Literature DB >> 28797330

Evolving beta-lactamase epidemiology in Enterobacteriaceae from Italian nationwide surveillance, October 2013: KPC-carbapenemase spreading among outpatients.

Tommaso Giani1,2, Alberto Antonelli2,3, Mariasofia Caltagirone4, Carola Mauri5, Jessica Nicchi3, Fabio Arena1, Elisabetta Nucleo4, Silvia Bracco5, Annalisa Pantosti6, Francesco Luzzaro5, Laura Pagani4, Gian Maria Rossolini1,3,7.   

Abstract

Extended-spectrum beta-lactamases (ESBLs), AmpC-type beta-lactamases (ACBLs) and carbapenemases are among the most important resistance mechanisms in Enterobacteriaceae. This study investigated the presence of these resistance mechanisms in consecutive non-replicate isolates of Escherichia coli (n = 2,352), Klebsiella pneumoniae (n = 697), and Proteus mirabilis (n = 275) from an Italian nationwide cross-sectional survey carried out in October 2013. Overall, 15.3% of isolates were non-susceptible to extended-spectrum cephalosporins but susceptible to carbapenems (ESCR-carbaS), while 4.3% were also non-susceptible to carbapenems (ESCR-carbaR). ESCR-carbaS isolates were contributed by all three species, with higher proportions among isolates from inpatients (20.3%) but remarkable proportions also among those from outpatients (11.1%). Most ESCR-carbaS isolates were ESBL-positive (90.5%), and most of them were contributed by E. coli carrying blaCTX-M group 1 genes. Acquired ACBLs were less common and mostly detected in P. mirabilis. ESCR-carbaR isolates were mostly contributed by K. pneumoniae (25.1% and 7.7% among K. pneumoniae isolates from inpatients and outpatients, respectively), with blaKPC as the most common carbapenemase gene. Results showed an increasing trend for both ESBL and carbapenemase producers in comparison with previous Italian surveys, also among outpatients. This article is copyright of The Authors, 2017.

Entities:  

Keywords:  Class C beta-lactamases; ESBL; Enterobacteriaceae; carbapenemase; epidemiology; outpatients

Mesh:

Substances:

Year:  2017        PMID: 28797330      PMCID: PMC5553057          DOI: 10.2807/1560-7917.ES.2017.22.31.30583

Source DB:  PubMed          Journal:  Euro Surveill        ISSN: 1025-496X


Introduction

Enterobacteriaceae are the most common cause of healthcare associated infections, and beta-lactams are among the most used antibiotics in clinical practice for treatment of these infections [1,2]. During the last decades, Enterobacteriaceae with decreased susceptibility to beta-lactams have been increasingly reported worldwide, causing major problems [3-8]. The most important resistance mechanism to beta-lactams in Enterobacteriaceae is the production of beta-lactamases, and the most challenging enzymes of this family are the extended-spectrum beta-lactamases (ESBLs), the AmpC-type beta-lactamases (ACBLs), and the carbapenemases [9-12]. ESBLs are able to hydrolyse a wide range of beta-lactams, including penicillins, narrow- and extended-spectrum cephalosporins and monobactams, but not cephamycins and carbapenems. ESBLs are usually inhibited by conventional beta-lactamase inhibitors. CTX-M-type ESBLs, which emerged in the late 1980s, and demonstrated a high ability to disseminate in clinical settings, rapidly reaching a pandemic diffusion. Nowadays they are the most prevalent plasmid-encoded ESBLs overall [13,14]. Acquired ACBLs can confer resistance to penicillins and to most cephalosporins (including cephamycins) but are poorly or not active against monobactams and the zwitterionic oxyimino-cephalosporins, such as cefepime and cefpirome, and the carbapenems. ACBLs are generally less prevalent than ESBLs in Enterobacteriaceae but are nonetheless important for their contribution to beta-lactam resistance, which can be extended also to carbapenems when ACBLs are overproduced in combination with an impermeability defect [10,15,16]. Carbapenemase production is the leading resistance mechanism to carbapenems in Enterobacteriaceae. Acquired carbapenemases of the KPC-, VIM-, NDM- and OXA-48-types are the most prevalent, although with a notable geographical variability [6,17-20]. In Italy, the most recent data from the European Antimicrobial Resistance Surveillance Network (EARS-Net) reported very high proportions of resistance to extended-spectrum cephalosporins among Escherichia coli (30.1%) and Klebsiella pneumoniae (55.9%), and of resistance to carbapenems among K. pneumoniae (33.5%) [21]. However, the EARS-NET data neither cover other enterobacterial species nor describe the resistance mechanisms. This survey, promoted by the Committee for Study of Antibiotics (CoSA) of the Italian Society of Clinical Microbiologists (AMCLI), was carried out to provide an updated picture of the molecular epidemiology of ESBL- and carbapenemase-producing Enterobacteriaceae circulating in Italy and to investigate, for the first time, the presence of ACBL producers on a nationwide scale.

