression of RELM-β. (B) Cell cycle of HMCs mediated by down-regulated expression of RELM-β. * P<0.05, ** P<0.01. Data represent means ±SD of 3 experiments.

Expression of RELM-β active the MAPKs pathway

The phosphorylation activities of p38, JNK, and ERK1/2 of MAPKs pathway were detected by Western blotting. In Figure 4, the experimental results of up-regulated expression of RELM-β showed that the phosphorylation activity of p38 and JNK increased obviously and ERK1/2 did not fluctuate. The results of down-regulated expression of RELM-β showed that the phosphorylation activity of p38 and JNK decreased and ERK1/2 did not obviously fluctuate.
Figure 4

Up-regulated and down-regulated expression of RELM-β activated MAPKs pathway, which was detected by Western blotting. (A) The expression of RELM-β protein was analyzed by Western blotting. The phosphorylation was determined using specific antibody. (B) The ratio of p-p38/p38. (C) The ratio of p-ERK/ERK. (D) The ratio of p-JNK/JNK. Data represent means ±SD of 3 experiments. * P<0.05.

The effect of p38 MAPK inhibitor on proliferation of HMCs

The vitality of HMCs was detected by CCK-8 methods. Figure 5 shows that the activity of HMCs proliferation with up-regulated expression of RELM-β was more active than in other groups. The proliferation was inhibited in the group with added p38 MAPK inhibitor (SB 202190).
Figure 5

The influence of p38 MAPK inhibitor on HMCs proliferation. Data represent means ±SD of 3 experiments. * P<0.05.

Discussion

In this research, we developed a novel method to fabricate vector plasmid. Lentivirus-mediated vectors and RNAi technology were used to establish the stable up-regulation and down-regulation expression models of RELM-β in HMCs. We found that up-regulated expression of RELM-β significantly promoted HMCs proliferation and down-regulated expression of RELM-β inhibited the activity. Accumulating evidence suggests that HMCs proliferation, which is a characteristic of mesangial cell activation, occurs in DN [10]. Recent studies have shown that abnormal hypertrophy, proliferation, and apoptosis of nephritic cells have important links with the occurrence and development of DN [15-18]. High-glucose environment and extracellular factors affect nephritic cell cycle and initiate the development of DN. In our study, the proliferation of HMCs was inactive in the down-regulated group. Further experiments verified that the high-glucose state reversed the inhibition of HMCs in the down-regulated + glucose group, which was detected by CCK-8 methods. The up-regulated group demonstrated that the cell number decreased observably at G0–G1 phase and increased observably at S phase, which means the cellular block was reduced and cellular growth increased. Correspondingly, in the down-regulated group, the cell number increased observably in G0–G1 phase and decreased observably in S phase, which means cellular growth was inhibited. Additional glucose and RELM-β protein relieved the inhibitory state of the cell cycle. The above results indicate that glucose and RELM-β protein promote proliferation and hypertrophy by regulating cell cycle progression. MAPK signaling pathways control the expression activity of a broad range of transcription factor genes. Our study showed that the phosphorylation activity of p38 and JNK were obviously increased in up-regulation of RELM-β expression of HMCs. Meanwhile, the phosphorylation activity of p38 and JNK was obviously decreased in the down-regulation group. The results demonstrate that the synthesis of RELM-β involves the p38 and JNK signaling pathways. In the down-regulation group, the inhibition of activity caused by RNAi was improved when RELM-β proteins and high glucose were combined. In the up-regulation RELM-β expression group, the proliferation activity of HMCs was more active than in the control group at 1–2 days. The competitive inhibitors combine the ATP binding sites and enable inhibition. In our research, the proliferation was inhibited as p38MAPK inhibitor (SB 202190) was added. Therefore, the blockade of the MAPK signaling pathway by SB 202190 may be a new approach to prevent the development of diabetic nephropathy [19]. Combined with the cell cycle test of up-regulated and down-regulated RELM-β expression of HMCs, we concluded that RELM-β regulates the HMC cell cycle through changing the activity of the MAPKs pathway [20]. The activation mechanism of the MAPKs family is similar, and is characterized by 3 levels of enzymatic reaction of phosphorylation [21]. The family includes ERK, JNK/SAPK, p38MAPK, and ERK5/BMKI [22-24]. High glucose is the primary etiological factor for DN, which activates the MAPKs pathway through several approaches, such as oxidative stress, polyols release, and accumulation of advanced glycosylation end-products (AGEs) [25]. Advanced AGEs are heterogeneous cross-linked sugar-derived proteins that accumulate in glomerular basement membrane, mesangial cells, endothelial cells, and podocytes [26]. AGEs are thought to be involved in the pathogenesis of diabetic nephropathy via multifactorial mechanisms [27]. The above-mentioned mechanism phosphorylates transcription factors and regulates gene expression. Researchers also reported that the activation of the MAPK signaling pathways influence the production of TGF-β1 and connective tissue growth factor (CTGF) in high-glucose in HMCs [28].

Conclusions

Our experimental results show that RELM-β participates in early DN through the MAPKs pathway. The secretion level of RELM-β affects the proliferation of HMCs and accumulation of extracellular matrix. The results provide evidence that RELM-β might be a potential molecular target for the treatment of DN.
  25 in total

Review 1.  Adipokines as a link between obesity and chronic kidney disease.

