A new species group in the genus Dichaetophora, with descriptions of six new species from the Oriental region (Diptera, Drosophilidae).

The genus Dichaetophora Duda comprises 61 described species classified into four species groups: agbo, tenuicauda, acutissima and sinensis. This genus is distributed exclusively in the Old World, and is rich in species in the tropical and subtropical areas of the Oriental, Australasian, and Afrotropical regions. In this paper, a new species group, the trilobita group, is established for six new species discovered from the Oriental region. The delimitation of these species is firstly performed in light of morphology and further with the aid of DNA sequences of the mitochondrial COI and COII (cytochrome c oxydase, subunits I and II, respectively) genes, considering also their respective geographical origins. Then, the new species (trilobita Yang & Gao, sp. n., heterochroma Yang & Gao, sp. n., flatosternata Yang & Gao, sp. n., borneoensis Yang & Gao, sp. n., javaensis Yang & Gao, sp. n., and sumatraensis Yang & Gao, sp. n.) are described, and a key, based on not only morphological but also molecular information, is provided.

Introduction

The genus is widely distributed in the Old World, especially its tropical and subtropical regions. This genus was originally established by Duda (1940) as a subgenus in the genus Fallén, for the Seychellean species, Lamb. Burla (1954) supplemented three African new species (including an informally named one) into and revised its diagnostic characters. Since then, the species composition of this subgenus [genus since Grimaldi’s (1990) upgrading] had been altered time and again in relation to the genus Wheeler & Takada (see Hu and Toda 2002). Hu and Toda (2002) examined the relationships among the genera , , the species group and some presumably related genera by a cladistic analysis of morphological characters. As a result, the revised and enlarged genus was proposed and subdivided into three species groups, i.e., the agbo, acutissima and groups. Hu and Toda (2005) established the forth (sinensis) species group for four species newly described from China, raising the number of known species to 61. In the present study, a new species group is established for six new species of recently discovered from the Oriental region, the group. The species delimitation is based on not only morphological but also geographical and DNA sequence data. A key to the six species is provided.

Materials and methods

Specimens

A summary of the specimens employed in the present study is shown in Table 1. The flies were mostly captured by net sweeping on herbs growing along watersides in open forests or at forest edges. Specimens were preserved in either 70% (after fixing with Kahle’s solution for morphological observation) or 100% ethanol (for DNA sequencing).

Table 1.

Summary of new species and specimens of employed in the present study.

Code of morpho-species	Formal name	Voucher # a	Distribution / collection site	Collection date
sp.K1	trilobita sp. n.	#03876 (♂)	Park Headquarters, Mt. Kinabalu, Sabah, Malaysia	11.iii.2008
		#03877–8 (♂, ♀)	Ulu Gombak, Selangor, Malaysia	8.xii.2013
		#03882 (♀)	Poring, Mt. Kinabalu, Sabah, Malaysia	20.iii.2008
		unnumbered (1♂, 1♀)	Kubah, Sarawak, Malaysia	19.i.1999
sp.K2	heterochroma sp. n.	#03879–81 (2♂, 1♀), (1♂)	Poring, Mt. Kinabalu, Sabah, Malaysia	20.iii.2008
		#03883 (♀)	Poring, Mt. Kinabalu, Sabah, Malaysia	13.iii.2008
		#03884–6 (1♂, 2♀)	Ulu Senagang, Crocker Range, Sabah, Malaysia	18.x.1999
		unnumbered (1♂)	Poring, Mt. Kinabalu, Sabah, Malaysia	19.iii.2008
		unnumbered (1♂)	Poring, Mt. Kinabalu, Sabah, Malaysia	3.x.1999
		unnumbered (3♀)	Mahua, Crocker Range, Sabah, Malaysia	14.x.1999
sp.K2-like	flatosternata sp. n.	#04171–8 (6♂, 2♀)	Guanlei, Xishuangbanna Nature Reserve, Yunnan, China	14–15.x.2012
sp.K3	borneoensis sp. n.	#03893–4 (♀)	Park Headquarters, Mt. Kinabalu, Sabah, Malaysia	11.iii.2008
		#03895 (♂)	Park Headquarters, Mt. Kinabalu, Sabah, Malaysia	16.viii.2011
		#03896 (♂)	Park Headquarters, Mt. Kinabalu, Sabah, Malaysia	17.viii.2011
		unnumbered (8♂, 4♀)	Park Headquarters, Mt. Kinabalu, Sabah, Malaysia	2.i.1999
		unnumbered (1♂)	Poring, Mt. Kinabalu, Sabah, Malaysia	28.xii.1998
		unnumbered (1♂)	Mahua, Crocker Range, Sabah, Malaysia	14.x.1999
	javaensis sp. n.	#03887–89 (♀)	Cikaniki, Mt. Halimun, West Java, Indonesia	6.xi.2009
		#03892 (♂)	Cikaniki, Mt. Halimun, West Java, Indonesia	7.xi.2009
		unnumbered (1♀)	Cikaniki, Mt. Halimun, West Java, Indonesia	10.xi.2009
		unnumbered (1♂)	Cibodas, West Java, Indonesia	16.xi.2013
		unnumbered (1♂)	Mt. Patuha, Sugihmukti, West Java, Indonesia	13.x.2004
	sumatraensis sp. n.	#03890–1 (♂, ♀)	Mt. Kerinci, Jambi, Sumatra, Indonesia	7.x.2004
		unnumbered (1♀)	Mt. Kerinci, Jambi, Sumatra, Indonesia	6.x.2004

a Numbers in bold indicate holotypes of new species.

Species delimitation

The specimens were first identified as of in light of morphology referring to Hu and Toda’s (2005) diagnosis of this genus. Then, they were examined for external morphology, morphometric characters and detailed structures of some dissected organs by the same methods as in Li et al. (2014), and sorted into morpho-species. For each of these morpho-species, representative specimens suitable for DNA sequencing were selected, considering also the numbers, geographical origins, and genders of available specimens. For each of the selected specimens, the total DNA was extracted from a hind-leg (usually the right one) or small piece(s) of abdominal tissue picked from the dissection cut of terminalia, using the TIANamp® Genomic DNA Kit. DNA sequences of the 658-bp barcoding region of the mitochondrial (cytochrome c oxydase subunit I) gene were then amplified and sequenced with the Folmer primers (Folmer et al. 1994; Table 2), using the same PCR cycle program as in Li et al. (2014). In addition, we determined the DNA sequences of the whole 688-bp region of the mitochondrial (cytochrome c oxidase subunit II) gene, using the primer pair designed by Simon et al. (1994; Table 2), with the same PCR cycle program used in Gao et al. (2007). The sequences obtained were edited in the SeqMan module of the DNAStar package, version 7.1.0 (DNAStar, Inc., Madison, WI), and aligned in MEGA7 (Kumar et al. 2016). We performed a tree-based DNA barcoding with the and sequences, respectively, with Bayesian trees constructed using MrBayes 3.1 (Ronquist and Huelsenbeck 2003). For this, the sequence alignment of each gene was partitioned into two subsets (codon positions 1 plus 2, and codon position 3), with choice of substitution models justified via model testing (Srivathsana and Meier 2012) in MEGA7 using the Bayesian Information Criterion. In Bayesian inference, sampling frequency was set as every 1000 generations, and numbers of chains = 4. Two analyses were run simultaneously till the average deviation of split frequencies fell well below 0.01. Therefore, in all analyses, full runs of 5,000,000 generations were performed. In each analysis, 1000 early-phase samples were discarded as burn-in for each run, yielding a total of 8,002 trees to construct a 50% majority consensus tree with nodes characterized by posterior probability (PP). We then summarized the information of intra- and interspecific p-distances calculated without data partitioning. The morpho-species were then reconsidered by integrating information from the morphology, the geographical distribution (Fig. 1) and DNA barcodes.