Methods

Study design

Fourteen clinical microbiology laboratories from 13 Italian cities participated in the study (Figure 1).
Figure 1

Distribution of the centers participating in the survey, Italy, October 2013 (n=14)

Distribution of the centers participating in the survey, Italy, October 2013 (n=14) For each centre the presence of CTX-M extended-spectrum beta-lactamase and carbapenemase genes is also indicated. Centers listed as follows: 1-Milano; 2-Lecco; 3-Novara; 4-San Remo; 5-Bolzano; 6-Udine; 7-Modena Bg; 8-Modena Pc; 9-Firenze; 10-Ancona; 11-Roma; 12-San Giovanni Rotondo; 13-Avellino; 14-Cosenza. The laboratories were selected so as to provide a countrywide coverage by large laboratories associated with hospitals, representative of most Italian Regions. Twelve of the 14 laboratories had also been involved in the first Italian survey on carbapenemase-producing Enterobacteriaceae, carried out in 2011 [22]. The survey period was from 1 to 15 October 2013. The laboratories consecutively collected all non-replicate (only first isolate from a patient included) clinical isolates of E. coli, K. pneumoniae and Proteus mirabilis, from any site of infection, showing a minimum inhibitory concentration (MIC) > 1 mg/L for extended-spectrum cephalosporins (ESC) (cefotaxime and/or ceftriaxone and/or ceftazidime and/or cefepime), and/or for ertapenem. Participating laboratories determined MICs of ESC and ertapenem by the automated systems routinely used in the respective laboratory: either Vitek 2 (bioMérieux, Marcy l’Etoile, France) or BD Phoenix (Becton, Dickinson and Co., New Jersey, United States (US)). The collected isolates were sent to reference laboratories for confirmation of species identification and characterisation of the resistance mechanisms. For each isolate, information on the type of clinical specimen and of patient (inpatient or outpatient) were provided. Isolates from patients from nursing homes or other long-term care facilities, and isolates from surveillance specimens, were excluded. Each laboratory also provided information on the total number of non-replicate clinical isolates of Enterobacteriaceae of the same species observed during the collection period from inpatients and outpatients.

Bacterial identification, antimicrobial susceptibility testing and phenotypic characterisation of resistance mechanisms

At the reference laboratories, identification of collected isolates was confirmed by MALDI-TOF mass spectrometry (Vitek MS, bioMérieux), and susceptibility to ESC (cefotaxime, ceftazidime, cefepime), carbapenems (ertapenem, imipenem, and meropenem), aztreonam, aminoglycosides (amikacin and gentamicin), ciprofloxacin, trimethoprim/sulfamethoxazole was determined by disc diffusion on Mueller-Hinton agar (for P. mirabilis imipenem was not tested) according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) methodology [23]. MICs of tigecycline and colistin for carbapenemase producers were determined using reference broth microdilution [24] with custom lyophilised plates (TREK Diagnostic Systems, Cleveland, Ohio, US). All results were interpreted according to the EUCAST breakpoints [25]. ESBL production was investigated using the double disk method testing the synergistic activity between amoxicillin-clavulanate and cefotaxime, ceftazidime, cefepime, and aztreonam [26].

Molecular characterisation of resistance genes

The presence of carbapenemase genes was investigated by multiplex real time-PCR (mRT-PCR) targeting blaKPC-type,blaVIM-type, blaOXA-48-type and blaNDM-type genes, using primers and conditions reported in Table 1. The presence of blaCTX-M ESBL genes was investigated by a mRT-PCR, able to distinguish among different blaCTX-M-type variants of groups 1, 2, 8/25 and 9, using primers and conditions reported in Table 1. The presence of ACBL genes was investigated by a multiplex PCR targeting genes encoding ACBLs, as described previously [27]. For E. coli, specific primers designed to distinguish between acquired and chromosomal ACBL genes were used [27]. The presence of mcr-1-like genes was investigated by a novel real time-PCR (Table 1).
Table 1

Sequence of primers and probes used in nationwide surveillance survey of the molecular epidemiology of ESBL- and carbapenemase-producing Enterobacteriaceae, Italy, October 2013

