Literature DB >> 28794672

A new species of terrestrial-breeding frog (Amphibia, Craugastoridae, Pristimantis) from high elevations of the Pui Pui Protected Forest in central Peru.

Edgar Lehr1, Rudolf von May2.   

Abstract

We describe a new species of Pristimantis from upper montane forests and high Andean grasslands of the Pui Pui Protected Forest and its close surroundings, Región Junín, central Peru. The description of the new species is based on 34 specimens found at elevations between 3400 and 3936 m a.s.l. Pristimantis attenboroughisp. n. is characterized by a snout-vent length of 14.6-19.2 mm in adult males (n = 21), 19.2-23.0 mm in adult females (n = 10), and is compared morphologically and genetically with other taxonomically and biogeographically relevant species of Pristimantis. The new species is characterized by having narrow digits that lack circumferential grooves, irregularly shaped, discontinuous dorsolateral folds, and absence of both tympanic membrane and tympanic annulus. The high similarity in morphology between P. attenboroughisp. n. and members of the Andean genera Phrynopus and Bryophryne provides an example for convergent evolution, and highlights the importance of using molecular data to justify generic assignment. Pristimantis attenboroughisp. n. is most similar to Phrynopus chaparroi from the Región Junín, suggesting that the generic placement of this species needs to be revised. Phylogenetically the new species belongs to the Pristimantis danae species Group, a clade that includes several Pristimantis species distributed in the montane forests of central Peru, including P. albertus, P. aniptopalmatus, P. ornatus, and P. stictogaster.

Entities:  

Keywords:  Andes; DNA barcoding; Pristimantis attenboroughi new species; Puna; frogs; molecular phylogeny; montane forest

Year:  2017        PMID: 28794672      PMCID: PMC5549528          DOI: 10.3897/zookeys.660.11394

Source DB:  PubMed          Journal:  Zookeys        ISSN: 1313-2970            Impact factor:   1.546


Introduction

The Pui Pui Protected Forest (Bosque de Protección Pui Pui, hereafter PPPF, Fig. 1) is located in the Selva Central of Peru and is one of twelve natural protected areas with different levels of legal protection such as national parks, national sanctuaries, and national reserves in the regions of Pasco and Junín (Sernanp 2010). The PPPF, located in the Región Junín, was established in 1985 and covers 60,000 hectares encompassing montane forest (30%) and high Andean grassland (Puna; 70%) habitats (Sernanp 2010). The area protects the upper watershed of several rivers and includes elevations between 1700 and 4500 m a.s.l. (Sernanp 2010).
Figure 1.

Map of Peru with the Pui Pui Protected Forest indicated in red.

In 2012–2014, we conducted herpetological surveys in montane forests and Puna of the PPPF to catalog the amphibian and reptile species and to evaluate their conservation status. As a result, we found several new species of frogs () as well as new species of lizards (). All new species were compared morphologically and genetically with other taxonomically and biogeographically relevant taxa mostly from Ecuador, Peru, and Bolivia. Herein we describe a new species of from upper montane and Puna habitats collected between 2012 and 2013.

Materials and methods

Fieldwork. Because of its remote location, the PPPF is difficult to reach and is only accessible through a few entrances located ca. 1–2 days of walking distance from the nearest villages. The upper montane forests and Puna of the PPPF were reached from Toldopampa (, 3670 m a.s.l., ca. 45 km SW from Satipo) with the help of local guides by walking in 1.5 days (ca. 11 km airline). In 2012 fieldwork was conducted between May 8 and 21 by EL and RvM, and in 2013 between June 21 and July 8 by EL, J. Moravec, and J.C. Cusi. Amphibians were preserved in 96% ethanol and stored in 70% ethanol. Deposited eggs were stored in 70% ethanol. Map of Peru with the Pui Pui Protected Forest indicated in red. Morphological characters. The format for the description follows Lynch and Duellman (1997), except that the term dentigerous processes of vomers is used instead of vomerine odontophores (Duellman et al. 2006), and diagnostic characters are those of Duellman and Lehr (2009). Taxonomic classification follows Hedges et al. (2008), except that we followed Pyron and Wiens (2011) for family placement and Padial et al. (2014) for names of species groups. Sex and maturity of specimens were identified by observing gonads through dissections. Specimens were considered juveniles when gonads were too small to distinguish between sexes. The tympanic region of two specimens (MUSM 31199, NMP6V 75534) was opened to see if a tympanic annulus is present under the skin. We measured the following variables to the nearest 0.1 mm with digital calipers under a stereomicroscope: snout–vent length (SVL, straight length distance from tip of snout to vent), tibia length (TL, distance from the knee to the distal end of the tibia), foot length (FL, distance from proximal margin of inner metatarsal tubercle to tip of Toe IV), head length (HL, from angle of jaw to tip PageBreakof snout), head width (HW, at level of angle of jaw), horizontal eye diameter (ED), interorbital distance (IOD), upper eyelid width (EW), internarial distance (IND), eye–nostril distance (E-N, straight line distance between anterior corner of orbit and PageBreakposterior margin of narial opening), and egg diameter. Fingers and toes are numbered preaxially to postaxially from I–IV and I–V, respectively. We compared the lengths of toes III and V by adpressing both toes against Toe IV; lengths of fingers I and II were compared by adpressing the fingers against each other. All drawings were made by EL using a stereomicroscope and a camera lucida. Photographs taken by EL and RvM were used for descriptions of coloration in life. Comparisons of congeners focus on species in similar habitats from Ecuador and Peru and those with close phylogenetic relationships as recovered in our phylogenetic trees. Information on species for comparative diagnoses was obtained from Duellman and Lehr (2009) and from original species descriptions. For specimens examined see Appendix. Codes of collections are: MUSM = Universidad Nacional Mayor de San Marcos, Lima, Peru; NMP6V = National Museum Prague, Prague, Czech Republic; UMMZ = University of Michigan Museum of Zoology, Ann Arbor, USA. Field number code is: IWU = Illinois Wesleyan University, Bloomington, USA. Conservation status was evaluated using the criteria in IUCN (2001). Maps were designed with ArcGIS 10.0 by J.C. Cusi. Molecular phylogenetic analysis. The phylogenetic position of the new species with respect to other morphologically similar species was determined through analysis of DNA sequence data. This analysis included two mitochondrial genes, 16S rRNA (16S) and 12S rRNA (12S). We used tissue samples from specimens collected in central Peru (Región Junín) to obtain DNA sequences for the new species and several other species (Table 1). Additionally, we downloaded selected sequences of morphologically similar taxa (, , , ) distributed at high elevations (> 2000 m a.s.l.) from Genbank (Table 1). We included , , and as outgroup taxa (Padial et al. 2014).
Table 1.

