Literature DB >> 28777374

High mobility group A1 protein modulates autophagy in cancer cells.

Andrea Conte1, Simona Paladino1,2, Gaia Bianco1, Dominga Fasano1, Raffaele Gerlini1, Mara Tornincasa1, Maurizio Renna3, Alfredo Fusco1, Donatella Tramontano1, Giovanna Maria Pierantoni1.   

Abstract

High Mobility Group A1 (HMGA1) is an architectural chromatin protein whose overexpression is a feature of malignant neoplasias with a causal role in cancer initiation and progression. HMGA1 promotes tumor growth by several mechanisms, including increase of cell proliferation and survival, impairment of DNA repair and induction of chromosome instability. Autophagy is a self-degradative process that, by providing energy sources and removing damaged organelles and misfolded proteins, allows cell survival under stress conditions. On the other hand, hyper-activated autophagy can lead to non-apoptotic programmed cell death. Autophagy deregulation is a common feature of cancer cells in which has a complex role, showing either an oncogenic or tumor suppressor activity, depending on cellular context and tumor stage. Here, we report that depletion of HMGA1 perturbs autophagy by different mechanisms. HMGA1-knockdown increases autophagosome formation by constraining the activity of the mTOR pathway, a major regulator of autophagy, and transcriptionally upregulating the autophagy-initiating kinase Unc-51-like kinase 1 (ULK1). Consistently, functional experiments demonstrate that HMGA1 binds ULK1 promoter region and negatively regulates its transcription. On the other hand, the increase in autophagosomes is not associated to a proportionate increase in their maturation. Overall, the effects of HMGA1 depletion on autophagy are associated to a decrease in cell proliferation and ultimately impact on cancer cells viability. Importantly, silencing of ULK1 prevents the effects of HMGA1-knockdown on cellular proliferation, viability and autophagic activity, highlighting how these effects are, at least in part, mediated by ULK1. Interestingly, this phenomenon is not restricted to skin cancer cells, as similar results have been observed also in HeLa cells silenced for HMGA1. Taken together, these results clearly indicate HMGA1 as a key regulator of the autophagic pathway in cancer cells, thus suggesting a novel mechanism through which HMGA1 can contribute to cancer progression.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28777374      PMCID: PMC5635219          DOI: 10.1038/cdd.2017.117

Source DB:  PubMed          Journal:  Cell Death Differ        ISSN: 1350-9047            Impact factor:   15.828


The High Mobility Group A (HMGA) family includes three proteins: HMGA1a, HMGA1b, (encoded by the same gene through alternative splicing) and HMGA2.[1] These proteins bind the minor groove of AT-rich DNA sequences through three short basic repeats, named ‘AT-hooks’, thereby altering chromatin structure and facilitating the assembly of multiprotein complexes of transcriptional factors, thus regulating the transcription of several genes involved in a wide spectrum of biological processes, such as embryogenesis, cell differentiation, cell cycle, cell migration, apoptosis and cell transformation.[2] The HMGA protein levels are low or absent in normal cells and adult tissues, whereas are abundant during development and in malignant cancers.[1] Indeed, overexpression of HMGA genes represents a constant feature of malignant neoplasias, and their expression levels correlate with metastatic potential, resistance to anti-cancer therapies[3, 4] and reduced survival of cancer patients.[5] The causal role of HMGA proteins in the process of carcinogenesis has been clearly demonstrated as the blockage of their expression prevents neoplastic transformation[6] and leads neoplastic cells to death.[7] Consistently, transgenic mice overexpressing the HMGA genes develop several neoplasias.[8, 9, 10] Although several mechanisms by which HMGA proteins contribute to cancer development have been described so far,[1] other ones, such as autophagy regulation, may be envisaged. In recent years, the study of the intertwined connections between cancer, apoptosis and autophagy has gained increasing interest, also in consideration of the potential translational applications of such discoveries. Autophagy is an intracellular self-digestive process that has a critical role in maintaining energy homeostasis, and its regulation seems to be crucial for cancer initiation and progression. Autophagy involves the formation of autophagosomes, which assemble around and encapsulate damaged organelles, misfolded proteins or cellular debris, and then fuse with lysosomes to degrade their content.[11] Autophagy is essential for long-term survival of mammalian cells, by allowing supply of nutrients under starvation and other stress conditions. Interestingly, disruption of autophagic pathways is associated with multiple diseases, including cancer, in which it can exert either an oncogenic or tumor suppressor activity depending on cellular context and tumor stage.[12] Indeed, many human neoplasias show aberrant autophagy, and its inhibition may contribute to cancer progression. In particular, autophagy inhibition may favor necrotic cell death, exacerbating local inflammation, promoting tumor growth[11] or leading to genomic instability.[13] Moreover, defective autophagy protects cancer cells from autophagic cell death (type II programmed cell death),[14] and resistance to both apoptotic and autophagic cell death can be acquired during cancer progression.[15] Here, we report that depletion of HMGA1 expression dysregulates autophagy in human epidermal squamous carcinoma SCC-13 cells as well as in HeLa cells. This effect appears mediated by autophagy initiation ULK genes,[16] whose expression is transcriptionally increased upon HMGA1-knockdown (KD). Taken together, these data indicate a critical role of HMGA1 in the regulation of autophagy, thus suggesting a novel mechanism by which HMGA1 may contribute to cancer progression.

Results

HMGA1 depletion induces autophagy in skin cancer cells

To investigate the role of HMGA1 proteins in skin cancer cells, HMGA1 expression was silenced by siRNA-transfection in human squamous carcinoma SCC-13 cells (Figures 1a and b). We evaluated the effect of HMGA1-KD on cell proliferation by performing a growth curve assay, observing a strong reduction in the number of HMGA1-interfered cells (HMGA1i) with respect to the scrambled oligonucleotide-transfected cells (Ctli) 48, 72 and 96 h after transfection (Figure 1c). Consistently, HMGA1i cells expressed higher levels of the CDK inhibitors p27Kip1 and p21Cip1 and lower levels of cyclin D1 and cyclin E (Figure 1d). However, we did not find β-galactosidase-positive cells (Supplementary Figure S1), concluding that HMGA1-KD does not induce permanent cell cycle arrest (i.e. senescence) in SCC-13 cells. However, we found that the viability of the HMGA1i cells was significantly lower (~40%) as compared with control cells (Figure 1e). Furthermore, HMGA1-KD does not significantly induce apoptosis in SCC-13 cells, as assessed by measuring the cleavage of two marker proteins of the apoptotic cascade, namely poly (ADP-ribose) polymerase (PARP) and caspase-7 (Figure 1f). Therefore, we investigated whether the reduction of cell viability induced by HMGA1 silencing was due to autophagy activation, which may lead to another type of programmed cell death.[14] A connection between HMGA1 and autophagy regulation has already been suggested by the ability of HMGA1 overexpression to activate the PI3K/AKT signaling pathway,[17] which in turn control the mTORC1, a negative regulator of autophagy.[18] Hence, we analyzed the phosphorylation of AKT and S6 ribosomal protein, two proteins downstream of the mTORC1 pathway, which was reduced in HMGA1i cells (Figure 2a), suggesting that a reduction of HMGA1 expression may trigger the mTOR-dependent activation of the autophagic pathway in skin cancer cells. Subsequently, we evaluated the LC3-I to LC3-II conversion, which occurs during autophagosomes formation.[19] The levels of LC3-II were increased in HMGA1-depleted cells (Figure 2b). We also performed the experiments in the presence of the lysosomal pump inhibitor Bafilomycin A1, which allows one to infer about the rate of LC3-II neosynthesis.[19, 20, 21] Indeed, the levels of LC3-II were higher in HMGA1i cells also in the presence of Bafilomycin A1, suggesting that there was an induction of autophagosomes synthesis. In addition, we analyzed the expression levels of p62/SQSTM1, which is recruited into autophagosomes during their assembly and then degraded inside autolysosomes.[21] Surprisingly, we did observe a modest accumulation of p62/SQSTM1 in HMGA1-depleted cells. Albeit in apparent contradiction with the LC3-II flux analysis, such a phenomenon could be explained by a concomitant reduction of the later stages of autophagic pathway, as previously reported.[19, 22]
Figure 1