TargetPrimer nameSequence (5’-3’)aReferencePositive control
OXA-48-like-rt-FGTAGCAAAGGAATGGCAAGAAA [44] Escherichia coli ECBZ-1 (blaOXA-48) [45]
bla OXA-48-like genesOXA-48-like-rt-RGATGCGGGTAAAAATGCTTG
OXA-48-like-rt-PHEX-CTCTGGAATGAGAATAAGCAGCAAGG-BHQ-1
bla KPC genesKPC-rt-FGATACCACGTTCCGTCTGG [46] Klebsiella pneumoniae FIPP-1 (blaKPC-3) [47]
KPC-rt-RGCAGGTTCCGGTTTTGTCTC
KPC-rt-PFAM-AGCGGCAGCAGTTTGTTGATTG-BHQ-1
bla VIM genesVIM-rt-FTGGTCTCATTGTCCGTGATG [48] K. pneumoniae VA-416/02 (blaVIM-4) [49]
VIM-rt-RCATGAAAGTGCGTGGAGA
VIM-rt-PROX-AAGCAAATTGGACTTCCCGTAACGC-BHQ-2
bla NDM genesblaNDM1_FCGCAACACAGCCTGACTTT [50] E. coli CVB-1 (blaNDM-1) [51]
blaNDM1_RTCGATCCCAACGGTGATATT
blaNDM1_PCY5-CAACTTTGGCCCGCTCAAGGTATTT-BHQ-3
bla CTX-M group 1 genesCTX-M-group-1_FWAAAAATCACTGCGCCAGTTC [52] E. coli V460a (blaCTX-M-15), in-house control
CTX-M-group-1_REVAGCTTATTCATCGCCACGTT
CTX-M-group1-PHEX-TGGCGACGGCAACCGTCACGCTGTT-BHQ-1This study
bla CTX-M group 2 genesCTX-M-group-2_FWCGACGCTACCCCTGCTATT [52] E. coli C277a (blaCTX-M-2), in-house control
CTX-M-group-2_REVCCAGCGTCAGATTTTTCAGG
CTX-M-group2-PFAM-TATTGAGCGTGGGCTCGGTTCTGTCCAG-BHQ-1This study
bla CTX-M group 8/25 genesCTX-M-group-8/25_ FWCGATACCACCACGCCATTAGThis study E. coli M26a (blaCTX-M-8), in-house control
CTX-M-group-8/25_REVAACCCACGATGTGGGTAGC [52]
CTX-M-group8/25-PCY5-CCTGAATGCTGGCAGCGCCGGTG-BHQ-3This study
bla CTX - M group 9 genesCTX-M-group-9_FWCAAAGAGAGTGCAACGGATG [52] E. coli V404a (blaCTX-M-14) [53]
CTX-M-group-9_REVATTGGAAAGCGTTCATCACC
CTX-M-group9-PROX-CGTGCATTCCGCTGCTGCTGGGCA-BHQ-2This study
All blaCTX-M genesU-CTX-M- FWATYRAYACMGCVGATAAYWCGCAThis study E. coli V460a (blaCTX-M-15), E. coli C277a (blaCTX-M-2), E. coli M26a (blaCTX-M-8), E. coli V404a (blaCTX-M-14)
U-CTX-M- REVCSGCAATSGGRTTRTAGTTAACThis study
U-CTX-M-PCY5.5-ATGTGCAGYACCAGTAARGTKATGGC-BHQ-3This study
PhHV (internal control)PhHV-267sGGGCGAATCACAGATTGAATC [54]PhHV DNA cloned in pGEM-T-easy E. coli DH5α
PhHV-337asGCGGTTCCAAACGTACCAA
PhHV-305tqCy5.5 -TTTTATGTGTCCGCCACCATCTGGATC-BHQ-3
mcr-1-like genesMcr-1-rt-fwdATCAGCCAAACCTATCCCATCThis study E. coli FI-4531 (mcr-1) [55], K. pneumoniae KP-6884 (mcr-1.2) [33]
Mcr-1-rt-revACACAGGCTTTAGCACATAGC
Mcr-1-rt-pCy5-GACAATCTCGGCTTTGTGCTGACGATC-BHQ-3

ESBL: extended-spectrum beta-lactamases.

a The amplification programme consisted of 35 two-step cycles of 15s at 95 °C and 60s at 60 °C.

ESBL: extended-spectrum beta-lactamases. a The amplification programme consisted of 35 two-step cycles of 15s at 95 °C and 60s at 60 °C.

Spectrophotometric assay for carbapenemase activity

In carbapenem non-susceptible isolates that tested negative for known carbapenemase genes, carbapenemase production was further investigated by measuring the imipenem-hydrolysing specific activity in bacterial crude extracts as described previously [28], using a Cary 100 UV-Vis spectrophotometer (Varian, Walnut Creek, California, US).

Statistical analysis

Statistical evaluation of differences between resistance rates observed in this study and previous surveillance studies was carried out with the chi-squared test with Yates correction, using the Stata Statistical Software (release 13, College Station, Texas, US). Since the surveillance studies were overall similar by design but there were a few sampling differences, which could act as confounding factors, the tests were treated rather as exploratory analyses, which may indicate trends.