GenBank accession numbers for taxa and genes sampled in this study.

Taxon16S12SVoucher_NbrReference
Bryophryne bakersfield KT276289 naMHNC5999 Chaparro et al. 2015
Bryophryne bakersfield KT276287 KT276281 MHNC6022 Chaparro et al. 2015
Bryophryne bakersfield KT276290 KT276282 MHNC6023 Chaparro et al. 2015
Bryophryne bakersfield KT276291 KT276283 MHNC6007 Chaparro et al. 2015
Bryophryne bakersfield KT276288 KT276284 MHNC6009 Chaparro et al. 2015
Bryophryne bustamantei KT276293 KT276286 MHNC6019 Chaparro et al. 2015
Bryophryne cophites EF493537 EF493537 KU173497 Heinicke et al. 2007
Bufo melanostictus FJ882791 FJ882791 VUB 0052 Van Bocxlaer et al. 2009
Hamptophryne boliviana DQ283438 DQ283438 na Frost et al. 2006
Ischnocnema guentheri EF493533 EF493533 na Heinicke et al. 2007
Lynchius flavomaculatus EU186667 EU186667 KU218210 Hedges et al. 2008
Lynchius nebulanastes EU186704 EU186704 KU181408 Hedges et al. 2008
Lynchius oblitus AM039640 AM039708 MUSM19914 Lehr et al. 2005, Motta et al. 2016
Lynchius oblitus AM039639 AM039707 MTD45954 Lehr et al. 2005, Motta et al. 2016
Lynchius parkeri EU186705 EU186705 KU181307 Hedges et al. 2008
Lynchius simmonsi JF810004 JF809940 QZ41639 Padial et al. 2014
Oreobates amarakaeri JF809996 JF809934 MHNC6975 Padial et al. 2014
Oreobates ayacucho JF809970 JF809933 MNCN_IDlR5024 Padial et al. 2014
Oreobates cruralis EU186666 EU186666 KU215462 Hedges et al. 2008
Oreobates gemcare JF809960 JF809930 MHNC6687 Padial et al. 2014
Oreobates granulosus EU368897 JF809929 MHNC3396 Padial et al. 2014
Phrynopus auriculatus EF493708 EF493708 KU291634 Heinicke et al. 2007
Phrynopus barthlenae AM039653 AM039721 SMF81720 Lehr et al. 2005
Phrynopus bracki EF493709 EF493709 USNM286919 Heinicke et al. 2007
Phrynopus bufoides AM039645 AM039713 MUSM19860 Lehr et al. 2005
Phrynopus heimorum AM039635 AM039703 MTD45621 Lehr et al. 2005
Phrynopus heimorum AM039636 AM039704 MTD45622 Lehr et al. 2005
Phrynopus horstpauli AM039651 AM039719 MTD44333 Lehr et al. 2005
Phrynopus horstpauli AM039647 AM039715 MTD44334 Lehr et al. 2005
Phrynopus kauneorum AM039650 AM039718 MTD44332 Lehr et al. 2005
Phrynopus kauneorum AM039655 AM039723 MUSM20595 Lehr et al. 2005
Phrynopus pesantesi AM039656 AM039724 MTD45072 Lehr et al. 2005
Phrynopus tautzorum AM039652 AM039720 MUSM20613 Lehr et al. 2005
Phrynopus tribulosus EU186725 EU186707 KU291630 Hedges et al. 2008
Pristimantis acuminatus EU130579 naQCAZ19664 Elmer et al. 2007
Pristimantis albertus EU186695 EU186695 KU291675 Hedges et al. 2008
Pristimantis albertus KY594749 naRVM41_14This study
Pristimantis albertus KY594750 naRVM42_14This study
Pristimantis albertus KY594751 naRVM527This study
Pristimantis altamazonicus EF493670 EF493670 KU215460 Heinicke et al. 2007
Pristimantis altamazonicus DQ195449 na MC11717 Mahecha et al., unpublished
Pristimantis aniptopalmatus EF493390 EF493390 KU291627 Heinicke et al. 2007
Pristimantis aniptopalmatus EU186694 EU186694 KU291666 Padial et al. 2014
Pristimantis attenboroughi sp. n. KY594752 naMUSM31186This study
Pristimantis attenboroughi sp. n. KY594753 KY594761 NMP6V75522This study
Pristimantis attenboroughi sp. n. KY594754 KY594762 NMP6V75524This study
Pristimantis attenboroughi sp. n. KY594755 KY594763 NMP6V75525This study
Pristimantis attenboroughi sp. n. KY594756 KY594764 NMP6V75528This study
Pristimantis attenboroughi sp. n. KY594757 naNMP6V75529This study
Pristimantis aureoventris JQ742152 naVUB3748 Kok et al. 2012
Pristimantis bipunctatus EF493702 EF493702 KU291638 Heinicke et al. 2007
Pristimantis bipunctatus KY594758 naMUSM31179This study
Pristimantis cf. mendax KY628996 naMUSM31157This study
Pristimantis cf. mendax EU186659 na MTD45080 Hedges et al. 2008
Pristimantis croceoinguinis KY594759 naMUSM31154This study
Pristimantis cruciocularis EU186656 EU186656 KU291673 Hedges et al. 2008
Pristimantis cruciocularis KY594760 naNMP6V75535This study
Pristimantis danae EU192270 naMNCN44234Padial and De la Riva 2009
Pristimantis diadematus EU186668 EU186668 KU221999 Hedges et al. 2008
Pristimantis llojsintuta EU712641 naMNCNDNA7314 Padial et al. 2009
Pristimantis melanogaster EF493664 EF493826 na Heinicke et al. 2007
Pristimantis orestes EF493388 EF493388 KU218257 Heinicke et al. 2007
Pristimantis ornatus EU186660 EU186660 MTD45073 Hedges et al. 2008
Pristimantis petrobardus EF493367 EF493825 KU212293 Heinicke et al. 2007
Pristimantis platydactylus EU712653 naMNCNDNA3943 Padial et al. 2009
Pristimantis platydactylus EU712671 naMNCNDNA4138 Padial et al. 2009
Pristimantis platydactylus EU712718 naMNCNDNA6377 Padial et al. 2009
Pristimantis pluvialis KX155577 naCORBIDI_11862 Shepack et al. 2016
Pristimantis pluvialis KX155578 naCORBIDI_16695 Shepack et al. 2016
Pristimantis reichlei EF493707 EF493707 MUSM9267 Padial et al. 2014
Pristimantis rhabdocnemus EU186706 EU186724 KU291651 Hedges et al. 2008
Pristimantis rhabdolaemus EF493706 EF493706 KU173492 Heinicke et al. 2007
Pristimantis sagittulus EF493705 EF493705 KU291635 Duellman and Hedges 2005
Pristimantis schultei EF493681 na KU212220 Heinicke et al. 2007
Pristimantis simonbolivari EF493671 EF493671 KU218254 Heinicke et al. 2007
Pristimantis simonsii EU186665 EU186665 KU212350 Hedges et al. 2008
Pristimantis skydmainos EF493393 EF493393 MUSM10071 Heinicke et al. 2007
Pristimantis sp. AM039658 na MTD45201 Lehr et al. 2005
Pristimantis stictogaster EF493704 EF493704 KU291659 Heinicke et al. 2007
Pristimantis toftae EF493353 EF493353 KU215493 Heinicke et al. 2007
Pristimantis toftae EU192294 naMNCN43246Padial and De la Riva 2009
Pristimantis wiensi EF493668 EF493377 KU219796 Heinicke et al. 2007
GenBank accession numbers for taxa and genes sampled in this study. Extraction, amplification, and sequencing of DNA followed protocols previously used for Neotropical terrestrial breeding frogs (Lehr et al. 2005, Hedges et al. 2008). We used the 16SA (forward) primer (5’-3’ sequence: CGCCTGTTTATCAAAAACAT) and the 16SB (reverse) primer (5’-3’ sequence: CCGGTCTGAACTCAGATCACGT) to amplify a fragment of the 16S gene (Palumbi et al. 1991), and we employed the following thermocycling conditions to amplify DNA using the polymerase chain reaction (PCR): 1 cycle of 96°C/3 min; 35 cycles of 95°C/30 s, 55°C/45 s, 72°C/1.5 min; 1 cycle 72°C/7 min. Additionally, we used the L25195 (forward) primer (5’-3’ sequence: AAACTGGGATTAGATACCCCACTA) and the H2916 (reverse) primer (5’-3’ sequence: GAGGGTGACGGGCGGTGTGT) to amplify a fragment of the 12S gene (Palumbi et al. 1991, Vences et al. 2000), and we employed the following thermocycling conditions to amplify DNA using PCR: 1 cycle of 94°C/1.5 min; 35 cycles of 94°C/45 s, 50°C/1 min., 74°C/2 min; 1 cycle 72°C/10 min. We completed the cycle sequencing reactions by using the corresponding PCR primers and the BigDye Terminator 3.1 (Applied Biosystems), and obtained sequence data by running the purified reaction products in an ABI 3730 Sequence Analyzer (Applied Biosystems). The newly obtained sequences are deposited in GenBank (Table 1). Geneious R6, version 6.1.8 (Biomatters 2013; http://www.geneious.com/) was used to align the sequences. Within Geneious, we used the MAFFT, version 7.017 (Katoh and Standley 2013) alignment program. Prior to conducting phylogenetic analysis, we used PartitionFinder, version 1.1.1 (Lanfear et al. 2012) to select the appropriate models of nucleotide evolution and used the Bayesian information criterion (BIC) to PageBreakdetermine the best partitioning scheme and substitution model for each gene. According to PartitionFinder, the best scheme included one partition combining both 12S and 16S and the best model of nucleotide substitution was GTR + I + Γ. Phylogenetic analysis was done using Maximum Likelihood (ML) approach using RaxML version 8.2.4 (Stamatakis 2006), where the “f-a” function was employed to conduct a bootstrap analysis and search for the optimal likelihood tree. Our analysis included 82 terminals and a 922 bp concatenated alignment that included the 16S and 12S dataset. The GTR + I + Γ model of nucleotide substitution was used to perform 200 trees searches; node support was assessed using 1000 bootstrap replicates. Additionally, we used the R package ‘APE’ (Paradis et al. 2004) to estimate uncorrected p-distances (i.e., the proportion of nucleotide sites at which any two sequences are different).