Table 2.

Primer sequences for PCR/sequencing.

Target region	Primer name	Primer sequence (5’–3’)	Reference
COI	LCO1490	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994)
	HCO2198	TAAACTTCAGGGTGACCAAAAAATCA	ditto
COII	COII-1	ATGGCAGATTAGTGCAATGG	Simon et al. (1994)
	COII-2	GTTTAAGAGACCAGTACTTG	Ditto

Figure 1.

Geographical distribution of the species group. See the text for the detailed information of the collection sites on the map.

Descriptions

In species illustration, a DinoLite® Digital Eyepiece Camera was used to microphotograph some organs for representative specimens. McAlpine (1981) was followed for the morphological terminology, and Zhang and Toda (1992) for the definitions of measurements and indices. The examined specimens are deposited in the following institutes:

Zoological Museum, Institute of Biological Science, University of Malaya, Kuala Lumpur, Malaysia

Kinabalu Park, Sabah Parks, Sabah, Malaysia

Institute for Tropical Biology and Conservation, Universiti Malaysia Sabah, Kota Kinabalu, Sabah, Malaysia

Museum Zoologicum Bogoriense, Bogor, Indonesia

Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japan

Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China

Results

The specimens examined were first sorted into four morpho-species (Table 1). We got 23 and 26 sequences. The GenBank accession numbers are KY809802−KY809824 for the , and KY809825−KY809850 for the sequences. Table 3 PageBreakshows the result of model selection. The and Bayesian trees (both unrooted) are shown in Fig. 2. Each of the morpho-species sp.K1 [from Peninsular Malaysia and Borneo (Sarawak and Sabah)], sp.K2 (Sabah) and sp.K2-like (Xishuangbanna, Yunnan, southwestern China) was strongly suggested to be monophyletic. Sp.K2 and sp.K2-like formed a well-supported clade (PPs = 1.00 in both of the and trees, respectively). Sp.K1, which is sympatric with sp.K2 in Sabah, formed a clade independent from the clade of sp.K2+sp.K2-like. Thus, these three morpho-species, spp.K1, K2 and K2-like, were recognized as independent species, i.e., sp. n., sp. n. and sp. n., respectively.

Table 3.

Models selected for sequence subsets a.

Gene	Data set	Model selected	BIC score	ln L	Invariant	Gamma	R
COI	whole	GTR+G	4417.9362	-1962.0299	n/a	0.2057	2.1514
	CP 1+2	K2+G	2057.0568	-823.9557	n/a	0.0500	18.7827
	CP 3	T92+G	2322.3495	-967.9958	n/a	1.0658	3.3825
COII	whole	T92+G	4745.1717	-2118.2231	n/a	0.1231	4.6468
	CP 1+2	T92+G	2250.9406	-881.6321	n/a	0.0500	4.4687
	CP 3	T92+G	2525.5613	-1037.0171	n/a	0.9274	9.6084

a Abbreviations: CP1+2, codon positions 1 plus 2; CP3, condon position 3; GTR, general time reversible; G, discrete Gamma distribution; K2, Kimura 2-parameter; T92, Tamura 3-parameter; BIC score, Bayesian Information Criterion score; lnL, maximum likelihood value; Invariant, estimated fraction of invariant sites; Gamma, gamma shape parameter; , estimated value of transition/transversion bias.

Figure 2.

Bayeisan trees deduced with (left) and (right) gene sequences. Label of each operational taxonomic unit (OUT) is given in the format of “voucher number (sex)”. Numbers beside nodes are posterior probabilities (when ≥ 0.90). Bold voucher numbers indicate holotype specimens.

Specimens of the morpho-species sp.K3 clustered into three more or less diverged, allopatric lineages each endemic to Borneo (Sabah), West Java, or Sumatra (Jambi) in the tree (PP = 1.00 for each lineage). While the former two lineages were recovered in the tree (PPs = 0.99 and 1.00, respectively), the last one was not supported in this tree. Table 4 shows the summary of intra- and interspecific p-distances for the six putative species. The interspecific mean p-distances for sequences among these three lineages of sp.K3 varied from 0.0349 (Java vs. Sumatra) to 0.0751 (Borneo vs. Java), coinciding with the smallest interspecifc distance variability of 5.9±4.1% (uncorrected divergence) for sequences in (Meier et al. 2008) and being larger than their intraspecific mean distances ranging from 0.0045 (Java) to 0.0185 (Sumatra). However, these lineages are morphologically very similar, differing from each other in so few morphological characters that it is hard to distinguish between them (see descriptions). On the other hand, comparison of the and nucleotide sequences among these lineages has revealed that there are fixed, lineage-specific nucleotides at more than one sites, where nucleotides remain unchanged in the other three species (Table 5). Such sites can therefore be used as pure molecular diagnostic characters (Sarkar et al. 2002, DeSalle et al., 2005) for respective lineages. Taking into account their geographically isolated situations as well, we regard these lineages as three independent, cryptic species, i.e., sp. n., sp. n. and sp. n.

Table 4.

Summary of intra- and interspecific p-distances.

Species (Morpho-species code)	Intraspecific mean distance (±SE) a		Interspecific mean distance (COI / COII) b
	COI	COII	1	2	3	4	5	6
1. trilobita sp. n. (sp.K1)	0.0078 ± 0.0028	0.0098 ± 0.0033		0.0112 / 0.0117	0.0101 / 0.0098	0.0127 / 0.0128	0.0122 / 0.0115	0.0123 / 0.0114
2. heterochroma sp. n. (sp. 2)	0.0076 ± 0.0026	0.0044 ± 0.0018	0.1123 / 0.1054		0.0082 / 0.0076	0.0128 / 0.0103	0.0114 / 0.0104	0.0125 / 0.0114
3. flatosternata sp. n. sp.K2-like)	0.0041 ± 0.0017	0.0111 ± 0.0021	0.1105 / 0.1148	0.0573 / 0.0707		0.0128 / 0.0112	0.0127 / 0.0110	0.0123 / 0.0106
4. borneoensis sp. n. (sp.K3, Borneo)	0.0063 ± 0.0024	0.0007 ± 0.0007	0.1256 / 0.1273	0.1412 / 0.1159	0.1448 / 0.1355		0.0082 / 0.0075	0.0085 / 0.0076
5. javaensis sp. n. (sp.K3, Java)	0.0045 ± 0.0019	0.0044 ± 0.0020	0.1118 / 0.1170	0.1295 / 0.1136	0.1271 / 0.1280	0.0751 / 0.0607		0.0079 / 0.0072
6. sumatraensis sp. n. (sp.K3, Sumatra)	0.0185 ± 0.0065	0.0060 ± 0.0027	0.1007 / 0.1178	0.1184 / 0.1129	0.1175 / 0.1223	0.0713 / 0.0576	0.0349 / 0.0468

a SE, standard error;

b Values of p-distance below diagonal, values of standard error above diagonal.