Results

Prevalence of Enterobacteriaceae with resistance mechanisms to extended-spectrum cephalosporins and/or carbapenems

During the study period, a total of 3,324 consecutive non-replicate clinical isolates of Enterobacteriaceae of the target species were isolated in the 14 laboratories participating in the survey, including 2,352 (70.7%) E. coli, 697 (21.0%) K. pneumoniae, and 275 (8.3%) P. mirabilis. Of these, 1,509 isolates (45.4%) were from inpatients and 1,815 (54.6%) from outpatients (Table 2).
Table 2

Proportions of ESCR-carbaS and ESCR-carbaR of Enterobacteriaceae by species included and origin of isolate, nationwide surveillance survey, Italy, October 2013 (n=3,324 isolates)

SpeciesIsolates from inpatientsIsolates from outpatientsAll isolates
Total ESCR % ESCR‑carbaS % ESCR‑carbaR % Total ESCR % ESCR‑carbaS % ESCR‑carbaR % Total ESCR % ESCR‑carbaS % ESCR‑carbaR %
Escherichia coli 92023025.021923.8111.21,43216211.315911.130.22,35239216.737816.1140.6
Klebsiella pneumoniae 43715936.44911.211025.12603613.8166.2207.769719528.0659.313018.7
Proteus mirabilis 1523925.73925.70NA1232621.12621.10NA2756523.66523.60NA
Total target species1,50942828.430920.31218.01,81522412.320111.1231.33,32465219.650815.31444.3

ESCR: non-susceptible to extended-spectrum cephalosporins; ESCR-carbaS: non-susceptible to extended-spectrum cephalosporins but susceptible to carbapenems; ESCR-carbaR: isolates non-susceptible to extended-spectrum cephalosporins and non-susceptible to carbapenems; NA: not applicable.

ESCR: non-susceptible to extended-spectrum cephalosporins; ESCR-carbaS: non-susceptible to extended-spectrum cephalosporins but susceptible to carbapenems; ESCR-carbaR: isolates non-susceptible to extended-spectrum cephalosporins and non-susceptible to carbapenems; NA: not applicable. Overall, 508 isolates were confirmed to be non-susceptible to ESC but susceptible to carbapenems (ESCR-carbaS phenotype), and 144 isolates to be non-susceptible to both ESC and carbapenems (ESCR-carbaR). Isolates susceptible to ESC and non-susceptible to carbapenems were not detected. The ESCR-carbaS phenotypes were contributed by all three species, with higher proportions among P. mirabilis (23.6%) and E. coli (16.1%) than among K. pneumoniae (9.3%), and with a higher proportion among isolates from inpatients (20.3%) but a remarkable proportion (11.1%) also among those from outpatients (Table 2). The ESCR-carbaR phenotypes were mostly contributed by K. pneumoniae, with higher proportion among isolates from inpatients (25.1% of K. pneumoniae) but also a notable proportion among those from outpatients (7.7% of K. pneumoniae) (Table 2). Considering the nature of resistant isolates, the majority of those from outpatients (n=224) were from urine (206/224, 91.9%), while those from inpatients (n=428) were from different specimens (urine: 239/428, 55.8%; blood: 55/428, 12.8%; respiratory tract samples: 54/428, 12.6%).

Beta-lactamase phenotypes and genotypes of the ESCR and carbapenem-resistant isolates

Of the ESCR-carbaS isolates, 460 (90.5%) were ESBL-positive and 384 of them (83.4%) carried a blaCTX-M ESBL gene (Figure 2 and Table 3).
Figure 2

Distribution of Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis isolates according to resistance phenotypes and genotypes, nationwide surveillance survey, Italy, October 2013 (n=652 isolates)

Table 3

Resistance mechanisms detected in the investigated phenotypic resistant isolates by species included, nationwide surveillance survey, Italy, October 2013 (n=652 isolates)

Phenotypic resistanceResistance mechanism Escherichia coli Klebsiella pneumoniae Proteus mirabilis Total
N % n % n % n %
Total 2,352 100 697 100 275 100 3,324 100
Resistant39216.719528.06523.665219.6
ESCR-carbaS Total 378 96.4 65 33.3 65 100.0 508 77.9
ESBLCTX-M-126469.85076.90NA31461.8
CTX-M-96116.10NA0NA6112.0
CTX-M-1 + 982.111.50NA91.8
Other ESBL287.4913.83960.07615.0
ACBLCMY/LAT/ACT/MIR123.20NA2436.9367.1
DHA0NA0NA11.510.2
OtherOther resistance mechanism51.357.711.5112.1
ESCR-carbaR Total 14 3.6 130 66.7 0 0.0 144 22.1
CARBAKPC214.310883.20NA11076.4
VIM17.121.50NA32.1
OXA-48214.332.30NA53.5
ESBLCTX-M-1428.696.90NA139.0
CTX-M-9321.40NA0NA32.1
CTX-M-1 + 90NA10.80NA10.7
ACBLCMY/LAT/ACT/MIR214.30NA0NA21.4
DHA0NA21.50NA21.4
OtherOther resistance mechanism0NA53.80NA53.5
Total Total 392 100 195 100 65 100 652 100
CARBAKPC20.510855.40NA11016.9
VIM10.321.00NA30.5
OXA-4820.531.50NA50.8
ESBLCTX-M-126868.45930.30NA32750.2
CTX-M-96416.30NA0NA649.8
CTX-M-1 + 982.021.00NA101.5
ACBLCMY/LAT/ACT/MIR143.60 NA2436.9385.8
DHA0NA21.011.530.5
OtherOther resistance mechanism338.4199.74061.59214.1

ACBL: acquired class C beta-lactamase-producing; CARBA: carbapenemase-producing; CTX-M-1: CTX-M group 1 producers; CTX-M-9: CTX-M group 9 producers; CTX-M-1+9: CTX-M group 1 and group 9 producers; ESBL: extended-spectrum beta-lactamase-producing; ESCR-carbaR: non-susceptible to extended-spectrum cephalosporins and non-susceptible to carbapenems; ESCR-carbaS: non-susceptible to extended-spectrum cephalosporins but susceptible to carbapenems; NA: not applicable.