Results

Molecular phylogenetic analysis. The Maximum Likelihood (ML) tree (Fig. 2) was generally congruent with a previous molecular phylogeny (Padial et al. 2014) and supported the distinctiveness of the new species from other closely related taxa. Placement of sp. n. in the genus Jiménez de la Espada, 1871 was strongly supported and, based on the available data, the new species is most closely related to Duellman and Hedges, 2007, (Duellman and Hedges, 2005), (Lehr, Lundberg, Aguilar, and von May, 2006), and (Duellman and Hedges, 2005) (Fig. 2). Table 2 compares uncorrected p-distances of a 542 bp (including gaps) fragment of the 16S mitochondrial rRNA gene of species included in our analyses. The lowest distance occurs between the new species and (uncorrected p-distance 4.3 %) while the uncorrected p-distances between the new species and the other three species in the same clade of the species Group (, , Padial and De la Riva, 2009, [Duellman, 1978a], [Duellman and Hedges, 2005], [Lehr, Aguilar, and Duellman, 2004], [Duellman, 1978b]) vary between 5.2 to 11.8 %.
Figure 2.

Maximum Likelihood (ML) phylogeny based on the combined 16S + 12S dataset (ML bootstrap values >50 are indicated at each node).

Table 2.

Uncorrected p-distances of the 16s mitochondrial rRNA gene for six specimens of sp. n. (in bold) and other species from GenBank.