Authors:  Jessica F Briffa; Andrew J McAinch; Philip Poronnik; Deanne H Hryciw
Journal:  Am J Physiol Renal Physiol       Date:  2013-10-09

2.  Comparison of B1 and B2 receptor activation on intracellular calcium, cell proliferation, and extracellular collagen secretion in mesangial cells from normal and diabetic rats.

Authors:  J P Girolami; M Ouardani; J L Bascands; C Pécher; G Bompart; J Leung-Tack
Journal:  Can J Physiol Pharmacol       Date:  1995-07       Impact factor: 2.273

Review 3.  ERK5: structure, regulation and function.

Authors:  Gopika N Nithianandarajah-Jones; Bettina Wilm; Christopher E P Goldring; Jürgen Müller; Michael J Cross
Journal:  Cell Signal       Date:  2012-07-16       Impact factor: 4.315

Review 4.  A new classification of Diabetic Nephropathy 2014: a report from Joint Committee on Diabetic Nephropathy.

Authors:  Masakazu Haneda; Kazunori Utsunomiya; Daisuke Koya; Tetsuya Babazono; Tatsumi Moriya; Hirofumi Makino; Kenjiro Kimura; Yoshiki Suzuki; Takashi Wada; Susumu Ogawa; Masaaki Inaba; Yoshihiko Kanno; Takashi Shigematsu; Ikuto Masakane; Ken Tsuchiya; Keiko Honda; Kazuko Ichikawa; Kenichiro Shide
Journal:  Clin Exp Nephrol       Date:  2015-02       Impact factor: 2.801

5.  p38 MAPK/HSP25 signaling mediates cadmium-induced contraction of mesangial cells and renal glomeruli.

Authors:  Sahoko Hirano; Xiankui Sun; Cheryl A DeGuzman; Richard F Ransom; Kenneth R McLeish; William E Smoyer; Eric A Shelden; Michael J Welsh; Rainer Benndorf
Journal:  Am J Physiol Renal Physiol       Date:  2005-02-01

Review 6.  Pathophysiology of obesity-related renal dysfunction contributes to diabetic nephropathy.

Authors:  George Bayliss; Larry A Weinrauch; John A D'Elia
Journal:  Curr Diab Rep       Date:  2012-08       Impact factor: 4.810

Review 7.  Diabetic nephropathy: where hemodynamics meets metabolism.

Authors:  J M Forbes; K Fukami; M E Cooper
Journal:  Exp Clin Endocrinol Diabetes       Date:  2007-02       Impact factor: 2.949

8.  p38/RK is essential for stress-induced nuclear responses: JNK/SAPKs and c-Jun/ATF-2 phosphorylation are insufficient.

Authors:  C A Hazzalin; E Cano; A Cuenda; M J Barratt; P Cohen; L C Mahadevan
Journal:  Curr Biol       Date:  1996-08-01       Impact factor: 10.834

Review 9.  Pathogenesis of the podocytopathy and proteinuria in diabetic glomerulopathy.

Authors:  Fuad N Ziyadeh; Gunter Wolf
Journal:  Curr Diabetes Rev       Date:  2008-02

10.  Gremlin induces cell proliferation and extra cellular matrix accumulation in mouse mesangial cells exposed to high glucose via the ERK1/2 pathway.

Authors:  Haixia Huang; Haiying Huang; Ying Li; Maodong Liu; Yonghong Shi; Yanqing Chi; Tao Zhang
Journal:  BMC Nephrol       Date:  2013-02-11       Impact factor: 2.388

View more
  5 in total

1.  Inhibitor of myogenic differentiation family isoform a, a new positive regulator of fibronectin production by glomerular mesangial cells.

Authors:  Parisa Yazdizadeh Shotorbani; Sarika Chaudhari; Yu Tao; Leonidas Tsiokas; Rong Ma
Journal:  Am J Physiol Renal Physiol       Date:  2020-01-27

2.  Long non-coding RNA Hottip modulates high-glucose-induced inflammation and ECM accumulation through miR-455-3p/WNT2B in mouse mesangial cells.

Authors:  Xiang-Jun Zhu; Zhaung Gong; Shu-Juan Li; Hai-Ping Jia; Da-Lin Li
Journal:  Int J Clin Exp Pathol       Date:  2019-07-01

3.  Retracted Article: Ligustrazine attenuates renal damage by inhibiting endoplasmic reticulum stress in diabetic nephropathy by inactivating MAPK pathways.

Authors:  Hongling Yang; Shukun Wu
Journal:  RSC Adv       Date:  2018-06-13       Impact factor: 4.036

4.  The Inflammatory Response Induced by RELMβ Upregulates IL-8 and IL-1β Expression in Bronchial Epithelial Cells in COPD.

Authors:  Li Che; Chao Yu; Guangshu Chen; Jiaxin Lin; Zhefan Xie; Tingting Xia; Wenzhi Luo; Xingdong Cai; Shengming Liu
Journal:  Int J Chron Obstruct Pulmon Dis       Date:  2021-09-02

5.  Retracted: Resistin-Like Molecule Beta (RELM-β) Regulates Proliferation of Human Diabetic Nephropathy Mesangial Cells via Mitogen-Activated Protein Kinases (MAPK) Signaling Pathway.

Authors:  Yun-Qian Wang; Cong-Cong Fan; Bao-Ping Chen; Jun Shi
Journal:  Med Sci Monit       Date:  2022-03-03
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.