Distribution of Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis isolates according to resistance phenotypes and genotypes, nationwide surveillance survey, Italy, October 2013 (n=652 isolates) ACBL: isolates producing acquired class C beta-lactamase; CARBA: carbapenemase producing isolates; E. coli: Escherichia coli; ESBL: isolates producing extended spectrum beta-lactamase; ESCR-carbaS: isolates non-susceptible to extended-spectrum cephalosporins but susceptible to carbapenems; ESCR-carbaR: isolates non-susceptible to extended-spectrum cephalosporins and non-susceptible to carbapenems; K. pneumoniae: Klebsiella pneumoniae; P. mirabilis: Proteus mirabilis. ACBL: acquired class C beta-lactamase-producing; CARBA: carbapenemase-producing; CTX-M-1: CTX-M group 1 producers; CTX-M-9: CTX-M group 9 producers; CTX-M-1+9: CTX-M group 1 and group 9 producers; ESBL: extended-spectrum beta-lactamase-producing; ESCR-carbaR: non-susceptible to extended-spectrum cephalosporins and non-susceptible to carbapenems; ESCR-carbaS: non-susceptible to extended-spectrum cephalosporins but susceptible to carbapenems; NA: not applicable. The proportion of blaCTX-M genes was 92.2% among ESBL-positive E. coli and 84.7% among ESBL-positive K. pneumoniae, while such genes were never detected among ESBL-positive isolates of P. mirabilis (Figure 2). Among CTX-M-positive isolates, most carried blaCTX-M genes of group 1 (81.5%), while a minority carried blaCTX-M genes of group 9 (16,0%) and a small proportion carried blaCTX-M genes of both CTX-M groups (2.5%) (Table 3). CTX-M-positive isolates were detected from all centers (Figure 1). Comparison of these data with results from the earlier Italian nationwide survey on producing ESBL-producing Enterobacteriaceae, carried out in 2003 [29], revealed a notable increase in the proportion of ESBL-producing isolates (from 6.4% to 14.4%; p < 0.001, considering the three target species). Among outpatients, the proportion of ESBL producers increased from 3.4% to 11.0% (p < 0.001), and the increase was especially large among E. coli (from 1.9% to 10.9%; p < 0.001). The majority of the ESCR-carbaS isolates that were ESBL-negative were positive for an acquired ACBL gene (n = 37, 79%) which, in most cases, belonged to the CMY/LAT/ACT/MIR lineage. Most of the ACBL-positive isolates were P. mirabilis (Figure 2, Table 3). Concerning the ESCR-carbaR isolates, most (81.9%) were positive for carbapenemase genes, including blaKPC- (93.2%), blaOXA-48- (4.2%), and blaVIM-type (2.6%) carbapenemase genes. The majority of carbapenemase-producers were K. pneumoniae, while only five E. coli produced a carbapenemase (Figure 2). Interestingly, some KPC-positive K. pneumoniae (KPC-KP) (6.5%) and most OXA-48-positive isolates also harbored a blaCTX-M gene (Table 3). The 26 ESCR-carbaR isolates that tested negative for carbapenemase genes were confirmed to be carbapenemase non-producers by spectrophotometric assay. Most of these isolates carried blaCTX-M genes (65.3%) while a minority was positive for an ACBL gene (blaDHA or blaCMY/LAT/ACT/MIR), suggesting that in these cases the carbapenem resistance mechanism was related with production of an ESBL or ACBL in combination with reduced permeability [30]. Comparison of these data with results from the first Italian nationwide survey on carbapenem-resistant Enterobacteriaceae (CRE), carried out in 2011 [22], revealed an increase in the proportion of carbapenem-resistant K. pneumoniae isolates (from 11.9% to 18.7%) although the difference was not statistically significant (p = 0.5). KPC-KP remained the major contributors (83.1% of carbapenem-resistant K. pneumoniae in 2013 vs. 87.2% in 2011). Among outpatients, the proportion of KPC-KP increased from 2.2% in 2011 to 4.6% (p < 0.05). A detailed distribution of the resistance genes in the Italy is reported in Figure 2, and the distribution by species and type of patients is reported in Table 2.