Table 5.

Selected diagnostic nucleotide sites for each of sp. n., sp. n., and sp. n. in the and sequences. For nonsynonymous nucleotide substitutions, corresponding amino acid status are given in parentheses. Hyphens (-) indicate missing data, and dots (.) indicate identical symbols with the first sequence (i.e., that of the specimen #03876 of sp. n.).

Species	Voucher #	Diagnostic sites
		COI								COII
		142	205	235	499	519	532	541	544	18	69	270	303	309	381	389	393	441	513	636
trilobita sp. n.	#03876	T	T	T	T	C (Ala)	A	T	T	T	T	T	T	A	A	C (Thr)	T	T	G	A
	#03877	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (.)	.	.	.	.
	#03878	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (.)	.	.	.	.
	#03882	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (.)	.	.	.	.
heterochroma sp. n.	#03879	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Pro)	.	.	.	.
	#03880	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Pro)	.	.	.	.
	#03881	-	-	-	-	-	-	-	-	.	.	.	.	.	.	. (Pro)	.	.	.	.
	#03883	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Pro)	.	.	.	.
flatosternata sp. n.	#04171	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04172	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04173	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04174	-	-	-	-	-	-	-	-	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04175	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04176	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04177	-	-	-	-	-	-	-	-	.	.	.	.	.	.	. (Ser)	.	.	.	.
	#04178	.	.	.	.	. (.)	.	.	.	.	.	.	.	.	.	. (Ser)	.	.	.	.
borneoensis sp. n.	#03893	.	.	C	C	T (Val)	T	C	C	.	.	.	.	G	.	T (Ile)	.	C	A	G
	#03894	.	.	C	C	T (Val)	T	C	C	.	.	.	.	G	.	T (Ile)	.	C	A	G
	#03895	.	.	C	C	T (Val)	T	C	C	.	.	.	.	G	.	T (Ile)	.	C	A	G
	#03896	.	.	C	C	T (Val)	T	C	C	.	.	.	.	G	.	T (Ile)	.	C	A	G
javaensis sp. n.	#03887	C	.	.	.	. (.)	.	.	.	.	C	C	C	.	G	. (.)	C	.	.	.
	#03888	C	.	.	.	. (.)	.	.	.	.	C	C	C	.	G	. (.)	C	.	.	.
	#03889	C	.	.	.	. (.)	.	.	.	.	C	C	C	.	G	. (.)	C	.	.	.
	#03892	C	.	.	-	-	-	-	-	.	C	C	C	.	G	. (.)	C	.	.	.
sumatraensis sp. n.	#03890	.	C	.	-	-	-	-	-	C	.	.	.	.	.	. (.)	.	.	.	.
	#03891	.	C	.	.	. (.)	.	.	.	C	.	.	.	.	.	. (.)	.	.	.	.

Taxonomy

In the following descriptions of the new species group and new species, and also the key to species, some figures in Hu and Toda (2005) are referred to, with their original numbers given in double quotation marks.

The six new species to be described here certainly belong to the genus , according to its diagnosis revised by Hu and Toda (2002): cibarium only slightly protruded at anterolateral corners; oviscapt with apical ovisensillum robust and largest, distinguishable from the others; basal lobe of palpus without setulae; hypopharyngeal apodeme expanded anteriorly; labellum with less than six pseudotracheae; ocellar setae outside triangle made by ocelli. Within , they should be related to the sinensis group, sharing some characters regarded by Hu and Toda (2005) as diagnostic for the latter group: very large ocellar triangle (“Fig. 1”); large number (≥ 40 per side) of medial sensilla on cibarium (“Fig. 6”); ventral surface of prementum forming discrete bump (Fig. 4E, J, O, T, Y, D’; “Figs 8–11A”). However, they lack some other diagnostic characters of the sinensis group: foreleg tibia with stout apical seta distinctly thicker than preapical dorsal seta (“Fig. 2”); aedeagus apically with membranous, trumpet-like dilation (“Figs 8F, 9–11D”). And, three of them, sp. n., sp. n. and sp. n., share a particular character, i.e., 4 pseudotracheae varying in thickness (“Fig. 4”), with the agbo species group (Hu and Toda 2005). Furthermore, all the six new species possess some characters specific to themselves: there are two or three prominent setae on the anteromedial portion of cercus (Figs 5–10B); the cercus is strongly sclerotized along the anterior to caudoventral margin, which seems to be homologous with the strong sclerotization of the caudoventral portion of cercus seen in three species of the sinensis group (“Figs 9–11B”), but the sclerotized plates of cerci are fused with each other caudoventrally and to epandrium anteroventrally (Figs 5–10A,B). Based on these morphological characteristics, we establish a new species group, the species group, in , for the six new species.

Figure 4.

Head (anterior view), postocciput, palpus, and prementum (ventral and lateral view, respectively). A−E sp. n. (#03877) F−J sp. n. (#03879) K−O sp. n. (#04172) P−T sp. n. (#03895) U−Y sp. n. (#03892) Z−D sp. n. (#03890). Scale bars: 0.1 mm except for A, F, K, P, U, Z (0.5 mm).

Figure 5.

sp. n. (A−H #03877 I−K paratype #03878). A Periphallic organs (posterior view), with red arrow indicating the median process on the caudoventral bridge of cerci B periphallic organs (posterolateral view), with red arrows indicating the prominent setae on the cercus and the anteroventral fusion of cercus (sclerotized, marginal plate) with the epandrium C surstyli (ventral view) D surstylus (inner side) E−G phallic organs (ventral, ventrolateral and lateral view, respectively) H paramedian setae (indicated with red arrows), and apical portion of paramere I, J oviscapt (lateral and ventral view, respectively) K spermathecae. Abbreviations: aed = aedeagus, aed a = aedeagal apodeme, cerc = cercus, epand = epandrium, hypd = hypandrium, pm = paramere, sur = surstylus, 10S = tenth sternite. Scale bars: 0.1 mm.

Figure 10.

sp. n. (A−H #03890 I−K paratype #03891). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and ventral portions of cerci D tenth sternite (posteroventral view) E−G phallic organs (ventral, ventrolateral and lateral view, respectively) H distal portion of hypandrium (posteroventral view), showing the caudolateral plates not pubescent (red arrows) and the paramedian setae I, J oviscapt (lateral and ventral view, respectively) K spermatheca (lateral view). Scale bars: 0.1 mm.

species group

Diagnosis. Cercus anteromedially with two or three prominent setae on anteromedial portion, strongly sclerotized along anterior to caudoventral margin; sclerotized plates of curci fused with each other caudoventrally and to epandrium anteroventrally (Figs 5–10A, B).