HMGA1 depletion impairs proliferation and viability of SCC-13 cells. Control (Ctli) and HMGA1-interfered (HMGA1i) SCC-13 cells were tested for the expression of HMGA1 by qRT-PCR (a) and western blotting (b). Actin was used as loading control. (c) Growth curves of Ctli and HMGA1i SCC-13 cells. Cells were plated as described in ‘Materials and Methods’ and counted at 48, 72 and 96 h. (d) Proteins extracted from Ctli and HMGA1i cells were analyzed by western blotting for Cyclin E, Cyclin D1, p21 and p27 protein levels. Actin was used as loading control. (e) Cell viability assay of Ctli and HMGA1i cells was evaluated as described in ‘Materials and Methods’ section. Bars represent the mean absorbance±S.D. of a representative experiment performed in triplicate. (f) Proteins extracted from Ctli and HMGA1i cells were analyzed by western blotting for PARP and Caspase-7 protein levels. Actin was used as loading control

Figure 2

HMGA1 depletion perturbs autophagic activity. (a) Immunoblot detection of p-AKT (Ser473), total AKT, p-rpS6 and total rpS6 expression levels in Ctli and HMGA1i cells. Actin was used as loading control. (b) Proteins extracted from Ctli and HMGA1i cells untreated or treated with 100 nM Bafilomycin A1 (Bafi) for 6 h were tested for LC3-I>II conversion level and p62/SQSTM1 expression levels by western blotting. Actin was used as loading control. The graphs represent the relative optical density of LC3-II and p62/SQSTM1 normalized to Actin levels (mean±S.D. of three independent experiments). (c–d) Ctli and HMGA1i cells were stained with p62/SQSTM1 and LC3-specific antibodies detected, respectively, with Alexa-488 and Alexa-546 conjugated secondary antibodies (c) or with fluorescent dyes, monodansylcadaverin (MDC) and lysotracker (d), as described in ‘Materials and Methods’. Serial confocal sections were collected. Bars, 10 μm. For each condition, pictures at higher magnification are shown. Bars, 5 μm. Number of puncta per cells in Ctli and HMGA1i cells is shown for p62/SQSTM1. Mean fluorescence intensity (arbitrary unit, a.u.) in Ctli and HMGA1i cells is shown for other markers. In (d) the area occupied by MDC and lysotracker was measured in Ctli and HMGA1i cells. Experiments were performed at least three independent times (n≥50 cells). The statistical analysis has been performed including experiments conducted with both HMGA1-interfering approaches. Error bars, means±S.D.; *P<0.0001

To clarify and further corroborate the above described biochemical data, we assessed the distribution of the autophagy markers p62/SQSTM1 and LC3 by confocal microscopy. We observed a strong increase of p62/SQSTM1- and LC3-positive dots (or puncta) in HMGA1-depleted cells, indicating their recruitment in autophagosomes and autophagolysosomes (Figure 2c). Furthermore, we assessed the effect of HMGA1 silencing on the properties of autophagic compartments. We stained Ctli and HMGA1i cells with monodansylcadaverine (MDC), a fluorescent dye that labels in vivo late-stage autophagosomes, whose staining rises under conditions that increase autophagy.[21, 23, 24] HMGA1 depletion caused an increase in both the number and size of MDC-positive structures with respect to Ctli cells, as well as of lysosomes, labeled with the Lysotracker dye (Figure 2d). Interestingly, a whole drastic expansion (in particular, a three/fourfold increase in the area positive for both markers) of the autophagosomal/lysosomal compartment was observed upon HMGA1 depletion (Figure 2d). Moreover, to test whether HMGA1 depletion closely mimics mTOR inhibition-induced autophagy induction, we performed amino-acid-starvation experiments. As expected, HBSS treatment reduced the activity of mTORC1 pathway (Supplementary Figure S2). However, in terms of autophagic flux we noticed how the overall effects observed in response to HBSS (namely, the increased turnover of p62/SQSTM1 and LC3-II) were remarkably different from the ones observed upon HMGA1 depletion (Figure 2). Finally, to rule out any potential ‘off-target’ effects generated by the siRNA pools employed, we performed the main experiments with a mix of three different siRNA oligonucleotides in SCC-13 cells (HMGA1i§) (Supplementary Figure S3), confirming the aforementioned results. Altogether, these data suggest that HMGA1 regulates autophagy in SCC-13 cells.

Induction of autophagy by the impairment of HMGA1 expression is not restricted to skin cancer cells

As HMGA1 is an architectural transcription factor that activates, recruits to or displaces from specific promoters other transcriptional regulators, its activity strongly depends on the set of proteins concomitantly co-expressed by a particular cell type, therefore its effects may vary on the basis of the cellular context. To verify whether the autophagy increase induced by the HMGA1-KD is not restricted to skin cancer cells, we analyzed the effect of HMGA1 silencing also in human cervix cancer-derived HeLa cells. Indeed, depletion of HMGA1 induces autophagy in HeLa cells, as demonstrated by both western blot and confocal imaging analysis (Figure 3), and the effects of HBSS treatment on autophagic markers are less consistent than those induced by HMGA1-KD (Supplementary Figure S4).
Figure 3

HMGA1 depletion affects autophagy also in HeLa cells. (a) Immunoblot detection of HMGA1, (b) p-rpS6 and total rpS6 expression levels in Ctli and HMGA1i cells. Actin was used as normalization. (c) Proteins extracted from Ctli and HMGA1i cells, untreated or treated with 100 nM Bafilomycin A1 (Bafi) for 6 h, were tested for LC3-I>II conversion and p62/SQSTM1 expression level by western blotting. Actin was used as loading control. (d) Ctli and HMGA1i cells were stained with p62/SQSTM1 and LC3-specific antibodies or with fluorescent dyes, MDC and lysotracker. Serial confocal sections were collected. Bars, 10 μm. Number of puncta per cells in Ctli and HMGA1i cells is shown for p62/SQSTM1. Mean fluorescence intensity (arbitrary unit, a.u.) in Ctli and HMGA1i cells is shown for other markers. Experiments were performed at least three independent times (n≥50 cells). The statistical analysis has been performed including experiments conducted with both HMGA1-interfering approaches. Error bars, means±S.D.; *P<0.00001