123456789
1 Pristimantis albertus KU291675
2 Pristimantis albertus RvM41_140.000
3 Pristimantis albertus RvM42_140.0000.000
4 Pristimantis albertus RvM5270.0000.0000.000
5 Pristimantis attenboroughi sp. n. NMP6V 75522 0.062 0.065 0.062 0.066
6 Pristimantis attenboroughi sp. n. NMP6V 75529 0.062 0.065 0.062 0.066 0.000
7 Pristimantis attenboroughi sp. n. NMP6V 75524 0.062 0.065 0.062 0.066 0.0000.000
8 Pristimantis attenboroughi sp. n. NMP6V 75525 0.062 0.065 0.062 0.066 0.0000.0000.000
9 Pristimantis attenboroughi sp. n. MUSM 31186 0.062 0.065 0.062 0.066 0.0000.0000.0000.000
10 Pristimantis attenboroughi sp. n. NMP6V 75528 0.062 0.065 0.062 0.066 0.0000.0000.0000.0000.000
11 Pristimantis ornatus MTD450730.0560.0590.0560.059 0.052 0.052 0.052 0.052 0.052
12 Pristimantis stictogaster KU2916590.0410.0430.0410.043 0.049 0.049 0.049 0.049 0.049
13 Pristimantis aniptopalmatus KU2916270.0560.0590.0560.059 0.043 0.043 0.043 0.043 0.043
14 Pristimantis aniptopalmatus KU2916660.0560.0590.0560.059 0.043 0.043 0.043 0.043 0.043
15 Pristimantis rhabdolaemus KU1734920.0930.0970.0930.097 0.058 0.058 0.058 0.058 0.058
16 Pristimantis toftae KU2154930.1100.1150.1100.115 0.074 0.074 0.074 0.074 0.074
17 Pristimantis toftae MNCN432460.1050.1100.1050.110 0.070 0.070 0.070 0.070 0.070
18 Pristimantis sagittulus KU2916350.0930.0970.0930.099 0.066 0.066 0.066 0.066 0.066
19 Pristimantis danae MNCN442340.1160.1210.1160.122 0.094 0.094 0.094 0.094 0.094
20 Pristimantis reichlei MHNSM92670.1320.1350.1320.136 0.118 0.118 0.118 0.118 0.118
10111213141516171819
1 Pristimantis albertus KU291675
2 Pristimantis albertus RvM41_14
3 Pristimantis albertus RvM42_14
4 Pristimantis albertus RvM527
5 Pristimantis attenboroughi sp. n. NMP6V 75522
6 Pristimantis attenboroughi sp. n. NMP6V 75529
7 Pristimantis attenboroughi sp. n. NMP6V 75524
8 Pristimantis attenboroughi sp. n. NMP6V 75525
9 Pristimantis attenboroughi sp. n. MUSM 31186
10 Pristimantis attenboroughi sp. n. NMP6V 75528
11 Pristimantis ornatus MTD45073 0.052
12 Pristimantis stictogaster KU291659 0.049 0.037
13 Pristimantis aniptopalmatus KU291627 0.043 0.0480.049
14 Pristimantis aniptopalmatus KU291666 0.043 0.0480.0490.000
15 Pristimantis rhabdolaemus KU173492 0.058 0.0820.0760.0740.074
16 Pristimantis toftae KU215493 0.074 0.0910.0910.0830.0830.070
17 Pristimantis toftae MNCN43246 0.070 0.0990.0880.0820.0820.0740.055
18 Pristimantis sagittulus KU291635 0.066 0.0840.0800.0680.0680.0660.0780.095
19 Pristimantis danae MNCN44234 0.094 0.1070.1070.1000.1000.0820.1010.1000.083
20 Pristimantis reichlei MHNSM9267 0.118 0.1240.1130.1170.1170.1030.1260.1140.1170.113
Maximum Likelihood (ML) phylogeny based on the combined 16S + 12S dataset (ML bootstrap values >50 are indicated at each node). Uncorrected p-distances of the 16s mitochondrial rRNA gene for six specimens of sp. n. (in bold) and other species from GenBank.

sp. n.

http://zoobank.org/DCE88D49-0EB1-4DA4-A672-5341763B3236

Common name.

English: Attenborough’s Rubber Frog. Spanish: Rana cutín Attenborough. Holotype. MUSM 31196 (IWU 178, Figs 3, 4), adult male from the Pui Pui Protected Forest, Provincia Satipo, Región Junín, Peru, Upper part of Quebrada Tarhuish, “Laguna Udrecocha”, Puna, open area on east side of Laguna Udrecocha, , 3936 m a.s.l. (Fig. 8A), collected on 17 May 2012 by E. Lehr and R. von May.
Figure 3.

Life male holotype (MUSM 31196, SVL 18.9 mm) of sp. n. in dorsolateral view (A), dorsal view (B), flanks, groin, anterior surfaces of thighs (C), posterior surfaces of thighs (D), and ventral view (E). Photos by E. Lehr.

Figure 4.

Ventral views of right hand (A) and right foot (B) of holotype of sp. n. (MUSM 31196). Drawings by E. Lehr.

Figure 8.

Habitats of sp. n. in the PPPF: A type locality in the upper Tarhuish valley at Laguna Udrecocha, Puna at 3936 m a.s.l., 17 May 2012 B upper montane forest at 3550 m a.s.l. where sp. n. was found in moss pads C female sp. n. (MUSM 31980, SVL 21.5 mm) guarding a clutch in a moss pad. Photos by E. Lehr.

Life male holotype (MUSM 31196, SVL 18.9 mm) of sp. n. in dorsolateral view (A), dorsal view (B), flanks, groin, anterior surfaces of thighs (C), posterior surfaces of thighs (D), and ventral view (E). Photos by E. Lehr. Ventral views of right hand (A) and right foot (B) of holotype of sp. n. (MUSM 31196). Drawings by E. Lehr. Paratypes. A total of 33 (Figs 5–7, 8C), all from inside the PPPF (except for: MUSM 31199–31202, NMP6V 75526–29), Provincia Satipo, Región Junín: 10 adult females (MUSM 31977, 31980, 31987, 31201, NMP6V 75076, 75522 [GenBank accession numbers KY594753, KY594761], 75523, 75528 [GenBank accession numbers KY594756, KY594764], 75529 [GenBank accession number KY594757], 75534), 20 adult males (MUSM 31186 [GenBank accession number KY594752], 31195, 31199, 31202, 31975, 31979, 31988, 31989, 31992, 31993, NMP6V 75077–75079, 75524 [GenBank accession numbers KY594754, KY594762], 75525 [GenBank accession numbers KY594755, KY594763], 75526, 75527, 75533, UMMZ 244726, 244727), 3 juveniles (MUSM 31187, 31990, 31200).
Figure 5.

Variation of male paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (MUSM 31186, SVL 18.6 mm) D–F (MUSM 31195, SVL 16.9 mm) G–I (MUSM 31992, SVL 15.9 mm). Photos by E. Lehr.

Figure 7.

Variation of juvenile paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (MUSM 31990, SVL 14.0 mm) D–F (MUSM 31187, SVL 12.5 mm) G–I (MUSM 31200, SVL 14.0 mm). Photos by E. Lehr.