Common characters. Head (Fig. 4): Eye red, with dense interfacetal setulae; longest axis nearly orthogonal to body axis. Frons, face, gena, occiput, postgena and clypeus glossy black; facial carina blackish brown. Ocellar very large, nearly rectangular, anteriorly reaching to ptilinal fissure; frontal vitta narrow, without interfrontal setulae. Pedicel grayish brown; arista with 6−7 dorsal and 2−3 ventral branches in addition to terminal fork. Subvibrissal seta not differentiated, as small as other orals. Palpus slender, apically with one prominent ventral and one subprominent dorsal setae. Cibarium not thickened on anterior margin, with four anterior sensilla arranged square; dorsal wall pear-shaped, anteriorly somewhat dilated in dorsal view and strongly convex in lateral view; anterior portion of hypopharynx shorter than posterior tubular portion. Prementum with 5–6 (one proximal, one central, 2–3 lateral, and one distal longest) pairs of setae. Labellum with four pseudotracheae per side.

Thorax (Fig. 3A, B, E, F, H, I, K, L, N, O, Q, R): Scutum and scutellum matt, entirely black. Postpronotum, thoracic pleura and notopleural portion blackish brown to black. Acrostichal setulae in six rows. Mid katepisternal seta minute, indistinguishable from a few underneath others.

Figure 3.

Left lateral habitus, head and thorax (dorsal view), wing (left, ventral view), and abdomen (dorsal view). A−D sp. n. (#03877) E−G sp. n. (#03879) H−J sp. n. (#04172) K−M sp. n. (#03895) N−P sp. n. (#03892) Q−S sp. n. (#03890). Scale bars: 1.0 mm.

Legs (Fig. 3A, E, H, K, N, Q): Preapical dorsal setae present on all tibiae; foreleg apical seta as thick as preapical dorsal one. Foreleg first tarsomere slightly shorter than total length of four succeeding tarsomeres; all tarsi narrowing distally, with small, apical claws.

Abdomen (Fig. 3A, D, E, H, K, N, Q): Tergites blackish brown. Sternites grayish yellow.

Male terminalia (Figs 5A–H, 6A–I, 7A–I, 8A–G, 9A–G, 10A–H): Surstylus basally narrowly fused to epandrium, with 8–10 peg-like prensisetae on caudal margin. Hypandrium pale brown, submedially with a pair of small, pubescent lobes apically PageBreakbearing short paramedian seta. Paramere broad, plate-like, not pubescent, partly fused to hypandrium, articulated with aedeagus, with two sensilla. Aedeagus apically without pale, membranous trumpet-like dilation; basal processes absent; aedeagal guide present, apically fused to hypandrium; apodeme as long as aedeagus.

Figure 6.

sp. n. (A−I #03879 J−L paratype #03881). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and cerci, with red arrow indicating the caudoventral bridge of cerci D, E tenth sternite (ventral and anterior view, respectively), with red arrows (E) indicating a pair of depressions F−H phallic organs (ventral, ventrolateral and lateral view, respectively), with red arrow (H) indicating the dorsally swollen, submedial portion of aedeagus I paramedian setae J, K oviscapt (lateral and ventral view, respectively) L spermathecae (lateral view). Scale bars: 0.1 mm.

Figure 7.

sp. n. (A−I #04172 J−L paratype #04177). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and cerci D, E tenth sternite (ventral and anterior view, respectively) F−H phallic organs (ventral, ventrolateral and lateral view, respectively) I paramedian setae J, K oviscapt (lateral and ventral view, respectively) L spermatheca (lateral view). Scale bars: 0.1 mm.

Figure 8.

sp. n. (A−G #03895 H−J paratype #03894). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and cerci, with red arrow indicating the median, elongated process on the caudoventral bridge of cerci D−F phallic organs (ventral, ventrolateral and lateral view, respectively) G distal portion of hypandrium (posteroventral view), showing the caudolateral plates not pubescent (red arrows) and the paramedian setae H, I oviscapt (lateral and ventral view, respectively) J spermatheca (lateral view). Scale bars: 0.1 mm.

Figure 9.

sp. n. (A−G #03892 H−J paratype #03888). A, B Periphallic organs (posterior and posterolateral view, respectively) C surstyli and ventral portions of cerci D−F phallic organs (ventral, ventrolateral and lateral view, respectively) G distal portion of hypandrium (posteroventral view), showing a pair of small patches of sparse pubescence on the caudolateral plates (red arrows) and the paramedian setae H, I oviscapt (lateral and ventral view, respectively) J spermatheca (lateral view). Scale bars: 0.1 mm.

Female terminalia (Figs 5I–K, 6J–L, 7J–L, 8H–J, 9H–J, 10I–K): Oviscapt valve yellowish brown, apically pointed and slightly bent outward, with four (three dorsal, one ventral) subterminal, trichoid ovisensilla.

Included species. Yang & Gao, sp. n., Yang & Gao, sp. n., Yang & Gao, sp. n., Yang & Gao, sp. n., Yang & Gao, sp. n., and Yang & Gao, sp. n.

Key to the species

In the following key, not only morphological characters but also the selected pure diagnostic nucleotide sites of and sequences (Table 5) are used to identify the three cryptic species, sp. n., sp. n. and sp. n.

Description of new species

The characters described above for the genus, the species group, and the key are not referred to in the following descriptions.

Yang & Gao sp. n.

http://zoobank.org/BAF11C36-EB50-4E98-A8A1-537AE7AD715A

Figs 3A–D , 4A–E , 5

Type material.

Holotype ♂ (#03877): MALAYSIA: Ulu Gombak, Selangor, 8.xii.2013, MJ Toda (UMKL).

Paratypes: same data as holotype (1♀: #03878, UMKL); Kubah, Sarawak, Malaysia, 19.i.1999 (1♂, 1♀, SEHU); Park Headquarters, Mt. Kinabalu, Sabah, Malaysia, 11.iii.2008, MJ Toda (1♂: #03876, KIZ); Poring, Mt. Kinabalu, Sabah, Malaysia, 20.iii.2008, MJ Toda (1♀: #03882, KIZ).

Diagnosis.

Postocellar setae absent; wing without distinct cloud (Fig. 3C); sclerotized, caudoventral bridge of cerci with small, narrow, apically pointed, median process and a pair of lateral, broad, apically rounded lobes (Fig. 5A); aedeagus apically curved, hook-like, and finely wrinkled all over, subapically with numerous, coarse serrations, submedially not swollen dorsally (Fig. 5G); spermatheca without distinct introvert (Fig. 5K).

Description.

Head (Figs 3A, B, 4A–E): First flagellomere grayish yellow. Dorsolateral tentorial apodemes slightly divergent in basal 2/5 but strongly divergent in distal 3/5; supracervical setae 21−23 per side; postocular setae 22–23 per side. Palpus with two subprominent, lateromedial setae. Cibarium with ca. 70 medial and ca. 8 posterior sensilla per side.

