| Literature DB >> 28798736 |
Kathryn L Kay1,2, Frederick Breidt1,2, Pina M Fratamico3, Gian M Baranzoni3, Gwang-Hee Kim3,4, Amy M Grunden1, Deog-Hwan Oh4.
Abstract
Shiga toxin producing Escherichia coli (STEC) strains vary in acid resistance; however, little is known about the underlying mechanisms that result in strain specific differences. Among 25 STEC O157:H7 strains tested, 7 strains flocculated when grown statically for 18 h in minimal salts medium at 37°C, while 18 strains did not. Interestingly, the flocculation phenotype (cells came out of suspension) was found to correlate with degree of acid sensitivity in an assay with 400 mM acetic acid solution at pH 3.3 targeting acidified foods. Strains exhibiting flocculation were more acid sensitive and were designated FAS, for flocculation acid sensitive, while the acid resistant strain designated PAR for planktonic acid resistant. Flocculation was not observed for any strains during growth in complex medium (Luria Bertani broth). STEC strains B201 and B241 were chosen as representative FAS (2.4 log reduction) and PAR (0.15 log reduction) strains, respectively, due to differences in acid resistance and flocculation phenotype. Results from electron microscopy showed evidence of fimbriae production in B201, whereas fimbriae were not observed in B241.Curli fimbriae production was identified through plating on Congo red differential medium, and all FAS strains showed curli fimbriae production. Surprisingly, 5 PAR strains also had evidence of curli production. Transcriptomic and targeted gene expression data for B201 and B241indicated that csg and hde (curli and acid induced chaperone genes, respectively) expression positively correlated with the phenotypic differences observed for these strains. These data suggest that FAS strains grown in minimal medium express curli, resulting in a flocculation phenotype. This may be regulated by GcvB, which positively regulates curli fimbriae production and represses acid chaperone proteins. RpoS and other regulatory mechanisms may impact curli fimbriae production, as well. These findings may help elucidate mechanisms underlying differences among STEC strains in relating acid resistance and biofilm formation.Entities:
Keywords: GcvB; STEC; acid resistance; curli; nutrient limitation
Year: 2017 PMID: 28798736 PMCID: PMC5526969 DOI: 10.3389/fmicb.2017.01404
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Escherichia coli O157:H7 isolates, acid resistance, and designated flocculation and curli phenotypes used in this study.
| B055 | USDA-ARS K-12 | Human isolate | N/A | FAS | − |