Antimicrobial susceptibility

All ESBL-producing isolates that were carbapenemase-negative remained susceptible to imipenem and meropenem, while ertapenem susceptibility was 98.1% among E. coli and 82.2% among K. pneumoniae (Table 4).
Table 4

Antimicrobial susceptibility testing results for the investigated isolates, nationwide surveillance survey, Italy, October 2013 (n=652 isolates)

Species Phenotypic resistance n Susceptible (%)

AK: amikacin; AZT: aztreonam; CARBA: carbapenemase production; CAZ: ceftazidime; CIP: ciprofloxacin; COL: colistin ; CTX: ceftriaxone; ERT: ertapenem; ESBL: extended spectrum beta-lactamase production; FEP: cefepime; GM: gentamicin; IMI: imipenem; MEM: meropenem; NA: not applicable; TIG: tigecycline; TRIM/SUL: trimethoprim/sulfamethoxazole .

a COL and TIG were tested only for carbapenemase producers.

AK: amikacin; AZT: aztreonam; CARBA: carbapenemase production; CAZ: ceftazidime; CIP: ciprofloxacin; COL: colistin ; CTX: ceftriaxone; ERT: ertapenem; ESBL: extended spectrum beta-lactamase production; FEP: cefepime; GM: gentamicin; IMI: imipenem; MEM: meropenem; NA: not applicable; TIG: tigecycline; TRIM/SUL: trimethoprim/sulfamethoxazole . a COL and TIG were tested only for carbapenemase producers. Among the carbapenemase producers, all were non-susceptible to ertapenem, while most carbapenemase-producing E. coli were susceptible to imipenem and meropenem (80.0% and 60.0%, respectively). Carbapenemase-producing K. pneumoniae were more susceptible to gentamicin than to amikacin (48.7% vs. 16.8%). Broth microdilution assays, carried out with the 113 carbapenemase-producing K. pneumoniae, revealed that 61.7% and 94.4% were susceptible to colistin and tigecycline, respectively, while all five carbapenemase-producing E. coli were susceptible to both drugs (Table 4). These results were overall similar to those reported from the European Survey of Carbapenemase-Producing Enterobacteriaceae (EuSCAPE) survey in 2015 [31], and underscore the remarkable rate of colistin resistance among carbapenemase-producing K. pneumoniae circulating in Italy. No significant differences in susceptibility to these two drugs were detected among inpatients and outpatients (data not shown).

Screening for mcr-1-like genes in colistin-resistant isolates

The 43 colistin-resistant carbapenemase-positive K. pneumoniae isolates were screened for the presence of mcr-1-like genes, encoding transferable colistin resistance [32,33]. All the tested isolates yielded negative results, revealing that colistin resistance was caused by different mechanisms.

Discussion

This study provides an updated picture of the prevalence, distribution, beta-lactamase profiles and susceptibilities of ESBL-, carbapenemase- and ACBL-producing E. coli, K. pneumoniae and P. mirabilis circulating in Italy. Compared with the earlier Italian nationwide survey on ESBL-producing Enterobacteriaceae, carried out in 2003 [29], the proportion of ESBL-producing isolates (considering the three target species) showed a notable increase, especially among outpatients and among E. coli. At the level of resistance mechanisms, this epidemiological evolution was associated with a remarkable increase in the prevalence of CTX-M-type enzymes, which, in 2013, represented by far the most common type of ESBL in E. coli and in K. pneumoniae. Interestingly, despite their ability to spread, the genes encoding these resistance mechanisms have not disseminated in P. mirabilis, where the ESCR phenotype was found to be relatively common (23.6% of isolates) but due to other mechanisms, i. e. ESBLs other than CTX-M-type or ACBLs, mostly of the CMY/LAT/ACT/MIR lineage. A similar epidemiological evolution was observed in other European Countries including Belgium (with 77% vs 46% of CTX-M-positive isolates, among ESBL-producing E. coli, in 2008 vs 2006) [34], Spain (with 72% vs 52% of CTX-M- positive isolates among ESBL-producing E. coli in 2006 vs 2000) [35]. Concerning carbapenem resistance, a notable increase was observed among K. pneumoniae in comparison with data from the first Italian nationwide survey on CRE, carried out in 2011 [22], with KPC-KP remaining the major contributors of CRE endemicity in Italy and other types of carbapenemases remaining uncommon. These findings underscore the ability of carbapenemase-producing Enterobacteriaceae (CPE) to rapidly disseminate and establish conditions of high-level endemicity, and the notion that CPE are associated with a heightened epidemiological risk and deserve special attention, as readily acknowledged by the European Centre for Disease Prevention and Control (ECDC) [36]. Indeed, the data from the EARS-NET surveillance system indicate that there is an overall increasing spread of CRE in some European countries [21], and results from the EuSCAPE project have shown that some regions are experiencing a worrisome prevalence of CPE per 10,000 hospital admissions, ranging from four to six for Italy, Greece and Spain [37]. Interestingly, KPC-KP isolates were also found from outpatients, at a rate that was approximately double compared with that found in the 2011 survey (4.6% vs 2.2%) [22]. Since a significant proportion of these outpatients could have been recently hospitalised or otherwise have had contact with healthcare services, this figure may not reflect accurately the prevalence of KPC-KP in the community, in Italy. However, this finding points to an increasing dissemination of CPE also outside the hospital setting, likely reflecting the ability of KPC-KP to establish persistent intestinal colonisation even after hospital discharge [38,39]. It might herald a possible dissemination in the community like the one previously witnessed with CTX-M-producing E. coli [40]. Indeed, recent reports from the US and Spain have described the emergence of CPE infections also in the community, underscoring this possibility [41,42]. Such a scenario should be avoided, and suitable infection control measures should be enforced to address this phenomenon in settings of high CRE endemicity like Italy and some other European countries [37]. In this grim scenario, the good news was that (i) overall carbapenem susceptibility was retained by P. mirabilis, with no carbapenemase-positive isolates detected in this species despite the high endemicity of CPE; and that (ii) no mcr-1-like transferable colistin resistance genes were detected among the colistin-resistant CPE isolates, suggesting that this worrisome resistance mechanism remains uncommon among colistin-resistant CPE circulating in Italy. Updated molecular surveillance data on resistance genes to beta-lactams are of increasing importance due to the introduction on the market of new antibiotics for resistant Gram-negatives that are based on new beta-lactamase inhibitors (e. g. avibactam), which will be useful for treatment of infections caused by ESBL and carbapenemase producers [43]. The new inhibitors, however, are not active against all beta-lactamases e. g. avibactam is able to inhibit class A but not class B beta-lactamases. Thus the possibility of using these new drugs will depend on the specific mechanism of resistance, and rapid testing for these resistance mechanisms will become an essential step in antibiotic stewardship programs. In this perspective, this survey underscores the major role of beta-lactamase genes as resistance determinants in Enterobacteriaceae in the Italian epidemiological setting, and provides relevant information for the selection of the most suitable diagnostic strategies based on molecular detection of beta-lactam resistance mechanisms. A limitation of this study is that, due to the study design, laboratory-based surveillance, information about risk factors for developing antibiotic resistance was not available. Future studies are warranted to investigate these aspects, which are relevant to understand the reasons for the epidemiological differences observed in different European countries and to contextualise infection control policies.
  47 in total