Wings (Fig. 3C): Veins pale brown to brown. Halter pale gray; stem darker.

Legs (Fig. 3A) pale grayish yellow; mid- and hindleg femora distally, foreleg tibia and tarsi proximally to medially darker. Apical setae present on all tibiae; hindleg apical seta short, stout. Mid-leg first tarsomere longer than total length of four succeeding tarsomeres; hindleg first tarsomere as long as total length of four succeeding tarsomeres.

Male terminalia (Fig. 5A–H): Epandrium pubescent except for anterior to ventral margin, with 1–3 dorsal and ca. 22 ventral, long setae per side. Surstylus with peg-like prensisetae in sinuate row on caudal margin, 2–5 apically pointed spines and medial patch of pubescence on outer surface and ca. 26 apically pointed spines (ventral ones shorter, thicker and straight, but medial to dorsal ones trichoid and recurved) on inner, caudal portion. Tenth sternite nearly flat. Cercus pubescent except for caudal margin, with 11–12 long setae near dorsal to posterior margin and 7–11 short setae in cluster on ventral portion of sclerotized marginal plate. Paramere with sensilla apically.

Female terminalia (Fig. 5I–K): Oviscapt valve dorsomedially narrowly extended, with 3−4 lateral and 9−13 marginal, peg-like ovisensilla.

Measurements (in mm): BL (straight distance from anterior edge of pedicel to tip of abdomen) = 2.03 in holotype (1♂ paratype: 2.00; range in 2♀ paratypes: 2.00−2.21), ThL (distance from anterior notal margin to apex of scutellum) = 0.84 (0.82; 0.86−0.88), WL (distance from humeral cross vein to wing apex) = 1.62 (1.69; 1.72−1.73), WW (maximum wing width) = 0.71 (0.72; 0.74−0.79).

Indices: FW/HW (frontal width/head width) = 0.53 (range in 1♂, 2♀, or less if noted, paratypes: 0.38−0.50), ch/o (maximum width of gena/maximum diameter of eye) = 0.18 (0.19−0.26), prorb (proclinate orbital seta/posterior reclinate orbital seta in length) = 0.72 (2♀: 0.71−0.80), rcorb (anterior reclinate orbital seta/posterior reclinate orbital seta in length) = 0.30 (2♀: 0.31−0.33), orbito (distance between proclinate and posterior reclinate orbital setae / distance between inner vertical and posterior reclinate orbital setae) = 0.60 (0.58−0.68), dcl (anterior dorsocentral seta/posterior dorsocentral seta in length) = 0.78 (2♀: 0.64−0.74), sctl (basal scutellar seta/apical scutellar seta in length) = 0.67 (1♀: 0.60), sterno (anterior katepisternal seta/posterior katepisternal seta in length) = 0.51 (0.57−0.60), dcp (distance between ipsilateral dorsocentral setae/distance between anterior dorsocentral setae) = 0.49 (0.53−0.60), sctlp (distance between ipsilateral scutellar setae/distance between apical scutellar setae) = 0.79 (0.68−0.77), C (2nd costal section between subcostal break and R2+3/3rd costal section between R2+3 and R4+5) = 1.57 (1.35−1.53), 4c (3rd costal section between R2+3 and R4+5/M1 between r-m and dm-cu) = 1.54 (1.46−1.66), 4v (M1 between dm-cu and wing margin/M1 between r-m and dm-cu) = 2.19 (2.11−2.33), 5x (CuA1 between dm-cu and wing margin/dm-cu between M1 and CuA1) = 2.19 (2.00−2.38), ac (3rd costal section between R2+3 and R4+5/distance between distal ends of R4+5 and M1) = 3.58 (3.66−3.76), M (CuA1 between dm-cu and wing margin/M1 between r-m and dm-cu) = 0.72 (0.66−0.70), C3F (length of heavy setation in 3rd costal section/length of 3rd costal section) = 0.70 (0.66−0.68).

Etymology.

Referring to the trilobed, caudoventral bridge of cercal sclerotized plates.

Distribution.

Malaysia (Peninsular Malaysia, Sarawak, Sabah).

Yang & Gao sp. n.

http://zoobank.org/4C4A707B-EFFC-474D-A485-381B40B879E8

Figs 3E–G , 4F–J , 6

Holotype ♂ (#03879): MALAYSIA: Poring, Mt. Kinabalu, Sabah, 20.iii.2008, MJ Toda (KPSP).

Paratypes: same data as holotype (1♂, 1♀: #03880, #03881, KIZ; 1♂, SEHU); same data as holotype except for 13.iii.2008 (1♀: #03883, KIZ); same data as holotype except for 19.iii.2008 (1♂, SEHU); same data as holotype except for 3.x.1999 (1♂, SEHU); Mahua, Crocker Range, Sabah, Malaysia, 14.x.1999, MJ Toda (1♀, KPSP; 2♀, SEHU); Ulu Senagang, Crocker Range, Sabah, Malaysia, 18.x.1999, MJ Toda (1♂, 2♀: #03884–3886, ZSM).

Wing largely clouded, except for central pale patch around dm-cu vein and periphery (Fig. 3G); dorsolateral tentorial apodemes nearly parallel in basal half (Fig. 4H); tenth sternite mediolaterally with a pair of round depressions (seen in anterior view; Fig. 6E); oviscapt valve 2/5 as broad as long (Fig. 6J).

Head (Figs 3E, F, 4F–J): First flagellomere grayish yellow. Supracervical setae 15−22 per side; postocular setae 17–21 per side. Palpus with one subprominent lateromedial seta. Cibarium with 78–79 medial and ca. 8 posterior sensilla per side.

Wings (Fig. 3G): Veins pale brown to dark brown, but pale within central pale patch. Halter pale gray; stem darker.

Legs (Fig. 3E) pale grayish yellow; foreleg coxa, tibia and tarsus, except for fifth tarsomere, dark brown. Mid-leg first tarsomere longer than total length of four succeeding tarsomeres; hindleg first tarsomere as long as total length of four succeeding tarsomeres.

Male terminalia (Fig. 6A–I): Epandrium pubescent except for anterior portion, with 3–4 dorsal and 9–12 ventral, long setae per side. Surstylus with prensisetae in nearly straight row on caudal margin, 2–4 apically pointed spines but no pubescence on outer surface and ca. 20 apically pointed, recurved spines on inner, caudal portion. Cercus pubescent except for caudal margin, with 6–12 long setae near dorsal to posterior margin and 6–7 short setae in cluster on ventral portion of sclerotized marginal plate. Paramere with sensilla subapically.

Female terminalia (Fig. 6J–L): Oviscapt valve with ca. five lateral and 12–14 marginal, peg-like ovisensilla. Introvert of spermathecal capsule 1/5 as deep as capsule height.

Measurements (in mm): BL = 2.18 in holotype (range in 2♂ paratypes: 1.99 –2.21; range in 4♀ paratypes: 2.31–2.77), ThL = 0.79 (0.81–0.85; 0.92 –0.97), WL = 1.64 (1.60–1.64; 1.80 –2.30), WW = 0.68 (0.69–0.70; 0.75 –0.97).