| B201 | SRCC 1675 | Apple cider, October 2002 | 2.42 ± 0.05 | FAS | ++ |
| B202 | SRCC 1486 | Salami, October 2002 | 0.29 ± 0.01 | PAR | − |
| B204 | SRCC 1941 | Pork, September 2002 | 0.17 ± 0.01 | PAR | + |
| B241 | 28RCI | Bovine carcass | 0.15 ± 0.02 | PAR | − |
| B244 | 3014-93 | Human outbreak | 0.15 ± 0.01 | PAR | + |
| B245 | 3055-93 | Human outbreak | 0.26 ± 0.08 | PAR | − |
| B246 | 3139-98 | Human outbreak | 1.06 ± 0.18 | FAS | + |
| B247 | 3159-98 | Human outbreak | 0.26 ± 0.08 | PAR | + |
| B249 | 3187-95 | Human outbreak | 0.17 ± 0.03 | PAR | − |
| B250 | 3261-98 | Human outbreak | 0.17 ± 0.03 | FAR | ++ |
| B251 | 3361-91 | Human outbreak | 0.16 ± 0.03 | PAR | − |
| B263 | RM1242 | Human, sporadic, 1997 | 1.04 ± 0.09 | FAS | + |
| B264 | RM1484 | Apple juice, associated with 1996outbreak | 0.21 ± 0.03 | PAR | + |
| B265 | RM1918 | Human, outbreak, 1999, lettuce | 0.27 ± 0.03 | PAR | − |
| B266 | RM2189 | Human, outbreak, 1999, taco meat | 0.16 ± 0.05 | FAR | + |
| B269 | RM4263 | Human, outbreak, 2000, waterborne | 0.09 ± 0.02 | PAR | + |
| B271 | RM4406 | Human, outbreak, 2003, leafy vegetable | 1.00 ± 0.05 | FAS | ++ |
| B273 | RM4688 | Human, outbreak, 2002, leafy vegetable | 0.25 ± 0.01 | PAR | − |
| B296 | RM5279 | Human, outbreak, 2005, leafy vegetable | 0.36 ± 0.12 | PAR | − |
| B301 | RM5630 | Water | 0.11 ± 0.01 | PAR | − |
| B306 | RM5850 | Water | 0.19 ± 0.05 | PAR | − |
| B307 | RM5875 | Water | 1.03 ± 0.11 | FAS | ++ |
| B309 | RM5714 | Water | 0.49 ± 0.07 | PAR | − |
| B311 | RM6011 | Human, outbreak, 2006, leafy vegetable | 0.31 ± 0.03 | PAR | − |
| B349 | NMSLD-1 | Spinach | 0.28 ± 0.06 | PAR | − |
Identification of E. coli O157:H7 isolates;
reference source (Oh et al., 2009);
log reduction with standard error after acid challenge (400 mM acetic acid, pH 3.3, 30°C) after growth in LBG;
acid sensitivity and flocculation phenotypes FAR (flocculating - acid resistant), PAR (planktonic - acid resistant) and FAS (flocculating - acid sensitive);
curli fimbriae production denoted by (−) indicating no curli production, (+) some curli expression, and (++) maximal expression of curli via colorimetric assay.
The primer sequences for RT-qPCR and chloramphenicol linear cassette.
| tus_For1 | 5′-CACAGAACGCGAAGTTA-3′ | 115 | |
| tus_Rev1 | 5′-GCAATCAGTGGTGTAGG-3′ | ||
| csgA_For1 | 5′-GCTGATGCTCGTAACTC-3′ | 152 | |
| csgA_Rev1 | 5′-GAGTCTTTACCGTTCCAC-3′ | ||
| csgB_For1 | 5′-GCCAATGATGCCAGTAT-3′ | 156 | |
| csgB_Rev1 | 5′-TTGTGTCACGCGAATAG-3′ | ||
| csgD_For1 | 5′-AGTAAGGAGGGCTGATT-3′ | 143 | |
| csgD_Rev1 | 5′-CCATGGAGGATCAAGAAC-3′ | ||
| csgDKO_ChlorF50 | 5′-CGAACAGAAATTCTGCCGCCACAATCCAGCGTAAATAACGTTTCATGGCT | 1,111 | |