To better evaluate the autophagic flux, we used a GFP-mRFP-tandem tagged LC3, which allows to discriminate between early autophagic organelles (GFP and mRFP positive) from acidified autophagolysosomes, which result positive only for mRFP because of higher sensitivity of GFP fluorescence to the acidic lumen of the lysosomal compartment.[23] To this aim, we performed HMGA1-KD in HeLa cells stably transfected with tandem GFP-mRFP-LC3.[25] In agreement with the results obtained by immunofluorescence experiments, we observed that the number of GFP-positive puncta was increased in HMGA1i cells with respect to control cells, or upon HBSS treatment (Figure 4a and Supplementary Figure S5). Strikingly, the puncta extended almost throughout cytosol of HMGA1i cells (occupied area was twofold higher in HMGA1i versus Ctli cells). Furthermore, by quantifying the number of red-only LC3 dots, we found that it is higher in Ctli than in HMGA1i cells, as also evidenced by the higher overlap coefficient (>0.5, graph at right) for GFP and mRFP signals (Figure 4a). Moreover, the fluorescence intensity of red puncta is significantly higher in HMGA1i cells, possibly resulting from homotypic and/or heterotypic fusion events between autophagosomes and lysosomes, respectively. Hence, the number of autophagosomes is increased in HMGA1i cells and such an increase is not mirrored by an equal increase in their maturation. Consistently, in the large majority of HMGA1i cells, p62/SQSTM1-positive structures do accumulate and co-localize with either the lysosomal marker LAMP-1 or LC3 (Figure 4b), confirming that the autophagic flux may be partially delayed in HMGA1-depleted cells. Importantly, the results obtained in HeLa cells strongly suggest that the interplay between HMGA1 and autophagy is not restricted to skin cancer cells.
Figure 4

Effects of HMGA1 depletion on autophagic flux through GFP-mRFP-tandem LC3 analysis. (a) HeLa stably expressing GFP-mRFP-LC3 cells were transfected with siRNAs targeting a scrambled sequence (Ctli) or HMGA1 (HMGA1i), fixed and analyzed by confocal microscopy. Bars, 10 μm. For each condition, pictures at higher magnification are shown. Bars, 5 μm. Quantification of the number of fluorescent puncta exhibiting green (GFP) or red-only fluorescence (obtained by subtracting green dots to the total red dots) is shown (right graphs). The mean fluorescence intensity (arbitrary unit, a.u.) of red puncta, and the percentage of cells exhibiting overlap coefficient lower or higher 0.5 upon the different conditions are shown in the lower graphs. Experiments were performed three independent times (n≥250 cells). Error bars, means±S.D.; *P

HMGA1-negative regulation of ULK1 and ULK2 expression likely accounts for the involvement of HMGA1 in autophagy

The results described above suggest that HMGA1-KD might alter autophagy at different steps. Starting from the observation that Ulk2 was upregulated in Hmga1 knock-out (KO) with respect to wild type (WT) MEFs by microarray analysis (data not shown) and qRT-PCR (fold-change ≈3), we hypothesized that HMGA1 could regulate the expression of the Unc-51-like kinase (ULK) genes, coding for the Ser/Thr kinases belonging to the autophagy-initiating complex.[26] Moreover, also the Ulk2 closely related paralogue Ulk1 was moderately overexpressed in KO versus WT MEFs (fold-change ≈1.9) (Figure 5a). Consistent with this, the mRNA levels of both ULK genes were substantially upregulated upon HMGA1-KD in HeLa and SCC-13 cell lines, as assessed by qRT-PCR analysis (Figure 5a). Interestingly, the fold-change of ULK1 (≈3-4) was higher than that of ULK2 (≈2.5) expression in both cell lines. We also confirmed the upregulation of ULK1 by western blotting analysis (Figure 5b). Moreover, we analyzed the effect of HMGA1 depletion on the phosphorylation of the ULK1 selective substrate ATG13, a critical event for the early step of the phagophore formation.[21] Interestingly, both HMGA1-KD and HBSS treatment (used as positive control) increased the amount of Ser318 phosphorylated-ATG13, despite a concomitant decrease in the total amount of ATG13 (Figure 5c). To verify whether HMGA1 proteins directly bind to ULK1 and ULK2 promoters, we performed chromatin immunoprecipitation (ChIP) assays followed by qRT-PCR. The occupancy of AT-rich sequences of ULK1 and ULK2 promoters by HMGA1 has been detected in the anti-HMGA1-precipitated chromatin from HeLa cells, whereas no amplification was observed in samples immunoprecipitated with rabbit IgG (Figure 5d). Finally, to evaluate the ability of HMGA1 protein to regulate ULK1 and ULK2 promoter activity, we performed luciferase activity assays and demonstrated how HMGA1 depletion increased the transcriptional activity of both ULK1 and ULK2 promoters (Figure 5e). To further verify the ability of HMGA1 to regulate the transcription of ULK1 promoter, we used HEK293 cells, which represent a useful system to study the effects of either depletion or overexpression of HMGA1 protein. As expected, HMGA1 depletion increased ULK1 promoter activity in HEK293 cells, whereas its overexpression significantly reduced it (Figure 5f). Altogether, these data strongly support a critical role of HMGA1 in the negative regulation of ULK genes.
Figure 5

HMGA1 protein regulates ULK1 and ULK2 transcription. (a) RNA extracted from control (Ctli) or HMGA1-interfered (HMGA1i) SCC-13, HeLa cells or from WT and KO MEFs were analyzed by qRT-PCR for ULK1 and ULK2 expression. The actin expression levels have been used for data normalization. Data are mean±S.D. of a representative experiment performed in triplicate. (b) Proteins extracted from Ctli and HMGA1i SCC-13 and HeLa cells were tested for ULK1 expression by western blotting. Tubulin and Vinculin were used as loading control. (c) Proteins extracted from HeLa cells in control conditions (Ctl) or treated with HBSS for 4 h and Ctli and HMGA1i HeLa cells were tested for phosho-Ser318-ATG13 and total ATG13 expression by western blotting. Vinculin was used as loading control. (d) ChIP was performed in HeLa cells. Soluble chromatin was immunoprecipitated with anti-HMGA1 antibodies. The DNAs were amplified by qPCR using primers covering specific regions of human ULK1 and ULK2 promoters (−878/−713 and +129/+352, respectively). IgG were used as negative control of immunoprecipitation. Amplification of the immunoprecipitated DNA using primers for the GAPDH gene promoter was used as control of specificity. Data are mean±S.D. of a representative experiment performed in triplicate. (e) Analysis of ULK1 and ULK2 luciferase-reporter activity in Ctli and HMGA1i HeLa cells. All transfections were performed in triplicate. Data are mean±S.D. of three independent experiments. The same analysis was carried out for ULK1 promoter activity in Ctli and HMGA1i HEK293 cells (f, left panel). Analysis of ULK1 promoter activity was also evaluated in HEK293 cells transiently transfected with empty vector (CV) or 0.8 μg of pcDNA3.1-Hmga1b expression vector (f, right panel). All transfections were performed in triplicate. Data are mean±S.D. of three independent experiments

The effects of HMGA1-KD are prevented by silencing of ULK1

As ULK1 and ULK2 are master regulators of autophagy initiation, we hypothesized that the regulation of their expression may account for the effects on autophagy caused by HMGA1-KD. In particular, we focused on ULK1, the most upregulated in response to HMGA1 depletion in both SCC-13 and HeLa cells. Therefore, HeLa cells were interfered for ULK1 expression using a pool of three specific siRNAs (Figure 6a). We found that ULK1 silencing strongly prevented LC3-I>LC3-II conversion induced by HMGA1 depletion (Figure 6b). Moreover, similarly to the pattern observed in ULK1 silenced cells, in the double KD cells (HMGA1i+ULK1i), the number of p62/SQSTM1-positive puncta was consistently reduced (Figure 6c). Furthermore, in the GFP-mRFP-LC3 stable cell line, ULK1 silencing significantly antagonized the increase in autophagosomes number mediated by HMGA1-KD (Figure 6d). Altogether, these data suggest that HMGA1 regulates autophagy, at least in part, through ULK1.
Figure 6