Review 1.  Plasmid-determined AmpC-type beta-lactamases.

Authors:  Alain Philippon; Guillaume Arlet; George A Jacoby
Journal:  Antimicrob Agents Chemother       Date:  2002-01       Impact factor: 5.191

2.  Carbapenemase-producing Enterobacteriaceae in Europe: assessment by national experts from 38 countries, May 2015.

Authors:  Barbara Albiger; Corinna Glasner; Marc J Struelens; Hajo Grundmann; Dominique L Monnet
Journal:  Euro Surveill       Date:  2015

Review 3.  The CTX-M beta-lactamase pandemic.

Authors:  Rafael Cantón; Teresa M Coque
Journal:  Curr Opin Microbiol       Date:  2006-08-30       Impact factor: 7.934

Review 4.  OXA-48-like carbapenemases: the phantom menace.

Authors:  Laurent Poirel; Anaïs Potron; Patrice Nordmann
Journal:  J Antimicrob Chemother       Date:  2012-04-11       Impact factor: 5.790

5.  Intestinal carriage of Shewanella xiamenensis simulating carriage of OXA-48-producing Enterobacteriaceae.

Authors:  Alberto Antonelli; Domenica Maria Di Palo; Angelo Galano; Sabrina Becciani; Carlotta Montagnani; Patrizia Pecile; Luisa Galli; Gian Maria Rossolini
Journal:  Diagn Microbiol Infect Dis       Date:  2015-02-21       Impact factor: 2.803

6.  Diagnosing herpesvirus infections by real-time amplification and rapid culture.

Authors:  G J J van Doornum; J Guldemeester; A D M E Osterhaus; H G M Niesters
Journal:  J Clin Microbiol       Date:  2003-02       Impact factor: 5.948

7.  Rapid detection of blaKPC carbapenemase genes by real-time PCR.

Authors:  Musa Hindiyeh; Gill Smollen; Zehava Grossman; Daniela Ram; Yehudit Davidson; Fernando Mileguir; Marina Vax; Debbie Ben David; Ilana Tal; Galia Rahav; Ari Shamiss; Ella Mendelson; Nathan Keller
Journal:  J Clin Microbiol       Date:  2008-07-09       Impact factor: 5.948

Review 8.  AmpC beta-lactamases.

Authors:  George A Jacoby
Journal:  Clin Microbiol Rev       Date:  2009-01       Impact factor: 26.132

9.  CTX-M Enzymes: Origin and Diffusion.

Authors:  Rafael Cantón; José María González-Alba; Juan Carlos Galán
Journal:  Front Microbiol       Date:  2012-04-02       Impact factor: 5.640

10.  Community-Onset Bloodstream and Other Infections, Caused by Carbapenemase-Producing Enterobacteriaceae: Epidemiological, Microbiological, and Clinical Features.