Variation of male paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (MUSM 31186, SVL 18.6 mm) D–F (MUSM 31195, SVL 16.9 mm) G–I (MUSM 31992, SVL 15.9 mm). Photos by E. Lehr. Variation of female paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (NMP6V 75522, SVL 19.2 mm) D–F (MUSM 31987, SVL 23.0 mm) G–I (MUSM 31977, SVL 21.9 mm). Photos by E. Lehr. Variation of juvenile paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (MUSM 31990, SVL 14.0 mm) D–F (MUSM 31187, SVL 12.5 mm) G–I (MUSM 31200, SVL 14.0 mm). Photos by E. Lehr. MUSM 31186, MUSM 31187, NMP6V 75522, 75523: Quebrada Tarhuish, left bank of Antuyo River, “Shiusha”, upper montane forest, , 3414 m a.s.l. collected on 12 May 2012 by E. Lehr and R. von May. MUSM 31195, NMP6V 75524, 75524: collected at the type locality along with the holotype. MUSM 31199, 31200, MUSM 31201, 31202, NMP6V PageBreak75526, 75527: Upper part of Quebrada Tasta, “Laguna Luichococha”, Puna, , 3708 m a.s.l. collected on 20 May 2012 by E. Lehr and R. von May. NMP6V 75528, 75529: near trail from Tasta to Tarhuish (first mountain peak), forest patch, , 3886 m a.s.l. collected on 20 May 2012 by E. Lehr and R. von May. MUSM 31975: Antuyo, , 3700 m a.s.l. collected on 27 June 2013 by E. Lehr, J. Moravec, and J.C. Cusi. MUSM 31977, 31979, MUSM 31980, NMP6V 75076, UMMZ 244726: Hatunpata, , 3710 m a.s.l. collected on 28 June 2013 by by E. Lehr, J. Moravec, and J.C. Cusi. MUSM 31987–31990, NMP6V 75077, 75078, 75533, UMMZ 244727: Trancapampa, , 3550 m a.s.l. collected on 2 July 2013 by E. Lehr, J. Moravec, and J.C. Cusi. MUSM 31992, 31993, NMP6V 75079, 75534: Antuyo Bajo, , 3400 m a.s.l. collected on 4 July 2013 by E. Lehr, J. Moravec, and J.C. Cusi.

Generic placement.

We assign this species to based on our molecular data (Fig. 2). Diagnosis. A new species of assigned to the species Group having the following combination of characters: (1) Skin on dorsum shagreen with low scattered tubercles, skin on flanks tuberculate, skin on venter areolate; discoidal fold absent, thoracic fold present; irregularly shaped, discontinuous dorsolateral folds present; (2) tympanic membrane and tympanic annulus absent; (3) snout short, rounded in dorsal and in lateral views; (4) upper eyelid without enlarged conical tubercles; EW shorter PageBreakthan IOD; cranial crests absent; (5) dentigerous processes of vomers present; (6) males without vocal slits, nuptial pads absent; (7) Finger I shorter than Finger II; tips of digits narrow, rounded, lacking circumferential grooves; (8) fingers without lateral fringes; (9) small conical ulnar and tarsal tubercles present; (10) heel with a small conical tubercle; inner tarsal fold usually absent; (11) inner metatarsal tubercle ovoid, 1.5 times as large as outer; outer metatarsal tubercle small, rounded; vie low supernumerary plantar tubercles; (12) toes without lateral fringes; basal toe webbing absent; Toe V longer than Toe III; tips of digits narrow, rounded, lacking circumferential grooves, toe tips slightly smaller than those on fingers; (13) in life, dorsal ground coloration pale or dark gray, reddish brown or brownish olive with dark gray scattered flecks, some with X-shaped mark on scapular and ill-defined diagonal bars on flanks; dark grayish-brown canthal and supratympanic stripes usually present; groin dark gray or pale reddish brown with a pale PageBreakred to pink tint in some; venter dark gray, pale gray, grayish brown or pale grayish green and in some dark gray mottled; iris pale grayish green with fine black vermiculation and brownish-orange horizontal streak across pupil and lower half of iris; (14) SVL in adult males 14.6–19.2 mm (n = 21), in adult females 19.2–23.0 mm (n = 10). Comparisons. is readily distinguished from its congeners in Ecuador (176 species, AmphibiaWeb 2016), Peru (128 species, AmphibiaWeb 2016), and Bolivia (17 species, AmphibiaWeb 2016) by having narrow digits without circumferential grooves, by lacking a tympanic annulus and tympanic membrane, and by having irregularly shaped, discontinuous dorsolateral folds. In Peru 18 species of lack a tympanum; these are Lehr, Moravec, and Gagliardi Urrutia, 2010, (Barbour and Dunn, 1921), Lehr and Moravec, 2017, (Lynch, 1979), Lehr and Duellman, 2007a, (Lynch, 1968), (Lehr, Lundberg, Aguilar, and von May, 2006), (Lehr, Lundberg, Aguilar, and von May, 2006), (Duellman, 1978b), (Dwyer, 1995), Boano, Mazzotti, and Sindaco, 2008, (Lynch, 1974), Duellman and Hedges, 2007, (Duellman and Hedges, 2005), (Boulenger, 1900), (Lehr, Torres-Gastello, PageBreakand Suárez-Segovia, 2007), (Boulenger, 1912), and Lehr, 2007. Of these, only from northern Peru has narrow digits without circumferential grooves. and lack circumferential grooves and a tympanum, and both have dorsolateral folds, but is smaller than (female SVL 26.2–33.3 mm in ), and male lack nuptial pads which are present in . Members of the species Group are terrestrial and inhabit high elevations in southern Ecuador and in Peru (Duellman and Lehr, 2009) and have narrow digits, and only one of the 17 species (Guayasamin and Artega 2013) lacks circumferential grooves (), and only two () lack a tympanum. Furthermore is phylogenetically distant from members of this group which is considered to be not monophyletic (Duellman and Lehr 2009, Fig. 2). Among the three other new species of from the upper montane forests and Puna of the PPPF, only sp. n. E lacks circumferential grooves and a tympanum. However, and sp. n. E both differ regarding other morphological traits, coloration, and genetically. shares with Venegas and Duellman, 2012 from the Puna of northern Peru (Venegas and Duellman 2012) narrow digits without circumferential grooves and dorsolateral folds. However, is smaller (female SVL 19.2–23.0 mm [n = 10] vs. 35.1 mm [n = 1]), lacks a tympanum (present in ), and has ulnar tubercles not coalesced into fold (coalesced into low fold in ), Venegas and Duellman (2012). The new species shares narrow digits without circumferential grooves and the absence of a tympanic annulus and tympanic membrane with the Andean genera Peters, 1873 (except for Duellman and Hedges, 2008, and Peters, 1873), 28 species from elevations between 2200 and 4400 m a.s.l. in central and northern Peru, Duellman and Lehr, 2009) and Hedges, Duellman, and Heinicke, 2008 (8 species from elevations between 2900 and 4120 m a.s.l. in southern Peru, Duellman and Lehr 2009), AmphibiaWeb (2016). is most similar with Mamani and Malqui, 2014 which was described based on morphological characters and found at elevations between 4205 and 4490 m a.s.l. in southern Región Junín (Mamani and Malqui 2014). Both and lack a tympanum and have narrow digits without circumferential grooves. However, is smaller than (female SVL 19.2–23.0 mm [n = 10] vs. 30.0–32.2 [n = 4]), lacks protuberant subconical postrictal tubercles (present in ), has dorsolateral folds (absent in ), dentigerous processes of vomers present (absent in ), and males lack nuptial pads (present in ). might belong to , but molecular characters need to be applied to confirm our suspicion.