Effects of HMGA1 silencing in autophagy are mediated by ULK1. Proteins extracted from Ctli, HMGA1i, ULK1i and HMGA1i-ULK1i HeLa cells were tested for the expression of ULK1 and HMGA1 (a) or LC3 (b) by western blotting. Actin was used as loading control. (c) Ctli, HMGA1i, ULK1i and HMGA1i-ULK1i cells were stained with p62/SQSTM1 specific antibody (labeled with FITC-conjugated secondary antibody). Bars, 11 μm. Number of puncta per cells in Ctli and HMGA1i cells is shown. Experiments were performed three independent times (n≥50 cells). (d) HeLa stably expressing GFP-mRFP-LC3 cells were transfected with siRNAs targeting ULK1 (ULK1i) or both HMGA1 and ULK1 (HMGA1i+ULK1i), fixed and analyzed by confocal microscopy. Bars, 10 μm. For each condition, pictures at higher magnification are shown. Bars, 5 μm. Quantification of the number of fluorescent puncta exhibiting green (GFP) (left graph) or red-only fluorescence (obtained by subtracting green dots to the total red dots, middle graph) is reported. The percentage of cells exhibiting overlap coefficient lower or higher 0.5 upon the different conditions is shown (right graph). Experiments were performed three independent times (n≥250 cells). Error bars, means±S.D.; *P

Subsequently, considering that ULK1-dependent cell death has been described in cancer cells in several conditions,[27] we examined whether ULK1 is involved in the suppression of SCC-13 cell number and viability observed in HMGA1-depleted cells (Figure 1). Strikingly, the reduction of viable cells was almost completely prevented by ULK1-KD, therefore suggesting that HMGA1 depletion leads to ULK1-dependent cell death in these cells (Figure 7a). To further investigate the relationship between ULK1 and the cell cycle arrest induced by HMGA1-KD, we performed a colony formation assay. HMGA1i formed less and smaller clones than Ctli cells, and ULK1-KD was able to rescue their clonogenic potential (Figure 7b). To rule out the possibility that the observed effects were mere consequences related to cell cycle arrest, we performed a propidium iodine (PI) exclusion assay, and we found that the percentage of HMGA1i PI-positive cells was consistently higher in comparison with control cells. Interestingly, the ULK1 depletion reduced the effects mediated by the HMGA1-KD, without affecting per se the percentage of PI-positive cells (Figure 7c). Furthermore, we reproduced similar results by using deconvoluted siRNA oligonucleotides against ULK1, ruling out any off-target effect (Supplementary Figure S6). Finally, to test whether the effects of HMGA1-KD on cellular proliferation and viability induced were due to autophagy induction and not to other functions of ULK1-dependent functions, we tested the KD of ATG5, a key component of the autophagic machinery and found that the number of metabolically viable cells was only moderately affected by HMGA1-KD in cells where ATG5 was concomitantly depleted (ATG5i) (Figure 8), therefore reinforcing the concept that the effect of HMGA1 depletion on cell viability is indeed autophagy-dependent. Altogether, these data indicate that depletion of HMGA1 induces a reduction of cell viability and proliferation that require autophagy to be fully enacted.
Figure 7

ULK1 silencing rescues the decrease in cell viability induced by HMGA1 depletion in SCC-13 cells. (a) Cell viability assays of Ctli, HMGA1i, ULK1i and HMGA1i-ULK1i cells were evaluated as described in ‘Materials and Methods’ section. Bars represent the mean absorbance±S.D. of a representative experiment performed in triplicate. (b) Equal numbers of Ctli, HMGA1i, ULK1i and HMGA1i-ULK1i cells were plated 24 h post transfection and then stained with Crystal violet after 10 days of culture. The graph shows the mean±S.D. of the number of colonies formed in three independent experiments. (c) The propidium iodide (PI) exclusion assay using flow cytometry was used to discriminate between live and dead Ctli, HMGA1i, ULK1i and HMGA1i+ULK1i SCC-13 cells 96 h post transfection. A representative experiment is shown

Figure 8

ATG5 silencing reduces the decrease in cell viability induced by HMGA1 depletion in SCC-13 cells. (a) The efficacy of siRNAs directed against ATG5 was tested by western blotting. Actin was used as loading control. The siRNA(s) used to KD ATG5 in ATG5i#1, ATG5i#2, ATG5i#3, ATG5i#4 and ATG5i cells are indicated in ‘Materials and Methods’ section. (b) Proteins extracted from Ctli, HMGA1i, ATG5i and HMGA1i-ATG5i SCC-13 cells were tested for HMGA1 and ATG5 expression by western blotting. Actin was used as loading control. (c) Cell viability assay of Ctli, HMGA1i, ATG5i, HMGA1i-ATG5i, ATG5i#1, HMGA1i-ATG5i#1, ATG5i#2 and HMGA1i-ATG5i#2 cells were evaluated as described in ‘Materials and Methods’ section. Bars represent the mean absorbance±S.D. of a representative experiment performed in triplicate