Indices: FW/HW = 0.59 (2♂, 4♀, or less if noted, paratypes: 0.50–0.54), ch/o = 0.20 (0.25–0.28), prorb = 0.74 (2♂, 1♀: 0.76–0.87), rcorb = 0.29 (2♂, 3♀: 0.31–0.36), orbito = 0.54 (0.48–0.76), dcl = 0.71 (1♂, 2♀: 0.60–0.73), sctl = n/a (1♂, 3♀: 0.88–0.94), sterno = 0.54 (0.50–0.61), dcp = 0.55 (0.55–0.65), sctlp = 0.62 (0.75–0.95), C = 1.69 (1.99–2.08), 4c = 1.54 (1.41–1.54), 4v = 2.50 (2.28 –2.51), 5x = 1.79 (1.25–1.56), ac = 2.86 (2.38–3.09), M = 0.70 (0.62–0.64), C3F = 0.78 (0.73–0.87).

Referring to the heterochromatic legs.

Malaysia (Sabah).

Yang & Gao sp. n.

http://zoobank.org/2BAD2A68-B183-4781-AF74-A103DEF614F4

Figs 3H–J , 4K–O , 7

Holotype. ♂ (#04172), CHINA: Mengyuan Substation, Mengla Station, Xishuangbanna National Nature Reserve, Guanlei, Mengla, Xishuangbanna, Yunnan, 14–15.xi.2012, JJ Gao (KIZ).

Paratypes: same data as holotype (5♂, 2♀: #04171, #04173–4178, KIZ, SEHU).

Wing largely clouded, except for central pale patch around dm-cu vein and periphery (Fig. 3J); dorsolateral tentorial apodemes slightly divergent in basal half (Fig. 4M); tenth sternite nearly flat (Fig. 7E); oviscapt valve half as broad as long (Fig. 7J).

Head (Figs 3H, I, 4K–O): First flagellomere grayish yellow. Supercervical setae 17−18 per side; postocular setae 20–22 per side. Palpus with one subprominent lateromedial seta. Cibarium with 77–79 medial and ca. 10 posterior sensilla per side.

Wings (Fig. 3J): Veins pale brown to dark brown, but pale within central pale patch. Halter pale gray; stem darker.

Legs (Fig. 3H) pale grayish yellow; foreleg tibia and tarsus, mid-leg femur and distal portion of hindleg femur darker. Hindleg tibia lacking apical seta. Mid-leg first tarsomere longer than total length of four succeeding tarsomeres; hindleg first tarsomere as long as total length of four succeeding tarsomeres.

Male terminalia (Fig. 7A–I): Epandrium pubescent except for anterior portion, with ca. three dorsal and 10–11 ventral, long setae per side. Surstylus with prensisetae in slightly concave row on caudal margin, 2–3 apically pointed spines but no pubescence on outer surface and ca. 16 apically pointed, recurved spines on inner, caudal portion. Cercus pubescent except for caudal margin, with 10–13 long setae near dorsal to posterior margin and 8–10 short setae in cluster on ventral portion of sclerotized marginal plate. Paramere with sensilla subapically.

Female terminalia (Fig. 7J–L): Oviscapt valve with ca. four lateral and 12–13 marginal, peg-like ovisensilla. Introvert of spermathecal capsule 1/4 as deep as capsule height.

Measurements (in mm): BL = 2.10 in holotype (range in 5♂ paratype: 2.08–2.32; range in 2♀ paratypes: 2.21 –2.31), ThL = 0.87 (0.83–0.88; 0.83 –0.93), WL = 1.78 (1.67–1.81; 1.71 –1.81), WW = 0.81 (1.79–1.82; 0.81–0.83).

Indices: FW/HW = 0.54 (5♂, 2♀, or less if noted, paratypes: 0.49–0.54), ch/o = 0.23 (0.27–0.29), prorb = 0.71 (0.79–0.87), rcorb = n/a (0.33–0.39), orbito = 0.54 PageBreak(0.55–0.74), dcl = 0.64 (0.62–0.78), sctl = n/a (4♂, 2♀: 0.89–0.97), sterno = 0.65 (0.54–0.63), dcp = 0.55 (0.54–0.62), sctlp = 0.73 (0.74–0.80), C = 1.53 (1.63–1.71), 4c = 1.45 (1.22–1.36), 4v = 1.96 (1.42–1.60), 5x = 1.89 (1.79–1.94), ac = 3.04 (2.53–2.76), M = 0.64 (0.57–0.64), C3F = 0.69 (0.62–0.71).

Referring to the flat male tenth sternite.

China (Yunnan).

Yang & Gao sp. n.

http://zoobank.org/20778512-6C3C-4BC2-99A6-83A02C6FBCC4

Figs 3K–M , 4P–T , 8

Holotype ♂ (#03895), MALAYSIA: Park Headquarters, Mt. Kinabalu, Sabah, 16.viii.2011, K Akutsu (KPSP).

Paratypes: same data as holotype except for 17.viii.2011 (1♂: #03896, KIZ); same data as holotype except for 11.iii.2008 (2♀: #03893, #03894, KIZ); same data as holotype except for 2.i.1999, MJ Toda (8♂, 2♀, SEHU; 1♀, KPSP; 1♀, ZSM); Poring, Mt. Kinabalu, Sabah, Malaysia, 28.xii.1998 (1♂); Mahua, Crocker Range, Sabah, Malaysia, 14.x.1999, MJ Toda (1♂, ZSM).

Postocellar setae present; spermathecal capsule somewhat cylindrical, apically flat; introvert 7/10 as deep as capsule height (Fig. 8J); = C, C, T, T, C and C at sites 235, 499, 519, 532, 541 and 544, respectively; = G, T, C, A and G at sites 309, 389, 441, 513 and 636, respectively (Table 5).

Head (Figs 3K, L, 4P–T): First flagellomere grayish brown. Dorsolateral tentorial apodemes slightly divergent in basal 2/5 but strongly divergent in distal 3/5; supracervical setae 21−25 per side; postocular setae 23−24 per side. Palpus with one subprominent, lateromedial seta. Cibarium with ca. 80 medial and 9−12 posterior sensilla per side.

Wings (Fig. 3M) slightly fuscous; veins yellowish brown to brown. Halter and stem gray.

Legs (Fig. 3K): All femora blackish brown; foreleg coxa, tibia and tarsus (except 5th tarsomere) grayish brown; rest grayish yellow. Apical setae present on foreleg and mid-leg tibiae. Mid-leg first tarsomere as long as total length of four succeeding tarsomeres; hindleg first tarsomere longer than total length of four succeeding tarsomeres.

Male terminalia (Fig. 8A–G): Epandrium pubescent except for anterior margin, with 1–2 dorsal and 7–11 ventral, long setae per side. Surstylus with 1–3 short spines and medial patch of pubescence on outer surface and 7–10 recurved spines on inner, caudal portion. Tenth sternite lingulate, slightly curved. Cercus pubescent except for dorsal to caudal margin, with 15–17 long setae distributed nearly all over; sclerotized, caudoventral bridge of cerci medially with narrowly elongated process. Paramere somePageBreakwhat triangular in lateral view, apically round, with sensilla on inner surface. Aedeagus apically trilobed, densely hirsute on outer lobes, dorsosubapically with a pair of small, marginally serrated flaps.