Description of the holotype.

Head about as long as wide; head length 39.7% of SVL; head width 38.6% of SVL; cranial crests absent; snout short, rounded in dorsal view, rounded in lateral view (Fig. 3A, B); eye-nostril distance 70% of eye diameter; nostrils slightly protuberant, directed dorsolaterally; canthus rostralis short, rounded PageBreakin lateral view, weakly concave in dorsal view; loreal region concave; lips rounded; outer margin of upper eyelid each with few slightly enlarged conical tubercles; upper eyelid width 51.9% of IOD (see photo in life Fig. 3); supratympanic fold short and broad, extending from posterior margin of upper eyelid slightly curved to insertion of arm; tympanic membrane and annulus absent; distinct conical postrictal tubercles present bilaterally. Choanae small, ovoid, not concealed by palatal shelf of maxilla; dentigerous processes of vomers positioned posterior to level of choanae, oblique, narrowly separated; tongue long, oval, about three times as long as wide, not notched posteriorly, posterior half free. Skin on dorsum shagreen with low scattered tubercles, skin on flanks tuberculate, irregularly shaped, discontinuous dorsolateral folds present extending from posterior level of tympanic area to level of hind limb insertion; skin on throat, chest, and belly areolate; discoidal fold absent, thoracic fold present; cloacal sheath short. Outer ulnar surface each with a row of four minute low tubercles; palmar tubercle bifid; thenar tubercle ovoid; subarticular tubercles well defined, most prominent on base of fingers, round in ventral view, subconical in lateral view; supernumerary tubercles indistinct; fingers short and stout lacking lateral fringes, Finger I shorter than Finger II; tips of digits of fingers narrow, round, lacking circumferential grooves (Fig. 4A). Hind limbs short, slender, tibia length 40.2% of SVL; foot length 41.3% of SVL; dorsal surfaces of hind limbs tuberculate; inner surface of thighs smooth, posterior surfaces of thighs tuberculate, ventral surfaces of thighs areolate; heels each with a small conical tubercle; outer surface of tarsus with few scattered minute low tubercles; inner tarsal fold absent, but small tubercle proximal to metatarsal tubercle; inner metatarsal tubercle ovoid, one and a half times the size of round outer metatarsal tubercle; subarticular tubercles well defined, round in ventral view, subconical in lateral view; few plantar supernumerary tubercles, about one third the size of subarticular tubercles; toes without lateral fringes; basal webbing absent; tips of digits narrow, round, less expanded than those on fingers, lacking circumferential grooves; relative length of toes: 1<2<5<3<4; Toe V slightly longer than Toe III (tip of digit of Toe III and Toe V not reaching distal subarticular tubercle on Toe IV; Fig. 4B).

Measurements (in mm) of the holotype.

SVL 18.9; tibia length 7.6; foot length 7.8; head length 7.5; head width 7.3; eye diameter 2.0; inter orbital distance 2.7; upper eyelid width 1.4; internarial distance 1.9; eye–nostril distance 1.4.

Coloration of the holotype in life

(Fig. The dorsal ground coloration is pale reddish brown with few dark brown flecks; narrow dark brown canthal and supratympanic stripes; flanks pale reddish brown with dark brown flecks forming irregularly shaped diagonal bars; groin and anterior surfaces of thighs reddish brown with dark brown flecks and pale reddish tint; chest, belly, and ventral surfaces of thighs dark grayish brown, throat pale reddish brown and pale gray mottled; palmar and plantar surfaces, and fingers and toes dark grayish brown; iris pale grayish green with fine black vermiculation and brownish-orange horizontal streak across pupil and lower half of iris. Measurements (in mm) of selected adult type specimens of sp. n. M = male, F = female. For other abbreviations see methods.

Coloration of the holotype in preservative.

The dorsal ground coloration is pale brown with few dark brown flecks; narrow dark brown canthal and supratympanic PageBreakstripes; flanks pale brown with many dark brown flecks forming irregularly shaped diagonal bars; groin and anterior surfaces of thighs brown with dark brown flecks; chest, belly, and ventral surfaces of thighs dark brown, throat pale brown and pale gray mottled; palmar and plantar surfaces, and fingers and toes dark brown; iris pale gray. Measurements (in mm) and proportions of adult male and adult female type specimens of sp. n.; ranges followed by means and one standard deviation in parentheses. For abbreviations see methods. Variation. All paratypes (Figs 5–7) are similar to the holotype regarding morphology and proportions (Tables 3, 4). Besides differences in SVL, notable morphological variation includes prominence of dorsolateral folds (e.g., prominent dorsolateral folds in MUSM 31192, 31195, Fig. 5D–F, G–I; weak dorsolateral folds in MUSM 31186, 31975, 31977, NMP6V 75522, 75528, 75529, Fig. 6G–I), and coarseness of tuberculate skin texture on flanks and hind limbs (skin coarsely tuberculate in MUSM 31186, 31192, 31195, NMP6V 75525, Fig. 5; skin weakly tubercular MUSM 31987, 31997, NMP6V 75528, 75529). Two specimens (NMP6V 75529, 75534) have a tubercle-like inner tarsal fold present. demonstrates a remarkable polymorphism in coloration (Figs 5–7).
Table 3.

Measurements (in mm) of selected adult type specimens of sp. n. M = male, F = female. For other abbreviations see methods.

Characters MUSM 31988 MUSM 31992 MUSM 31186 UMMZ 244727 NMP6V 75523 MUSM 31980 MUSM 31977 NMP6V 75076 MUSM 31987
sexMMMMFFFFF
SVL 14.615.918.619.220.121.521.922.923.0
TL 6.06.27.36.88.38.48.18.38.8
FL 5.86.17.77.39.48.88.89.210.2
HL5.36.26.26.87.57.67.38.47.1
HW 5.05.76.36.67.47.87.87.97.9
ED 1.61.71.91.92.02.22.42.42.2
IOD 1.82.12.42.12.72.52.32.62.9
EW 0.91.41.21.31.61.61.61.61.3
IND 1.31.51.72.02.01.92.12.32.1
E-N 1.11.01.31.31.31.71.51.81.7
Table 4.

Measurements (in mm) and proportions of adult male and adult female type specimens of sp. n.; ranges followed by means and one standard deviation in parentheses. For abbreviations see methods.