Discussion

HMGA overexpression is a frequent event in human malignancies, and correlates with cancer progression, high aggressiveness and poor prognosis.[1, 2, 3, 4, 5, 6, 7] HMGA proteins contribute to carcinogenesis by several mechanisms: (a) inactivation of p53-induced apoptosis[28] and regulation of cancer stem cell division;[29] (b) impairment of DNA repair;[3] (c) transcriptional regulation of miRNAs and genes involved in the control of the cell cycle[30, 31] and induction of epithelial-mesenchymal transition;[32, 33] (d) induction of AP-1 activity;[34] (e) induction of chromosome instability.[35, 36] Nevertheless, it is general opinion that HMGA1 exerts its oncogenic activity also by other unidentified mechanisms. Here, we demonstrate that HMGA1 expression has a key role in autophagy regulation. Indeed, HMGA1 silencing induces a ‘dual effect’ on the autophagic pathway associated to a decrease in cellular proliferation and viability in human epidermal squamous SCC-13 cells and uterine cervix HeLa cancer cells. HMGA1-depleted cells show typical features of increased autophagy, including reduced phosphorylation of AKT and ribosomal S6 proteins, increased rate of LC3-II conjugation, and re-distribution of LC3 and p62/SQSTM1 to both autophagosomes and autophagolysosomes (Figures 2 and 3). Nevertheless, by using a range of assays, we have shown how such an increase in autophagosomes formation is not mirrored by an equal increase in their maturation, with a consequent reduction of the autophagic flux. The observed increase in LC3-II levels is consistent with this dual effect of HMGA1 depletion on the autophagic pathway. In fact, an increase in levels of LC3-II can have different possible causes: increased autophagosome formation, a block or delay in autophagosome maturation, or both. Such a dual effect is very similar to that induced by the depletion of Sly1, whose effects on both LC3-II levels and GFP-mRFP-LC3 distribution are superimposable to those caused by depletion of HMGA1.[22] A similar detrimental effect on the autophagic flux has been reported also for some dual PI3K/mTOR inhibitors (DKI), which are canonically considered to be autophagy activators and currently under study for the potential treatment of several types of cancers. Indeed, DKIs such as PI-103 and NVP-BEZ-235 strongly compromise autophagic flux, by concomitantly inhibiting the class-III PI3K Vps34, which in turn causes the blockade to autophagosome–lysosome fusion.[37] In such a scenario, the autophagy perturbation exerted by these molecules may ultimately contribute to cell death in a way similar to the one we propose here for the HMGA1 depletion. Furthermore, the evaluation of MDC/Lysotracker staining indicates that the loss of HMGA1 appears to impair the structure (i.e. numbers and/or size) of the lysosomal compartment, which is suggestive of an altered autophagosome–lysosome fusion. As such, this could also explain the negative effect on the activity of the mTOR pathway[38] observed in HMGA1-depleted cells. Moreover, the increase in autophagosomes formation induced by HMGA1 depletion, augmenting the ratio between autophagosomes and lysosomes, may favor the fusion of several autophagosomes with one lysosome, as suggested by the increase in the fluorescence intensity of red dots found in HMGA1-depleted cells using the GFP-mRFP-LC3 reporter assay. This may partially compensate the decrease in red-only dots and contribute to explain the autolysosomal degradative capacity shown by HMGA1i cells. The observed delay of the autophagic flux is not so surprising. In fact, HMGA1 may not be involved in the regulation of the late stages of autophagy, differently from other transcription factors, such as TFEB and ZKSCAN3.[39] In fact, our data does not necessarily imply that HMGA1 depletion impairs or decreases lysosomal capacity per se, rather that the increase in autophagosomes formation induced by HMGA1 depletion is not associated to a proportionate increase in autophagosomes maturation and lysosomal capacity sufficient to guarantee an appropriate turnover of autophagosomes. Consistently with this hypothesis, we performed a fluorogenic assay to measure Cathepsin L, which infers about the activity of the lysosomal acidic hydrolases, and we found no significative difference between Ctli and HMGA1i HeLa cells (data not shown), indicating that HMGA1 depletion does not alter the activity of the lysosomal compartment. Nevertheless, the effect of HMGA1-KD on autophagy eventually results in a decrease in cellular proliferation and viability, as strongly indicated by the autophagy inhibition experiments (namely, ULK1- and ATG5-KD). Interestingly, autophagic cell death is usually associated to a delay/block of the autophagic flux owing to saturation of the degradative capacity of lysosomes, rather than death mediated by autophagy.[40] We can hypothesize that also in our conditions the overall effect in terms of cell viability might be due, at least in part, to the impaired turnover of autophagosomes. The differences we have observed in basal levels of autophagy (higher in SCC-13 than in HeLa cells) might explain the minor differences and only apparent discrepancies (in particular, the effect on p62/SQSTM1 levels and autophagosomes accumulation) between the two cell lines. In addition, as p62/SQSTM1 is an oxidative stress-inducible protein,[41] the observed changes could be also consequent to other mechanisms, rather than to its autophagy-dependent turnover. Noteworthy, we have confirmed how a prolonged serum and amino-acid starvation (HBSS for 4 h) can paradoxically reduce LC3-II protein levels in SCC-13 cells, while it increases the number of LC3- and p62-positive puncta (Supplementary Figure S2). Hence, an increased number of autolysosomes, which correlates with the enhanced starvation-induced flux of LC3 to lysosomes, can be indeed reflected by reduced LC3-II levels as a direct consequence of the fractional amount of LC3-II (or p62/SQSTM1) degraded upon delivery to the lysosomal compartment.[42, 43] Other studies have suggested a possible interplay between HMGA proteins and autophagy. Indeed, HMGA1 overexpression activates the (PI3K)/AKT and mTORC1 signaling pathways[17, 18] and positively regulates the transcription of the glucose transporter SLC2A3/GLUT3 gene, thus increasing glucose uptake and ATP levels leading to AMPK inactivation with the consequent inhibition of autophagy.[44] Furthermore, also HMGB1 protein, a member of other HMG subfamily, has been demonstrated to act as a pro-autophagic protein.[45] Here, we provide further evidence that HMGA1 proteins are involved in autophagy by regulating ULK1 transcriptional activity. Indeed, the ULK1 gene is upregulated upon HMGA1 depletion in both HeLa and SCC-13 cells (Figure 5). In consideration of the role exerted by ULK1 in the early steps of autophagosome biogenesis, its upregulation is coherent with the increased rate of autophagosomes synthesis observed upon HMGA1 depletion. In addition, the fact that ULK1 silencing significantly prevents the effects of HMGA1-KD on autophagic pathway (Figures 6 and 7) strongly support that the HMGA1 effects on this pathway are, at least in part, directly mediated by ULK1 protein. Considering that several HMGA1 interactors, such as p53 and NF-κB, are involved in transcriptional and post-transcriptional regulation of autophagy,[39] the role of HMGA1 in the modulation of ULK genes expression may depend on these interactions and on the cellular context. In particular, as HMGA proteins impairs p53-mediated regulation of apoptotic genes[46] and p53 positively regulates ULK1 expression,[47] it is conceivable to speculate that HMGA1 and p53 could regulate the expression of the same autophagy-related genes in an opposite way, as already described for apoptosis-related genes.[28] Moreover, resistance to autophagic cell death has also been correlated to other cellular processes in which HMGA1 proteins are involved, such as chromosomal instability and impairment of DNA repair.[3, 13, 48] Therefore, the possibility that HMGA1 would enhance the survival of cancer cell and, thereby, cancer progression by inhibiting, at the same time, autophagy and apoptosis, can be envisaged. Furthermore, the ULK1-KD seems to be more effective than ATG5-KD in preventing the effects on cell viability induced by depletion of HMGA1. Hence, some additional ULK1-downstream effectors may be involved in the regulation of the entire phenomenon in an autophagy-independent manner. Indeed, ULK1 is able to exerts an autophagy-independent pro-death role in response to ROS-induced damage through PARP[49] and to contribute to cellular homeostasis by regulating ER-to-Golgi trafficking.[50] The role of autophagy in cancer is not completely understood, as it strongly depends on cellular context and tumor stage. Autophagy may be oncogenic allowing the survival of cancer cells by providing new energy sources under stress conditions, but it may also represent a mechanism of tumor suppression, reducing oxidative stress, activating the DNA damaging response, preventing inflammation, genomic instability and ultimately inducing cell death.[13, 51] Notably, both autophagy impairment and resistance to autophagic cell death are features frequently acquired during cancer progression accounting, along with resistance to apoptosis, for enhanced cancer cell survival and chemoresistance.[52] Although further investigation is needed to define the influence of HMGA1-mediated autophagy on the biology of cancer cells, one can speculate that autophagy modulation could be another way by which HMGA1 regulates cell survival and genomic stability, consistent with its pro-survival activity and its role in the development of chemoresistance. In conclusion, the data reported here imply that HMGA1 overexpression inhibits autophagy by, at least in part, negatively regulating the expression of ULK1 gene. The roles of ULK1 in disease pathogenesis are still poorly understood and often controversial. Nevertheless, alterations in ULK/ATG1 expression and autophagy-related functions have been implicated in the prognosis of some cancers.[53] The one described here represents a novel mechanism by which HMGA overexpression would enhance survival of cancer cells and contribute to cancer progression, further supporting the need of innovative antineoplastic therapies based on the selective inactivation of HMGA1/ULK1 functions, rather than on the more general autophagy inhibitors and activators.