Female terminalia (Fig. 8H–J): Oviscapt valve dorsomedially narrowly extended, with 4−5 lateral and 12−15 marginal, peg-like ovisensilla. Spermathecal capsule with fine spinules on distal half of outer surface.

Measurements (in mm): BL = 2.42 in holotype (1♂ paratype: 2.10; range in 2♀ paratypes: 2.34–2.57), ThL = 1.01 (0.87; 0.93–0.96), WL = 2.19 (1.84; 1.82–2.14), WW = 0.97 (0.85; 0.92–0.94).

Indices: FW/HW = 0.50 (1♂, 2♀, or less if noted, paratypes: 0.48–0.51), ch/o = 0.19 (0.25–0.29), prorb = 0.66 (1♂, 1♀: 0.63–0.73), rcorb = 0.23 (1♂, 1♀: 0.24–0.30), orbito = 0.62 (0.53–0.60), dcl = 0.76 (1♀: 0.77), sctl = 0.86 (0.84–0.87), sterno = 0.59 (1♂, 1♀: 0.58–0.62), dcp = 0.49 (0.49–0.52), sctlp = 0.90 (0.84–0.89), C = 1.82 (1.82–2.01), 4c = 1.47 (1.31–1.51), 4v = 2.51 (2.22–2.70), 5x = 2.16 (2.11–2.32), ac = 2.81 (2.88–3.15), M = 0.79 (0.71–0.87), C3F = 0.59 (0.57–0.63).

Pertaining to the type locality.

Malaysia (Sabah).

Yang & Gao sp. n.

http://zoobank.org/09DA1C1A-C0A2-4025-99FB-6AAAC123F295

Figs 3N–P , 4U–Y , 9

Holotype. ♂ (#03892), INDONESIA: Cikaniki, Mt. Halimun, West Java, 7.x.2009, MJ Toda (MZB).

Paratypes: same as holotype except for 6.xi.2009 (1♀: #03887, MZB; 2♀: #03888–9, KIZ); same as holotype except for 10.xi.2009 (1♀, SEHU); Cibodas, West Java, Indonesia, 16.xi.2013, MJ Toda (1♂, SEHU); Mt. Patuha, Sugihmukti, West Java, Indonesia, 13.x.2004 (1♂, SEHU).

Postocellar setae present; spermathecal capsule somewhat dome-shaped, apically roundish; introvert 2/5 as deep as capsule height (Fig. 9J); hypandrium sparsely pubescent in small, medial patch on caudolateral plate (Fig. 9G); = C and T at sites 142 and 205, respectively; = T, C, C, C, G and C at sites 18, 69, 270, 303, 381 and 393, respectively (Table 5).

Head (Figs 3N, O, 4U–Y): First flagellomere grayish brown. Dorsolateral tentorial apodemes slightly divergent in basal 2/5 but strongly divergent in distal 3/5; supercervical setae 18−22 per side; postocular setae 19 per side. Palpus with one subprominent, lateromedial seta. Cibarium with ca. 90 medial and 10−12 posterior sensilla per side.

Wings (Fig. 3P) slightly fuscous; veins yellowish brown to brown. Halter and stem gray.

Legs (Fig. 3N): All femora blackish brown; foreleg coxa, tibia and tarsus (except 5th tarsomere) grayish brown; rest grayish yellow. Apical setae present on foreleg and mid-leg tibiae. Mid-leg first tarsomere as long as total length of four succeeding tarsomeres; hindleg first tarsomere longer than total length of four succeeding tarsomeres.

Male terminalia (Fig. 9A–G): Epandrium pubescent except for anterior margin, with 2–3 dorsal and 9–10 ventral, long setae per side. Surstylus with 2–3 short spines and medial patch of pubescence on outer surface and 10–11 recurved spines on inner, caudal portion. Tenth sternite lingulate, slightly curved. Cercus pubescent except for dorsal to caudal margin, with 14–17 long setae; sclerotized, caudoventral bridge of cerci medially with narrowly elongated process. Paramere somewhat triangular in lateral view, apically round, with sensilla on inner surface. Aedeagus apically trilobed, densely hirsute on outer lobes, dorsosubapically with a pair of small, marginally serrated flaps.

Female terminalia (Fig. 9H–J): Oviscapt valve dorsomedially narrowly extended, with 4−5 lateral and 12−15 marginal, peg-like ovisensilla. Spermathecal capsule without spinules on outer surface.

Measurements (in mm): BL = 1.94 in holotype (range in 3♀ paratypes: 2.08–2.50), ThL = 0.86 (0.97–1.03), WL = 1.81 (1.99–2.07), WW = 0.82 (0.86–0.92).

Indices: FW/HW = 0.56 (3♀, or less if noted, paratypes: 0.49–0.52), ch/o = 0.21 (0.34–0.41), prorb = 0.76 (0.72–0.79), rcorb = 0.24 (0.29–0.31), orbito = 0.60 (0.54–0.69), dcl = 0.74 (1♀: 0.71), sctl = 0.81(1♀: 0.81), sterno = 0.60 (0.50–0.54), dcp = 0.52 (0.53–0.60), sctlp = 0.71 (0.52–0.71), C = 1.85 (1.78–1.98), 4c = 1.54 (1.35–1.40), 4v = 2.62 (2.26–2.28), 5x = 2.28 (1.73–1.91), ac = 3.03 (2.95–3.24), M = 0.76 (0.71–0.90), C3F = 0.58 (0.50–0.60).

Pertaining to the type locality.

Indonesia (West Java).

Yang & Gao sp. n.

http://zoobank.org/8F7EB4F2-3B81-4D2F-9AAC-3ABD144F8BC7

Figs 3Q–S , 4Z–D ’, 10

Holotype ♂ (#03890): INDONESIA: Mt. Kerinci., Jambi, Sumatra, 7.x.2004, MJ Toda (MZB).

Paratypes: same as holotype (1♀: #03891, MZB); same as holotype except for 6.x.2004 (1♀, SEHU).

Postocellar setae present; spermathecal capsule somewhat dome-shaped, apically roundish; introvert 2/5 as deep as capsule height (Fig. 10K); hypandrium without pubescence on caudolateral plate (Fig. 10H); = T and C at sites 142 and 205, respectively; = C, T, T, T, A and T at sites 18, 69, 270, 303, 381 and 393, respectively (Table 5).

Head (Figs 3Q, R, 4Z–D’): First flagellomere grayish brown. Dorsolateral tentorial apodemes slightly divergent in basal 2/5 but strongly divergent in distal 3/5; supercervical setae 19−22 per side; postocular setae 20−24 per side. Palpus with one subprominent, lateromedial seta. Cibarium with numerous (> 60) medial and 8−9 posterior sensilla per side.