Characters Males (n = 21) Females (n = 10)
SVL 14.6–19.2 (17.1 ± 1.2)19.2–23.0 (21.6 ± 1.1)
TL 5.8–7.6 (6.7 ± 0.5)8.0–8.8 (8.4 ± 0.2)
FL 5.8–7.8 (7.0 ± 0.5)8.8–10.2 (9.3 ± 0.4)
HL5.3–7.3 (6.3 ± 0.5)7.1–8.4 (7.6 ± 0.4)
HW 5.0–6.9 (6.0 ± 0.5)7.3–8.3 (7.9 ± 0.3)
ED 1.6–2.1 (1.9 ± 0.2)1.8–2.4 (2.1 ± 0.2)
IOD 1.8–2.5 (2.1 ± 0.1)2.3–2.9 (2.7 ± 0.2)
EW 0.9–1.9 (1.3 ± 0.2)1.3–1.7 (1.5 ± 0.1)
IND 1.3–2.1 (1.6 ± 0.2)1.9–2.3 (2.1 ± 0.1)
E-N0.8–1.4 (1.2 ± 0.1)1.3–1.8 (1.5 ± 0.2)
TL/SVL0.34–0.440.36–0.42
FL/SVL0.35–0.460.40–0.47
HL/SVL0.33–0.410.31–0.39
HW/SVL0.31–0.380.34–0.39
HW/HL0.84–1.020.94–1.11
E-N/ED0.47–0.710.62–0.89
EW/IOD0.45–0.700.45–0.70
Figure 6.

Variation of female paratypes of sp. n. in dorsolateral, dorsal, and ventral views. A–C (NMP6V 75522, SVL 19.2 mm) D–F (MUSM 31987, SVL 23.0 mm) G–I (MUSM 31977, SVL 21.9 mm). Photos by E. Lehr.

The dorsal coloration ranges from pale gray (MUSM 31987, NMP6V 75533, Fig. 6D–F), dark gray (MSUM 31186, 3199, NMP6V 75522, 75523, 75528, 75529, PageBreakFig. 6A–C), reddish brown (MUSM 31195, 31975, NMP6V 75525, Figs 5D–F) to brownish olive (MUSM 31992, 31997, Figs 5G–I, 6G–I) with dark gray scattered flecks. Some have an X-shaped mark on scapular (MUSM 31200, 31975, 31990), some ill-defined diagonal bars on the flanks (MUSM 31195). Dark grayish-brown canthal and supratympanic stripes are usually present except for dark gray specimens (MSUM 31186, 3199, NMP6V 75522, 75523, 75528, 75529). The groin is dark gray (MSUM 31186, 3199, NMP6V 75522, 75523, 75528, 75529) or pale reddish brown with a pale red to pink tint in some specimens (MUSM 31195, 31196). The venter is dark gray (NMP6V 75522, 75523, 75528, 75529, Fig. 6C), pale gray (MUSM 31987, Fig. 6F), grayish brown (MUSM 31186, 31195, NMP6V 75525, Fig. 5C, F) or pale grayish green and gray mottled (MUSM 31197, Fig. 6I) or dark gray and pale gray mottled (MUSM 31199, 31975, 31992, NMP6V 75533, Fig. 5I). Juveniles (MUSM 31187, 31990, 31200, Fig. 7) have a paler coloration (yellowish to reddish brown) with contrasting dark brown flecks and distinct canthal and supratympanic stripes. All have the iris pale grayish green with fine black vermiculation and brownish-orange horizontal streak across pupil and lower half of iris, and usually a narrow vertical dark gray streak from pupil through middle of lower iris.

Etymology.

We dedicate this species to Sir David Frederick Attenborough in honor for his educational documentaries on wildlife, especially on amphibians (e.g., Life in Cold Blood, Fabulous Frogs), and for raising awareness about the importance of wildlife conservation. The specific epithet is used as noun in apposition.

Distribution, natural history, and conservation status.

is known from six localities inside the PPPF (Puna of Quebrada Tarhuish at PageBreakPageBreakLaguna Udrecocha, Fig. 8A; upper montane forest of Quebrada Tarhuish on the left bank “Shiusha” of Antuyo River; Antuyo; Antuyo Bajo; Hatunpata, and Trancapampa, Figs 8B, 9) and from two outside the PPPF (upper part of Quebrada Tasta close to Laguna Luichococha; in forest of first mountain peak next to trail from Tasta to Tarhuish), and is distributed at elevations between 3400 and 3936 m a.s.l., Fig. 9. The type locality (Figs 8A, 9), upper part of Quebrada Tarhuish, on the east side of Laguna Udrecocha at 3936 m a.s.l., belongs to the Puna ecoregion (Brack 1986). The vegetation consists of Peruvian feather grass (), mosses, and small bushes. The holotype was found inside moss in the afternoon on 17 May 2012. No sympatric anurans were found at the type locality. At the upper montane forest of Quebrada Tarhuish on the left bank “Shiusha” of Antuyo River, was found deep inside large moss layers. Sympatric anurans are (MUSM 31193), PageBreak sp. n. C (MUSM 31190–92), sp. n. D (MUSM 31197–98), and sp. n. A (MUSM 31203).
Figure 9.

Distribution of sp. n. in the PPPF and its surroundings: type locality: Laguna Udrecocha, 3936 m a.s.l.; 1 Upper part of Quebrada Tasta, “Laguna Luichococha”, 3708 m a.s.l. 2 near trail from Tasta to Tarhuish (first mountain peak), forest patch, 3886 m a.s.l. 3 Quebrada Tarhuish, left bank of Antuyo River, “Shiusha”, 3414 m a.s.l. 4 Antuyo, 3700 m a.s.l. 5 Antuyo Bajo, 3400 m a.s.l. 6 Hatunpata, 3710 m a.s.l. 7 Trancapampa, 3550 m a.s.l.

Habitats of sp. n. in the PPPF: A type locality in the upper Tarhuish valley at Laguna Udrecocha, Puna at 3936 m a.s.l., 17 May 2012 B upper montane forest at 3550 m a.s.l. where sp. n. was found in moss pads C female sp. n. (MUSM 31980, SVL 21.5 mm) guarding a clutch in a moss pad. Photos by E. Lehr. A female (MUSM 31980, Fig. 8C) guarding 20 eggs was found at Hatunpata inside moss, 3710 m a.s.l., on 28 June 2013. The eggs were pale cream colored and had an average diameter of 3.5 ± 0.1 mm (3.3–3.6 mm, n = 20). The IUCN Red List criteria (IUCN 2001) consider that if a species occurs in fewer than 10 threat-defined locations and the extent of occurrence (EOO) is < 20,000 km2, it should be classified as Vulnerable or Endangered. is known from seven localities distributed in the PPPF and its buffer zone (Fig. 9), with an estimated EOO of 66.54 km2. As such, this new species might be classified as Vulnerable if we take into account these criteria. However, given that the PPPF may host a greater number of locations and most of them are inside the protected area, we propose that should likely be categorized as Near Threatened (NT). Distribution of sp. n. in the PPPF and its surroundings: type locality: Laguna Udrecocha, 3936 m a.s.l.; 1 Upper part of Quebrada Tasta, “Laguna Luichococha”, 3708 m a.s.l. 2 near trail from Tasta to Tarhuish (first mountain peak), forest patch, 3886 m a.s.l. 3 Quebrada Tarhuish, left bank of Antuyo River, “Shiusha”, 3414 m a.s.l. 4 Antuyo, 3700 m a.s.l. 5 Antuyo Bajo, 3400 m a.s.l. 6 Hatunpata, 3710 m a.s.l. 7 Trancapampa, 3550 m a.s.l. Given that the known distribution of overlaps with the PPPF, a substantial portion of the habitat of this species is formally protected. However, other factors such as fungal infections, climate change, pollution, and man-made fires (used to expand grazing areas for livestock) continue to be threats for many Andean amphibians even inside protected areas (Catenazzi and von May 2014).