Materials and methods

Cell cultures

HeLa cells were grown in RPMI supplemented with 10% FBS, L-glutamine, and antibiotics (Invitrogen, Carlsbad, CA, USA). Human epidermal squamous carcinoma SCC-13 cell line was kindly provided by Rheinwald JG.[54] Cells were cultured in keratinocyte serum-free medium (KSFM, Invitrogen) with 25 mg/ml bovine pituitary extract, penicillin, streptomycin, 0.2 ng/ml epidermal growth factor, and CaCl2 to a final Ca2+ concentration of 0.4 mmol/l. To maintain healthy confluent cultures, after cultures reached 40% confluence, they were re-fed daily with 1:1 medium (1:1 vol/vol Ca2+-free DMEM/KSFM, supplemented as above described). HEK293 cells were cultured in DMEM with 10% FBS, l-glutamine, and antibiotics (Invitrogen). Bafilomycin A1 (B1793) has been purchased from Sigma-Aldrich (Saint Louis, MO, USA). HBSS buffer (#14025092) has been purchased from Gibco (Waltham, MA, USA).

Transfections and plasmids

Cells were transfected with plasmids by Lipofectamine plus reagent (Invitrogen) according to the manufacturer’s instructions. Cells were transiently transfected with pcDNA3.1-Hmga1b.[55] Luciferase activity was analysed by LightSwitch Luciferase Assay kit (Switch Gear Genomics, Carlsbad, CA, USA), according to manifacturer’s instructions. ULK1-luc (cod. SKU:S707592) and ULK2-luc (cod. SKU:S709931) plasmids were from Switch Gear Genomics. HeLa cells stably expressing GFP-mRFP-LC3 were a kind gift of D. Rubinzstein (Cambridge Institute for Medical Research).[25]

RNA interference, RNA extraction and quantitative real-time PCR (qRT-PCR)

RNA interference was obtained using Lipofectamine RNAiMAX (Invitrogen) as previously described[37] with the following specific siRNAs: HMGA1i: Hs_HMGA1_5 (SI02662023) (Sense strand GGACAAGGCUAACAUCCCATT and Antisense strand UGGGAUGUUAGCCUUGUCCAG) (Qiagen, Hilden, Germany) HMGA1i§: Stealth siRNAs (Set of 3) HSS142459, HSS142460, HSS142461, Cat. #1299001, (Life Technologies-Invitrogen) ULK1i: Stealth siRNAs (Set of 3) HSS140824, HSS140825, HSS141051, Cat. #1299001, (Life Technologies-Invitrogen) ULK1i#1: single Stealth siRNA HSS140824 (Life Technologies-Invitrogen) ULK1i#2: single Stealth siRNA HSS140825 (Life Technologies-Invitrogen) ULK1i#3: single Stealth siRNA HSS141051 (Life Technologies-Invitrogen) ATG5i: Set of 4: siGENOME ATG5 siRNA, M-004374-04 (Dharmacon, LA, USA) ATG5i#1: deconvoluted siRNA J-004374-07 (Dharmacon, LA, USA) ATG5i#2: deconvoluted siRNA J-004374-08 (Dharmacon, LA, USA) ATG5i#3: deconvoluted siRNA J-004374-09 (Dharmacon, LA, USA) ATG5i#4: deconvoluted siRNA J-004374-10 (Dharmacon, LA, USA) As negative control, Qiagen AllStars control (SI03650318) was used. Cells were transduced with 25 nM of siRNA using RNAiMAX reagent (Invitrogen) according to the manufacturer's instructions and analyzed after 48, 72 and 96 h. Total RNA was isolated as previously described.[56] qRT-PCR analysis was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) with following primer sequences: humanHMGA1-Fw 5′-CAACTCCAGGAAGGAAACCA-3′ humanHMGA1-Re 5′-AGGACTCCTGCGAGATGC-3′ humanULK1-Fw 5′-CAGACAGCCTGATGTGCAGT-3′ humanULK1-Re 5′-CAGGGTGGGGATGGAGAT-3′ humanULK2-Fw 5′-TTTAAATACAGAACGACCAATGGA-3′ humanULK2-Re 5′-GGAGGTGCCAGAACACCA-3′ humanACTIN-Fw 5′-CCAACCGCGAGAAGATGA-3′ humanACTIN-Re 5′-CCAGAGGCGTACAGGGATAG-3′ mouseUlk1-Fw 5′-GGATCCATGGTGTCACTGC-3′ mouseUlk1-Re 5′-CAAGGGCAGCTGATTGTACC-3′ mouseUlk2-Fw 5′-CACCATCTTGTCGCTTTGC-3′ mouseUlk2-Re 5′-GGATAAGTTTTCTTCCTGAATATGCT-3′ mouseActin-Fw 5′-CTAAGGCCAACCGTGAAAAG-3′ mouseActin-Re 5′-ACCAGAGGCATACAGGGACA-3′

Growth curve and cell viability assay

SCC-13 cells were seeded in six-well plates, interfered and transfected as above described. Ctli and HMGA1i cells were counted after 48, 72 and 96 h as described in.[57] Cell viability of cells was quantified by MTS (3-(4,5 dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl)-2H-tetrazolium) assay (Promega's CellTiter 96 AQueous One Solution, Promega Fitchburg, WI, USA). Cells were seeded in 96-well plates at 5 × 103 cells per well, then interfered and transfected as above described. After 72 h, absorbance was measured at 490 nm.

β-Galactosidase staining

β-Galactosidase staining was performed using Senescence Cells Histochemical Staining Kit (CS0030, Sigma-Aldrich) kit (Sigma-Aldrich) according to the manufacturer’s instructions 6 days after transfection. Over/night treatment with 400 μM H2O2 was used as a positive control. Cells have been observed with Axiovert 25 and photographed with Canon GC5 (final magnification × 40).

Colony assay

To perform the colony assays, the cells were transfected with siRNAs as described before. After 24 h of transfection, the cells were trypsinized, counted and re-plated in equal numbers. After 10 days of culture, the cells were fixed in methanol for 10 min, stained with Crystal Violet (C3886, Sigma-Aldrich) for 25 min, washed several times with water, and then photographed.

PI exclusion assay

For the determination of cell viability, cells were analyzed 96 h after trasfection with a FACS Calibur cytofluorimeter using CellQuest software (BD Biosciences, Mississauga, ON, Canada), following addition of a Propidium Iodide solution at a final concentration of 1 μg/ml.

Western blotting and antibodies

Protein extraction and western blotting were performed as described elsewhere.[58] Antibodies directed against HMGA1 proteins were already described.[59] Commercial antibodies were: anti-pSer473-AKT (#9271), anti-AKT (#9272), anti-Caspase-7 (#9492), anti-phospho S6 ribosomal protein (Ser240/244) (D68F8, #5364), anti-S6 ribosomal protein (54D2, #2317S), anti-LC3A/B (#4108), anti-PARP (46D11, #9532), anti-ATG5 (D5F5U, #12994) and anti-ULK1 (R600, #4773) antibodies from Cell Signaling Technology (MA, USA); anti-β-Actin (I-19, sc-1616), anti-β-Tubulin (D-10, sc-5274), anti-p21 (C-19, sc-397), anti-Cyclin D1 (A12, sc-8396), anti-Cyclin E (E20, sc-481), and anti-Vinculin (N-19, sc-7649) were from Santa Cruz Biotechnology (Dallas, TX, USA); anti-p27 (610241) and anti-p62/SQSTM1 (610833) were from BD Biosciences (Franklin Lakes, NJ USA); anti-phospho ATG13 (Ser318) (PAB19948) was from Abnova (Taipei City,Taiwan); anti-ATG13 (SAB4200100) was from Sigma-Aldrich. ECL System was purchased from Amersham Pharmacia (Buckinghamshire, UK).