| csgDKO_ChlorR50 | 5′-TGCTTCTATTTTAGAGGCAGCTGTCAGGTGTGCGATCAATAAAAAAAGCG | ||
| csgDSeq_For1 | 5′-ACTTCTACCTCAACGGCGTG-3′ | 776, 1,136 | |
| csgDSeq_Rev1 | 5′-GCTGTCAGGTGTGCGATCA-3′ | ||
| csrA_For1 | 5′-CAGCCTGGATACGCTGGTAG-3′ | 147 | |
| csrA_Rev1 | 5′-CTCGTCGAGTTGGTGAGACC-3′ | ||
| csrB_For1 | 5′-CAGGATGGAGAATGAGAAC-3′ | 106 | |
| csrB_Rev1 | 5′-CTATTGCTTCCTGCTCAC-3′ | ||
| csrC_For1 | 5′-GCGAAGACAGAGGATTG-3′ | 149 | |
| csrC_Rev1 | 5′-CCTGACTCATAACCCTTAAC-3′ | ||
| csrD_For1 | 5′-CTGGTTCTCCGTTCGCTTCT-3′ | 206 | |
| csrD_Rev1 | 5′-TTGAACTTGCAGAGGCCGAT-3′ | ||
| cycA_For1 | 5′-AACAGCGTCCTCATCTA-3′ | 121 | |
| cycA_Rev1 | 5′-GTGTCATCTTCCAGTGTC-3′ | ||
| flhC_For1 | 5′-GTGCGGTTTGTTGAAAG-3′ | 121 | |
| flhC_Rev1 | 5′-ATGGCGGTTGACATAAG-3′ | ||
| flhD_For1 | 5′-CCGCTATGTTTCGTCTC-3′ | 100 | |
| flhD_Rev1 | 5′-ACCAGCTGATTGGTTTC-3′ | ||
| fliC_ForA | 5′-CGCGGAGTTCACATTTA-3′ | 140 | |
| fliC_RevA | 5′-CTAACGTTGCCGACTATAC-3′ | ||
| gcvA_For1 | 5′-GAACACACCGGCAATAA-3′ | 119 | |
| gcvA_Rev1 | 5′-GATCGTCAGGAAGATAAGC-3′ | ||
| gcvB_For1 | 5′-CCTGAGCCGGAACGAAA-3′ | 106 | |
| gcvB_Rev1 | 5′-GTCTGAATCGCAGACCAA-3′ | ||
| gcvR_For1 | 5′-CCGTCATGTCAGTAGTTG−3′ | 100 | |
| gcvR_Rev1 | 5′-ATTCCATGAACCGGAAAG-3′ | ||
| glyA_For1 | 5′-CCAGGAACAGATGGTTATC-3′ | 136 | |
| glyA_Rev1 | 5′-CTGAAAGAAGCGATGGAG-3′ | ||
| hdeA_For1 | 5′-GTACAAGCCTGAACGATAG-3′ | 154 | |
| hdeA_Rev1 | 5′-GGACCTGTGAAGATTTCC-3′ | ||
| hdeB_For1 | 5′-ATTCCTGGCAGGTCATA-3′ | 117 | |
| hdeB_Rev1 | 5′-TTTCATCTCTCCGTAAAGC-3′ | ||
| hfq_For1 | 5′-GGGCAAATCGAGTCTTT-3′ | 126 | |
| hfq_Rev1 | 5′-GGCGTTGTTACTGTGAT-3′ | ||
| mlrA_For1 | 5′-CGAACGTGGATCAAAGAG-3′ | 162 | |
| mlrA_Rev1 | 5′-CAGACAAATGGCGATGTA-3′ | ||
| pgaA_For2 | 5′-GGTCAGACTGTCGTTTATG-3′ | 100 | |
| pgaA_Rev2 | 5′-AGTACGGTCTGGGTTATC-3′ | ||
| pgaB_For2 | 5′-GTGGATGCCGGTATTAAG-3′ | 113 | |
| pgaB_Rev2 | 5′-GAGAGAGACGGTGATATTG-3′ | ||
| pgaC_For2 | 5′-CGTCTATTTCTGGGTCTATC-3′ | 141 | |
| pgaC_Rev2 | 5′-GCGTGTATGGTTTCCTC-3′ | ||
| pgaD_For2 | 5′-GGGCGCTGTACAATAAG-3′ | 104 | |
| pgaD_Rev2 | 5′-GAGCTCATCAGGTATTGC-3′ | ||
| rpoS_For1 | 5′-CGAATAGTACGGGTTTGG-3′ | 154 | |
| rpoS_Rev1 | 5′-CGTTGCTGGACCTTATC-3′ |
List of primers designed for RT-qPCR and amplification of the chloramphenicol linear cassette, with 50 nt homology up and downstream of target genes as well as defined cat cassette homology (indicated by underlined nts) to T-SACK, needed for gene deletion mutants. Corresponding amplicon length for RT-qPCR targets, linear cassette, and sequencing primers are listed;
where sequencing primers have two amplicon lengths derived from the wild-type and respective gene deletion mutant strains.