Discussion

When we encountered the first specimen of in the field both of us were sure that we had found a new species of because of its overall morphological appearance: most species in the genus usually lack tympanum, have narrow digits without circumferential grooves and are distributed at high elevations. However, following an integrative taxonomy approach that included molecular and morphological data, we realized that is not a species. Our analysis also revealed that is not closely related to other species that have narrow digits (e.g., members of the species group), an assumption that could have been made if only morphological data were available. In other words, displays convergence that easily could have led to an incorrect generic assignment. is morphologically most similar to (Mamani and Malqui 2014) and we assume that the latter species might belong to and to the species group. Thus, molecular data are needed to determine whether the current generic placement of is correct. With , seven species of are known from the Puna (> 3000 m a.s.l.) of Peru. Of these, six occur in northern Peru ( [Duellman and Pramuk, 1999], 2963–3330 m a.s.l.; Lehr, Aguilar, Siu-Ting, Jordán, 2007, 1900–3100 m a.s.l.; [Lehr and Duellman, 2007b], 3400–4100 m a.s.l.; Venegas and Duellman, 2012, 3596 m a.s.l.; PageBreak[Duellman and Pramuk, 1999], 3000–3916 m a.s.l.; Venegas and Duellman, 2012, 3596 m a.s.l.), and only one species in central Peru (, 3400–3936 m a.s.l.), Duellman and Lehr 2009. Navarrete et al. (2016) pointed out the disparity in species richness of at high elevation between Ecuador (18 species of ) and Peru (5 species of ). Whilst the Páramo in Ecuador is more humid than the drier Puna in Peru, it is likely that, besides climatic differences between the two regions, the lower species richness of in the Puna of Peru is an artifact of lower survey effort and the presence of other high-elevation clades not present in Ecuador. Thus, we hypothesize that the occurrence of the genus at high elevations (28 species from elevations between 2200–4400 m a.s.l., AmphibiaWeb 2016, Duellman and Lehr 2009) in central Peru might restrict the number of niches available for at high elevations. Additional new species of terrestrial-breeding frogs from montane forests and Puna of the PPPF will be described in the near future.
  18 in total

1.  Phylogeny and classification of poison frogs (Amphibia: dendrobatidae), based on mitochondrial 16S and 12S ribosomal RNA gene sequences.

Authors:  M Vences; J Kosuch; S Lötters; A Widmer; K H Jungfer; J Köhler; M Veith
Journal:  Mol Phylogenet Evol       Date:  2000-04       Impact factor: 4.286

2.  Partitionfinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses.

Authors:  Robert Lanfear; Brett Calcott; Simon Y W Ho; Stephane Guindon
Journal:  Mol Biol Evol       Date:  2012-01-20       Impact factor: 16.240

3.  RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2006-08-23       Impact factor: 6.937

4.  A new species of the Pristimantis orestes group (Amphibia: Strabomantidae) from the high Andes of Ecuador, Reserva Mazar.

Authors:  Juan M Guayasamin; Alejandro F Arteaga
Journal:  Zootaxa       Date:  2013-02-21       Impact factor: 1.091

5.  Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria.

Authors:  José M Padial; Taran Grant; Darrel R Frost
Journal:  Zootaxa       Date:  2014-06-26       Impact factor: 1.091

6.  MAFFT multiple sequence alignment software version 7: improvements in performance and usability.

Authors:  Kazutaka Katoh; Daron M Standley
Journal:  Mol Biol Evol       Date:  2013-01-16       Impact factor: 16.240

7.  A new species of Pristimantis (Amphibia, Anura, Craugastoridae) from the foothills of the Andes in Manu National Park, southeastern Peru.

Authors:  Alexander Shepack; Rudolf von May; Alex Ttito; Alessandro Catenazzi
Journal:  Zookeys       Date:  2016-05-30       Impact factor: 1.546

8.  Two new species of frogs of the genus Pristimantis from Llanganates National Park in Ecuador with comments on the regional diversity of Ecuadorian Pristimantis (Anura, Craugastoridae).

Authors:  María J Navarrete; Pablo J Venegas; Santiago R Ron
Journal:  Zookeys       Date:  2016-05-26       Impact factor: 1.546

9.  A new species of Pristimantis (Amphibia, Anura, Craugastoridae) from a montane forest of the Pui Pui Protected Forest in central Peru (Región Junín).

Authors:  Edgar Lehr; Jiří Moravec
Journal:  Zookeys       Date:  2017-01-12       Impact factor: 1.546

10.  Cryptic diversity and deep divergence in an upper Amazonian leaflitter frog, Eleutherodactylus ockendeni.

Authors:  Kathryn R Elmer; José A Dávila; Stephen C Lougheed
Journal:  BMC Evol Biol       Date:  2007-12-21       Impact factor: 3.260

View more
  3 in total

1.  A new species of Phrynopus (Amphibia, Anura, Craugastoridae) from upper montane forests and high Andean grasslands of the Pui Pui Protected Forest in central Peru.

Authors:  Edgar Lehr; Rudolf von May; Jiří Moravec; Juan Carlos Cusi
Journal:  Zookeys       Date:  2017-11-02       Impact factor: 1.546

2.  Evolutionary radiation of earless frogs in the Andes: molecular phylogenetics and habitat shifts in high-elevation terrestrial breeding frogs.

Authors:  Rudolf von May; Edgar Lehr; Daniel L Rabosky
Journal:  PeerJ       Date:  2018-02-22       Impact factor: 2.984

3.  A new species of Pristimantis (Amphibia, Anura, Strabomantidae) from the Pui Pui Protected Forest (central Peru), with comments on Pristimantis albertus Duellman & Hedges, 2007.

Authors:  Jiří Moravec; Edgar Lehr; Karel Kodejš
Journal:  Zookeys       Date:  2020-11-17       Impact factor: 1.546

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.