ChIP assay

After transfection, cells have been treated with formaldehyde 1%, washed and then lysed isolating the nuclei. Then the nuclei have been in turn lysed and chromatin has been sonicated. Then, samples have been processed and immunoprecipitated using anti-HMGA1 antibody[28] or normal rabbit IgG as negative control. For PCR analysis, 2 μl out of 150 μl immunoprecipitated DNA was used with primers described below. GAPDH promoter amplicon was used as negative control in all the experiments. Input DNA was used as positive control. Primers used were: ULK1-prom-Fw 5′-TGCCCTGTTCCATATTTTGC-3′ ULK1-prom-Re 5′-ACCCAAACCAACGACATAGC-3′ ULK2-prom-Fw 5′-AGCTGGGGATGGAGAGTACC-3′ ULK2-prom-Re 5′-AGAGACCGGAGCGGAAACT-3′ GAPDH-prom-Fw 5′-CCCAAAGTCCTCCTGTTTCA-3′ GAPDH-prom-Re 5′-GTCTTGAGGCCTGAGCTACG-3′

Fluorescence microscopy

Lysotracker Probe (Molecular Probes, Eugene, OR, USA) and MDC (50 μM, Sigma) were used to label lysosomes and autophagosomes, respectively. In brief, cells grown on coverslips were incubated with Lysotracker Probe for 1 h at 37 °C before fixation (4% PFA). Cells grown on bottom-glass dishes were incubated with MDC in PBS for 10 min at 37 °C and imaged in vivo in PBS. Cells stained with LC3 antibody (0231-100/LC3-5F10, nanoTools, Teningen, Germany) were fixed with methanol, quenched with 0.2% BSA/10% FBS in PBS for 30 min and permeabilized with 0.2% TX-100 for 7 min. Cells stained with p62/SQSTM1 antibody (GP62-C, Progen, Heidelberg, Germany) and Lamp-1 (#555798, BD Biosciences Pharmingen, San Diego, CA, USA) were fixed in PFA 4% and then processed as above. Primary antibodies were detected with TRITC (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) or Alexa-488 or -546 (Life Technologies, Camarillo, CA, USA) conjugated secondary antibodies. Images were collected using a laser scanning microscope (LSM 510 META, Carl Zeiss Microimaging, Inc., Thornwood, NY, USA) equipped with a Plan Apo 63 × oil-immersion (NA 1.4) objective lens. Quantification, morphometric analyses and co-localization analysis were carried out using LSM 510 software as previously described.[60] The mean fluorescence intensities in selected regions of interest of equal size were measured. For the quantification we acquired the images, for each fluorophore, with the same setting (laser power, detector gain) as well as we kept the same threshold of fluorescence intensity in all experimental conditions (control and silenced cells). We evaluated the size of phagosomal or lysosomal compartments measuring the area occupied from each organelle marker that takes in account both the number and the dimension of these compartments. For GFP-mRFP-LC3 assay, we counted the fluorescent puncta exhibiting green (GFP) or red (mRFP) fluorescence. The number of red-only puncta was obtained by subtracting green dots to the total red dots. The green-only puncta were excluded by quantitative analysis.

Statistical analysis

Student’s t-test was used to determine the significance for all the quantitative experiments. Error bars represent the S.D. of the average.
  60 in total

1.  Architectural transcription factor HMGI(Y) promotes tumor progression and mesenchymal transition of human epithelial cells.

Authors:  R Reeves; D D Edberg; Y Li
Journal:  Mol Cell Biol       Date:  2001-01       Impact factor: 4.272

2.  Transgenic mice overexpressing the wild-type form of the HMGA1 gene develop mixed growth hormone/prolactin cell pituitary adenomas and natural killer cell lymphomas.

Authors:  Monica Fedele; Francesca Pentimalli; Gustavo Baldassarre; Sabrina Battista; Andres J P Klein-Szanto; Lawrence Kenyon; Rosa Visone; Ivana De Martino; Andrea Ciarmiello; Claudio Arra; Giuseppe Viglietto; Carlo M Croce; Alfredo Fusco
Journal:  Oncogene       Date:  2005-05-12       Impact factor: 9.867

3.  Adenovirus-mediated suppression of HMGI(Y) protein synthesis as potential therapy of human malignant neoplasias.

Authors:  S Scala; G Portella; M Fedele; G Chiappetta; A Fusco
Journal:  Proc Natl Acad Sci U S A       Date:  2000-04-11       Impact factor: 11.205

4.  A truncated HMGA1 gene induces proliferation of the 3T3-L1 pre-adipocytic cells: a model of human lipomas.

Authors:  Giovanna Maria Pierantoni; Sabrina Battista; Francesca Pentimalli; Monica Fedele; Rosa Visone; Antonella Federico; Massimo Santoro; Giuseppe Viglietto; Alfredo Fusco
Journal:  Carcinogenesis       Date:  2003-09-11       Impact factor: 4.944

5.  High-mobility group A1 proteins are overexpressed in human leukaemias.

Authors:  Giovanna Maria Pierantoni; Valter Agosti; Monica Fedele; Heather Bond; Irene Caliendo; Gennaro Chiappetta; Francesco Lo Coco; Fabrizio Pane; Maria Caterina Turco; Giovanni Morrone; Salvatore Venuta; Alfredo Fusco
Journal:  Biochem J       Date:  2003-05-15       Impact factor: 3.857

Review 6.  Autophagy as a cell death and tumor suppressor mechanism.

Authors:  Devrim Gozuacik; Adi Kimchi
Journal:  Oncogene       Date:  2004-04-12       Impact factor: 9.867

7.  Thyroid cell transformation requires the expression of the HMGA1 proteins.

Authors:  Maria Teresa Berlingieri; Giovanna M Pierantoni; Vincenzo Giancotti; Massimo Santoro; Alfredo Fusco
Journal:  Oncogene       Date:  2002-05-02       Impact factor: 9.867

8.  The HMG-I oncogene causes highly penetrant, aggressive lymphoid malignancy in transgenic mice and is overexpressed in human leukemia.

Authors:  Yi Xu; Takita Felder Sumter; Raka Bhattacharya; Abeba Tesfaye; Ephraim J Fuchs; Lisa J Wood; David L Huso; Linda M S Resar
Journal:  Cancer Res       Date:  2004-05-15       Impact factor: 12.701

9.  Transcriptional activation of the cyclin A gene by the architectural transcription factor HMGA2.

Authors:  Michela A Tessari; Monica Gostissa; Sandro Altamura; Riccardo Sgarra; Alessandra Rustighi; Clio Salvagno; Giuseppina Caretti; Carol Imbriano; Roberto Mantovani; Giannino Del Sal; Vincenzo Giancotti; Guidalberto Manfioletti
Journal:  Mol Cell Biol       Date:  2003-12       Impact factor: 4.272

10.  A novel assay to study autophagy: regulation of autophagosome vacuole size by amino acid deprivation.

Authors:  D B Munafó; M I Colombo
Journal:  J Cell Sci       Date:  2001-10       Impact factor: 5.285

View more
  20 in total

Review 1.  High Mobility Group A1 (HMGA1): Structure, Biological Function, and Therapeutic Potential.