Figure 1Growth of E. coli O157:H7 PAR strain B241 (top) and FAS strain B201 (bottom) in (A) LBG, (B) M9GT, and (C) M9GT supplemented with 1% glycine. Representative flocculation phenotype is displayed by FAS strain B201 in M9GT whereas flocculation is repressed with glycine supplementation.
Figure 2Transmission electron microscopy images of PTA stained (A) acid sensitive (B201) grown in M9GT exhibiting curli, (B) acid resistant (B241) grown in M9GT without curli, (C) acid sensitive (B201) grown in LBG exhibiting flagella, and (D) acid resistant (B241) grown in LBG exhibiting flagella.
Transcriptomics data for selected genes from strains B201 and B241.
| 194.02 | 84.02 | 43 | 17.31 | 2.03 | 12 | 11.21 | |||
| 74.56 | 58.06 | 78 | 11.10 | 1.70 | 15 | 6.71 | 0.2102 | 0.184 | |
| 33.91 | 14.95 | 44 | 7.99 | 1.76 | 22 | 4.25 | 0.0822 | ||
| 42.11 | 16.95 | 40 | 228.67 | 79.32 | 35 | −5.43 | |||
| 93,040.36 | 73,676.54 | 79 | 123,916.42 | 93,430.23 | 75 | −1.33 | 0.7058 | 0.735 | |
| 34.94 | 45.76 | 131 | 49.36 | 74.84 | 152 | −1.41 | 0.7893 | 0.961 | |
| 19.20 | 3.80 | 20 | 14.96 | 2.53 | 17 | 1.28 | 0.2449 | 0.241 | |
| 25.32 | 19.33 | 76 | 41.45 | 22.31 | 54 | −1.64 | 0.5049 | 0.438 | |
| 13.24 | 0.90 | 7 | 8.48 | 0.59 | 7 | 1.56 | |||
| 16.06 | 1.95 | 12 | 9.12 | 0.54 | 6 | 1.76 | |||
| 18.82 | 1.77 | 9 | 14.88 | 3.68 | 25 | 1.26 | 0.2449 | 0.241 | |
| 13.20 | 6.55 | 50 | 17.74 | 8.46 | 48 | −1.34 | 0.5929 | 0.642 | |
| 3.33 | 1.34 | 40 | 8.19 | 3.95 | 48 | −2.46 | 0.1955 | 0.115 | |
| 53.51 | 40.37 | 75 | 37.90 | 5.91 | 16 | 1.41 | 0.5929 | 0.735 | |
| 12.67 | 9.91 | 78 | 76.65 | 13.48 | 18 | −6.05 | |||
| 17.50 | 10.54 | 59 | 979.68 | 209.54 | 21 | −55.02 | |||
| 13.15 | 8.84 | 67 | 52.00 | 12.80 | 25 | −3.95 | |||
| 72.72 | 37.24 | 51 | 317.29 | 256.31 | 81 | −4.36 | 0.2449 | 0.105 | |
| 13.56 | 0.68 | 5 | 10.70 | 0.74 | 7 | 1.27 | |||
| 26.03 | 6.09 | 23 | 10.27 | 0.18 | 2 | 2.53 | |||
| 14.61 | 2.45 | 17 | 8.74 | 0.83 | 9 | 1.67 | |||
| 47.74 | 51.68 | 108 | 25.85 | 22.18 | 86 | 1.85 | 0.5929 | 0.642 | |
| 16.41 | 4.55 | 28 | 9.30 | 2.38 | 26 | 1.76 | 0.1369 | 0.098 | |
| 54.68 | 25.33 | 46 | 162.95 | 30.76 | 19 | −2.98 | |||
Data include: mean .