Wing (Fig. 3S) slightly fuscous; veins yellowish brown to brown. Halter and stem gray.

Legs (Fig. 3Q): All femora blackish brown; foreleg coxa, tibia and tarsus (except 5th tarsomere) grayish brown; rest grayish yellow. Apical setae present on foreleg and mid-leg tibiae. Mid-leg first tarsomere as long as total length of four succeeding tarsomeres; hindleg first tarsomere longer than total length of four succeeding tarsomeres.

Male terminalia (Fig. 10A–H): Epandrium pubescent except for anterior margin, with three dorsal and 11–13 ventral, long setae per side. Surstylus with 9–10 prensisetae caudal margin, 2–3 short spines and medial patch of pubescence on outer surface and ca. 15 recurved spines on inner, caudal portion. Tenth sternite lingulate, slightly curved. Cercus pubescent except for dorsal to caudal margin, with 20–21 long setae; sclerotized, caudoventral bridge of cerci medially with narrowly elongated process. Paramere somewhat triangular in lateral view, apically round, with sensilla on inner surface. Aedeagus apically trilobed, densely hirsute on outer lobes, dorsosubapically with a pair of small, marginally serrated flaps.

Female terminalia (Fig. 10I–K): Oviscapt valve dorsomedially narrowly extended, with 5−6 lateral and 14−17 marginal, peg-like ovisensilla. Spermathecal capsule without spinules on outer surface.

Measurements (in mm): BL = 2.33 in holotype (1♀ paratype: 2.70), ThL = 1.04 (1.13), WL = 2.17 (2.46), WW = 1.10 (1.00).

Indices: FW/HW = 0.36 (1♀ paratype: 0.40), ch/o = 0.39 (0.33), prorb = n/a (n/a), rcorb = n/a(n/a), orbito = 0.75 (0.78), dcl = 0.72 (n/a), sctl = n/a (n/a), sterno = n/a (0.61), dcp = 0.62 (0.60), sctlp = 0.80 (0.75), C = 1.90 (2.00), 4c = 1.29 (1.34), 4v = 2.18 (2.23), 5x = 2.18 (1.84), ac = 2.37 (2.57), M = 0.79 (0.75), C3F = 0.58 (0.60).

Pertaining to the type locality.

Indonesia (Sumatra).

Remarks.

The last three species somewhat resemble sp. n. in having the following morphological characters: wing without distinct, dark cloud; surstylus with medial patch of pubescence on outer surface; sclerotized, caudoventral bridge of cerci with narrow, median process; and oviscapt valve dorsomedially narrowly extended. However, the three species are very hard to distinguish from each other because of their least morphological differentiation. To overcome this difficulty, we employed 19 nucleotide sites of and genes as molecular diagnostic characters to identify these cryptic species (Table 5). Nucleotide substitutions at two of these sites are nonsynonymous, i.e., causing changes of amino acids, and specific to sp. n. (Table 5), thus providing more reliable (less changeable) characters for this species.

1	Postocellar setae absent; ocellar plate granulose; posteromost pseudotrachea of labellum thicker than the others; mid-leg first tarsomere with one subproximal and one apical, short, blackish brown spines, and hindleg first tarsomere with one apical, short spine; prensisetae on surstylus apically blunt (Figs 5–7C); cercus with three prominent setae on anteromedial portion (Figs 5–7B); sclerotized, caudoventral bridge of cerci with a pair of lateral, broad, apically rounded lobes (Figs 5A, 6C, 7C); aedeagus apically hooked (Figs 5G, 6H, 7H); spermathecal capsule pale brown, spherical, slightly broader than long, without apical indentation (Figs 5K, 6L, 7L)	2
–	Postocellar setae present (Fig. 4W); ocellar plate smooth, glossy; posteromost pseudotrachea of labellum as thick as the others; first tarsomeres of mid- and hindlegs without short, blackish brown spines; prensisetae on surstylus apically somewhat pointed (Figs 8–10C); cercus with two prominent setae on anteromedial portion (Figs 8–10B); sclerotized, caudoventral bridge of cerci without lateral lobes (Figs 8–10C); aedeagus apically not hooked (Figs 8F, 9F, 10G); spermathecal capsule small, less sclerotized, with apical indentation (Figs 8J, 9J, 10K)	4
2	Wing nearly entirely, lightly fuscous, without distinct cloud (Fig. 3C); sclerotized, caudoventral bridge of cerci with small, narrow, apically pointed, median process (Fig. 5A); aedeagus apically curved, hook-like, and finely wrinkled all over, subapically with numerous, coarse serrations, submedially not swollen dorsally (Fig. 5G); spermatheca without distinct introvert (Fig. 5K)	Di. trilobita Yang & Gao, sp. n.
–	Wing largely clouded, except for central pale patch around dm-cu vein and periphery (Fig. 3G,J); sclerotized, caudoventral bridge of cerci without median process (Figs 6C, 7C); aedeagus apically bearing a pair of strongly recurved, smooth hooks, subapically densely spinose, submedially swollen dorsally (Figs 6F,H, 7F,H); spermatheca with introvert 1/5–1/4 as deep as capsule height (Figs 6L, 7L)	3
3	Dorsolateral tentorial apodemes nearly parallel in basal half but strongly divergent in distal half (Fig. 4H); tenth sternite mediolaterally with a pair of round depressions (seen in anterior view; Fig. 6E); oviscapt valve 2/5 as broad as long (Fig. 6J)	Di. heterochroma Yang & Gao, sp. n.
–	Dorsolateral tentorial apodemes slightly divergent in basal half but strongly divergent in distal half (Fig. 4M); tenth sternite nearly flat (Fig. 7E); oviscapt valve half as broad as long (Fig. 7J)	Di. flatosternata , Yang & Gao, sp. n.
4	Spermathecal capsule somewhat cylindrical, apically flat; introvert 7/10 as deep as capsule height (Fig. 8J); COI = C, C, T, T, C and C at sites 235, 499, 519, 532, 541 and 544, respectively; COII = G, T, C, A and G at sites 309, 389, 441, 513 and 636, respectively (Table 5)	Di. borneoensis Yang & Gao, sp. n.
–	Spermathecal capsule somewhat dome-shaped, apically roundish; introvert 2/5 as deep as capsule height (Figs 9J, 10K); COI = T, T, C, A, T and T at sites 235, 499, 519, 532, 541 and 544, respectively; COII = A, C, T, G and A at sites 309, 389, 441, 513 and 636, respectively (Table 5)	5
5	Hypandrium sparsely pubescent in small, medial patch on caudolateral plate (Fig. 9G); COI = C and T at sites 142 and 205, respectively; COII = T, C, C, C, G and C at sites 18, 69, 270, 303, 381 and 393, respectively (Table 5)	Di. javaensis Yang & Gao, sp. n.
–	Hypandrium without pubescence on caudolateral plate (Fig. 10H); COI = T and C at sites 142 and 205, respectively; COII = C, T, T, T, A and T at sites 18, 69, 270, 303, 381 and 393, respectively (Table 5)	Di. sumatraensis Yang & Gao, sp. n.