Authors:  Lu Wang; Ji Zhang; Min Xia; Chang Liu; Xuyu Zu; Jing Zhong
Journal:  Int J Biol Sci       Date:  2022-07-04       Impact factor: 10.750

2.  MicroRNA-296-5p inhibits cell proliferation by targeting HMGA1 in colorectal cancer.

Authors:  Guohui Yan; Shuidi Yan; Jiajia Wang; Shen Lei; Weimin Tian; Xin Yue; Yang Zhang
Journal:  Exp Ther Med       Date:  2021-05-24       Impact factor: 2.447

Review 3.  Molecular mechanisms of cell death: recommendations of the Nomenclature Committee on Cell Death 2018.

Authors:  Lorenzo Galluzzi; Ilio Vitale; Stuart A Aaronson; John M Abrams; Dieter Adam; Patrizia Agostinis; Emad S Alnemri; Lucia Altucci; Ivano Amelio; David W Andrews; Margherita Annicchiarico-Petruzzelli; Alexey V Antonov; Eli Arama; Eric H Baehrecke; Nickolai A Barlev; Nicolas G Bazan; Francesca Bernassola; Mathieu J M Bertrand; Katiuscia Bianchi; Mikhail V Blagosklonny; Klas Blomgren; Christoph Borner; Patricia Boya; Catherine Brenner; Michelangelo Campanella; Eleonora Candi; Didac Carmona-Gutierrez; Francesco Cecconi; Francis K-M Chan; Navdeep S Chandel; Emily H Cheng; Jerry E Chipuk; John A Cidlowski; Aaron Ciechanover; Gerald M Cohen; Marcus Conrad; Juan R Cubillos-Ruiz; Peter E Czabotar; Vincenzo D'Angiolella; Ted M Dawson; Valina L Dawson; Vincenzo De Laurenzi; Ruggero De Maria; Klaus-Michael Debatin; Ralph J DeBerardinis; Mohanish Deshmukh; Nicola Di Daniele; Francesco Di Virgilio; Vishva M Dixit; Scott J Dixon; Colin S Duckett; Brian D Dynlacht; Wafik S El-Deiry; John W Elrod; Gian Maria Fimia; Simone Fulda; Ana J García-Sáez; Abhishek D Garg; Carmen Garrido; Evripidis Gavathiotis; Pierre Golstein; Eyal Gottlieb; Douglas R Green; Lloyd A Greene; Hinrich Gronemeyer; Atan Gross; Gyorgy Hajnoczky; J Marie Hardwick; Isaac S Harris; Michael O Hengartner; Claudio Hetz; Hidenori Ichijo; Marja Jäättelä; Bertrand Joseph; Philipp J Jost; Philippe P Juin; William J Kaiser; Michael Karin; Thomas Kaufmann; Oliver Kepp; Adi Kimchi; Richard N Kitsis; Daniel J Klionsky; Richard A Knight; Sharad Kumar; Sam W Lee; John J Lemasters; Beth Levine; Andreas Linkermann; Stuart A Lipton; Richard A Lockshin; Carlos López-Otín; Scott W Lowe; Tom Luedde; Enrico Lugli; Marion MacFarlane; Frank Madeo; Michal Malewicz; Walter Malorni; Gwenola Manic; Jean-Christophe Marine; Seamus J Martin; Jean-Claude Martinou; Jan Paul Medema; Patrick Mehlen; Pascal Meier; Sonia Melino; Edward A Miao; Jeffery D Molkentin; Ute M Moll; Cristina Muñoz-Pinedo; Shigekazu Nagata; Gabriel Nuñez; Andrew Oberst; Moshe Oren; Michael Overholtzer; Michele Pagano; Theocharis Panaretakis; Manolis Pasparakis; Josef M Penninger; David M Pereira; Shazib Pervaiz; Marcus E Peter; Mauro Piacentini; Paolo Pinton; Jochen H M Prehn; Hamsa Puthalakath; Gabriel A Rabinovich; Markus Rehm; Rosario Rizzuto; Cecilia M P Rodrigues; David C Rubinsztein; Thomas Rudel; Kevin M Ryan; Emre Sayan; Luca Scorrano; Feng Shao; Yufang Shi; John Silke; Hans-Uwe Simon; Antonella Sistigu; Brent R Stockwell; Andreas Strasser; Gyorgy Szabadkai; Stephen W G Tait; Daolin Tang; Nektarios Tavernarakis; Andrew Thorburn; Yoshihide Tsujimoto; Boris Turk; Tom Vanden Berghe; Peter Vandenabeele; Matthew G Vander Heiden; Andreas Villunger; Herbert W Virgin; Karen H Vousden; Domagoj Vucic; Erwin F Wagner; Henning Walczak; David Wallach; Ying Wang; James A Wells; Will Wood; Junying Yuan; Zahra Zakeri; Boris Zhivotovsky; Laurence Zitvogel; Gerry Melino; Guido Kroemer
Journal:  Cell Death Differ       Date:  2018-01-23       Impact factor: 12.067

4.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 5.  Critical role of the high mobility group A proteins in hematological malignancies.

Authors:  Marco De Martino; Francesco Esposito; Alfredo Fusco
Journal:  Hematol Oncol       Date:  2021-10-12       Impact factor: 4.850

6.  Downregulation of HMGA1 Mediates Autophagy and Inhibits Migration and Invasion in Bladder Cancer via miRNA-221/TP53INP1/p-ERK Axis.

Authors:  Xiaoqiang Liu; Zhengtao Zhou; Yibing Wang; Ke Zhu; Wen Deng; Yulei Li; Xiaochen Zhou; Luyao Chen; Yu Li; An Xie; Tao Zeng; Gongxian Wang; Bin Fu
Journal:  Front Oncol       Date:  2020-05-12       Impact factor: 6.244

7.  let-7i inhibits proliferation and migration of bladder cancer cells by targeting HMGA1.

Authors:  M-M Qin; X Chai; H-B Huang; G Feng; X-N Li; J Zhang; R Zheng; X-C Liu; C Pu
Journal:  BMC Urol       Date:  2019-06-13       Impact factor: 2.264

8.  Silencing H19 regulated proliferation, invasion, and autophagy in the placenta by targeting miR-18a-5p.

Authors:  Lei Zhang; Xinru Deng; Xian Shi; Xiaojing Dong
Journal:  J Cell Biochem       Date:  2018-12-09       Impact factor: 4.429

9.  Anti-Apoptotic and Anti-Oxidant Proteins in Glioblastomas: Immunohistochemical Expression of Beclin and DJ-1 and Its Correlation with Prognosis.

Authors:  Elia Guadagno; Giorgio Borrelli; Sara Pignatiello; Annalidia Donato; Ivan Presta; Biagio Arcidiacono; Natalia Malara; Domenico Solari; Teresa Somma; Paolo Cappabianca; Giuseppe Donato; Marialaura Del Basso De Caro
Journal:  Int J Mol Sci       Date:  2019-08-20       Impact factor: 5.923

10.  RNA binding protein HuR promotes osteosarcoma cell progression via suppressing the miR-142-3p/HMGA1 axis.

Authors:  Weicheng Pan; Jinhui Pang; Bin Ji; Zhen Wang; Chengwei Liu; Yan Cheng; Lei Zhang
Journal:  Oncol Lett       Date:  2018-05-31       Impact factor: 2.967

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.