Authors:  José Ramón Paño-Pardo; Beatriz López Quintana; Fernando Lázaro Perona; Guillermo Ruiz Carrascoso; María Pilar Romero-Gómez; Belén Loeches Yagüe; Beatriz Díaz-Pollán; Ana Martínez-Virto; Jesús Mingorance; Julio García Rodríguez; José Ramón Arribas; Rosa Gómez-Gil
Journal:  Open Forum Infect Dis       Date:  2016-08-01       Impact factor: 3.835

View more
  21 in total

1.  Incidence and antimicrobial resistance trends in bloodstream infections caused by ESKAPE and Escherichia coli at a large teaching hospital in Rome, a 9-year analysis (2007-2015).

Authors:  Giulia De Angelis; Barbara Fiori; Giulia Menchinelli; Tiziana D'Inzeo; Flora Marzia Liotti; Grazia Angela Morandotti; Maurizio Sanguinetti; Brunella Posteraro; Teresa Spanu
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2018-06-09       Impact factor: 3.267

2.  mcr-3 and mcr-4 Variants in Carbapenemase-Producing Clinical Enterobacteriaceae Do Not Confer Phenotypic Polymyxin Resistance.

Authors:  Jeanette W P Teo; Marimuthu Kalisvar; Indumathi Venkatachalam; Oon Tek Ng; Raymond T P Lin; Sophie Octavia
Journal:  J Clin Microbiol       Date:  2018-02-22       Impact factor: 5.948

Review 3.  AmpC β-lactamase-producing Enterobacterales: what a clinician should know.

Authors:  Simone Meini; Carlo Tascini; Marco Cei; Emanuela Sozio; Gian Maria Rossolini
Journal:  Infection       Date:  2019-03-06       Impact factor: 3.553

4.  Mortality attributable to different Klebsiella susceptibility patterns and to the coverage of empirical antibiotic therapy: a cohort study on patients admitted to the ICU with infection.

Authors:  Guido Bertolini; Giovanni Nattino; Carlo Tascini; Daniele Poole; Bruno Viaggi; Greta Carrara; Carlotta Rossi; Daniele Crespi; Matteo Mondini; Martin Langer; Gian Maria Rossolini; Paolo Malacarne
Journal:  Intensive Care Med       Date:  2018-09-25       Impact factor: 17.440

5.  Letter to the Editor: Surveillance of mcr-1 and mcr-2 genes in Carbapenem-resistant Klebsiella pneumoniae strains from an Italian Hospital.

Authors:  Carolina Venditti; Carla Nisii; Silvia D'Arezzo; Antonella Vulcano; Antonino Di Caro
Journal:  Euro Surveill       Date:  2017-08-31

6.  Multicenter prospective study on the prevalence of colistin resistance in Escherichia coli: relevance of mcr-1-positive clinical isolates in Lombardy, Northern Italy.

Authors:  Luigi Principe; Aurora Piazza; Carola Mauri; Adriano Anesi; Silvia Bracco; Gioconda Brigante; Erminia Casari; Carlo Agrappi; Mariasofia Caltagirone; Federica Novazzi; Roberta Migliavacca; Laura Pagani; Francesco Luzzaro
Journal:  Infect Drug Resist       Date:  2018-03-09       Impact factor: 4.003

7.  A Novel IncA/C1 Group Conjugative Plasmid, Encoding VIM-1 Metallo-Beta-Lactamase, Mediates the Acquisition of Carbapenem Resistance in ST104 Klebsiella pneumoniae Isolates from Neonates in the Intensive Care Unit of V. Monaldi Hospital in Naples.

Authors:  Eliana P Esposito; Stefano Gaiarsa; Mariateresa Del Franco; Valeria Crivaro; Mariano Bernardo; Susanna Cuccurullo; Francesca Pennino; Maria Triassi; Piero Marone; Davide Sassera; Raffaele Zarrilli
Journal:  Front Microbiol       Date:  2017-11-03       Impact factor: 5.640

8.  Recommendations for the surveillance of multidrug-resistant bacteria in Italian long-term care facilities by the GLISTer working group of the Italian Association of Clinical Microbiologists (AMCLI).

Authors:  Richard Aschbacher; Leonardo Pagani; Roberta Migliavacca; Laura Pagani
Journal:  Antimicrob Resist Infect Control       Date:  2020-07-13       Impact factor: 4.887

Review 9.  Community-Acquired Urinary Tract Infection by Escherichia coli in the Era of Antibiotic Resistance.

Authors:  Dong Sup Lee; Seung-Ju Lee; Hyun-Sop Choe
Journal:  Biomed Res Int       Date:  2018-09-26       Impact factor: 3.411

10.  Whole-Genome Sequence of the First Extended-Spectrum β-Lactamase-Producing Strain of Salmonella enterica subsp. enterica Serovar Napoli.

Authors:  Mathieu Clément; Alban Ramette; Odette J Bernasconi; Luigi Principe; Francesco Luzzaro; Andrea Endimiani
Journal:  Microbiol Resour Announc       Date:  2018-09-13
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.