Transcriptomics data for selected genes from strain B201 grown in M9GT and M9GT + glycine.
| 217.77 | 28.53 | 13 | 204.24 | 256.18 | 125 | 1.07 | 0.932 | 0.640 | |
| 74.26 | 51.13 | 69 | 103.17 | 135.82 | 132 | −1.39 | 0.892 | 0.983 | |
| 37.82 | 4.19 | 11 | 26.91 | 15.03 | 56 | 1.41 | 0.578 | 0.615 | |
| 26.45 | 11.30 | 43 | 34.79 | 13.07 | 38 | −1.32 | 0.651 | 0.640 | |
| 14.60 | 5.43 | 37 | 8.81 | 4.69 | 53 | 1.66 | 0.578 | 0.614 | |
| 3.78 | 1.03 | 27 | 36.48 | 22.28 | 61 | −9.66 | 0.416 | 0.117 | |
| 54.45 | 13.66 | 25 | 60.22 | 30.35 | 50 | −1.11 | 0.892 | 0.983 | |
| 12.45 | 3.26 | 26 | 17.05 | 6.12 | 36 | −1.37 | 0.578 | 0.640 | |
| 19.18 | 3.65 | 19 | 242.60 | 371.09 | 153 | −12.65 | 0.578 | 0.615 | |
| 11.27 | 4.25 | 38 | 12.44 | 7.34 | 59 | −1.10 | 0.892 | 0.983 | |
| 78.93 | 11.17 | 14 | 163.23 | 121.93 | 75 | −2.07 | 0.578 | 0.640 | |
| 17.22 | 7.35 | 43 | 8.12 | 1.91 | 24 | 2.12 | 0.464 | 0.374 | |
| 62.93 | 23.74 | 38 | 19.11 | 8.62 | 45 | 3.29 | 0.416 | 0.129 | |
Data include mean .
Transcriptomics data for selected genes from strains B241 and B250.
| 53.49 | 23.93 | 45 | 14.48 | 0.78 | 5 | 3.69 | 0.104 | ||
| 85.93 | 108.23 | 126 | 9.39 | 1.90 | 20 | 9.15 | 0.340 | 0.120 | |
| 6.32 | 0.86 | 14 | 6.79 | 1.91 | 28 | −1.07 | 0.780 | 0.874 | |
| 9.94 | 2.51 | 25 | 34.79 | 19.43 | 56 | −3.50 | 0.173 | ||
| 7.19 | 0.55 | 8 | 15.16 | 7.67 | 51 | −2.11 | 0.190 | 0.161 | |
| 2.87 | 0.38 | 13 | 7.00 | 3.77 | 54 | −2.44 | 0.190 | 0.079 | |
| 17.04 | 3.21 | 19 | 31.77 | 4.55 | 14 | −1.86 | |||
| 9.50 | 2.16 | 23 | 64.15 | 8.95 | 14 | −6.75 | |||
| 9.31 | 1.93 | 21 | 817.16 | 123.86 | 15 | −87.80 | |||
| 8.55 | 2.21 | 26 | 43.69 | 11.16 | 26 | −5.11 | |||
| 18.26 | 4.91 | 27 | 269.78 | 222.82 | 83 | −14.77 | 0.190 | ||
| 8.97 | 1.55 | 17 | 9.02 | 1.03 | 11 | −1.01 | 0.977 | 0.933 | |
| 11.01 | 3.10 | 28 | 138.10 | 33.29 | 24 | −12.55 | |||
Data include mean .
Figure 3Regulatory model for curli expression and acid resistance phenotype of STEC strains B201 and B241. Proposed gene regulation of FAS (black) and PAR (red) STEC strains. The thickness of the arrows represents the amount of transcription, where thinner arrows indicate less transcription than thicker arrows. Barred lines represent transcription repression, the arrows increased transcription. The dashed line represents a proposed glycine feedback loop. Gene target categories are grouped by shape; regulatory genes (boxes), glycine cleavage system and RpoS (circles), sRNA (curved line), environmental conditions (oval), and glycine (triangle). The question mark indicates unknown effectors.