Literature DB >> 28761780

DNA-barcoding of forensically important blow flies (Diptera: Calliphoridae) in the Caribbean Region.

Sohath Z Yusseff-Vanegas1, Ingi Agnarsson1.   

Abstract

Correct identification of forensically important insects, such as flies in the family Calliphoridae, is a crucial step for them to be used as evidence in legal investigations. Traditional identification based on morphology has been effective, but has some limitations when it comes to identifying immature stages of certain species. DNA-barcoding, using COI, has demonstrated potential for rapid and accurate identification of Calliphoridae, however, this gene does not reliably distinguish among some recently diverged species, raising questions about its use for delimitation of species of forensic importance. To facilitate DNA based identification of Calliphoridae in the Caribbean we developed a vouchered reference collection from across the region, and a DNA sequence database, and further added the nuclear ITS2 as a second marker to increase accuracy of identification through barcoding. We morphologically identified freshly collected specimens, did phylogenetic analyses and employed several species delimitation methods for a total of 468 individuals representing 19 described species. Our results show that combination of COI + ITS2 genes yields more accurate identification and diagnoses, and better agreement with morphological data, than the mitochondrial barcodes alone. All of our results from independent and concatenated trees and most of the species delimitation methods yield considerably higher diversity estimates than the distance based approach and morphology. Molecular data support at least 24 distinct clades within Calliphoridae in this study, recovering substantial geographic variation for Lucilia eximia, Lucilia retroversa, Lucilia rica and Chloroprocta idioidea, probably indicating several cryptic species. In sum, our study demonstrates the importance of employing a second nuclear marker for barcoding analyses and species delimitation of calliphorids, and the power of molecular data in combination with a complete reference database to enable identification of taxonomically and geographically diverse insects of forensic importance.

Entities:  

Keywords:  Calliphoridae; Caribbean; DNA-barcoding; Diptera; Forensic entomology

Year:  2017        PMID: 28761780      PMCID: PMC5531032          DOI: 10.7717/peerj.3516

Source DB:  PubMed          Journal:  PeerJ        ISSN: 2167-8359            Impact factor:   2.984


Introduction

Forensic entomology is the application of the study of insects in legal investigations. Although several groups of insects, mainly of the orders Diptera and Coleoptera, are associated with cadaveric decomposition, blow flies (Diptera: Calliphoridae) are among the most dominant and conspicuous insects in the decomposition process (Catts, 1992). They are useful to determine time of death and, in particular situations, cause of death (Goff, 2000) or relocation of a body (Matuszewski, Szafalowicz & Jarmusz, 2013). During the last five decades of intensive studies in forensic entomology (Byrd & Castner, 2010; Catts & Haskell, 1990; Goff, 2000; Smith, 1986; Tomberlin & Benbow, 2015), the acceptance of insects as evidence in legal investigations has increased gradually and they are now included as standard operating procedures in crime scene investigations in many countries (Tomberlin & Benbow, 2015). Determining the post mortem interval (PMI) is one of the most important tasks during an investigation, and the use of immature stages of Calliphoridae is essential whenever time of death is difficult to establish based on other means (Catts & Haskell, 1990). Although the accurate determination of PMI and period of insect activity (PIA) depend of several factors that are discussed in detail by Catts (1992), the first one, and most important to resolve, is the correct identification of the specimens found at the crime scene. As each species has a specific developmental rate and range of distribution, the accurate identification of insects, mainly the larval stages, is critical because the incorrect determination will invalidate the estimated post mortem interval and impact other interpretations of the evidence (Goff, 2000; Wells & LaMotte, 2001). Morphology is most commonly used to identify adult insects involved in cadaveric decomposition and taxonomic keys are available for most of the Calliphoridae species. In general, these taxonomic keys include the detailed description of the male and female genitalia, which is examined when external characteristics are not sufficient to establish identity (Tantawi, Whitworth & Sinclair, 2017; Whitworth, 2010; Whitworth, 2014; Whitworth & Rognes, 2012). Identification of immature stages (eggs, larvae and pupae) is more challenging, but possible when detailed taxonomic descriptions exist (Greenberg & Szyska, 1984; Sukontason et al., 2005; Szpila et al., 2013a; Szpila et al., 2014; Szpila & Villet, 2011; Wells, Byrd & Tantawi, 1999). However, in places like the Caribbean, where forensic entomology has not yet been developed, this approach is limited due to the lack of detailed descriptions of immature stages. For instance, from the 18 forensically important calliphorid species currently recognized in the Caribbean, plus the most important livestock pest parasite in the Americas, C. hominivorax (Whitworth, 2010), only eight have been documented well enough to be identified based on larvae, mainly using morphology of the third instar (Florez & Wolff, 2009; Wells, Byrd & Tantawi, 1999). For the other species, the identification of immature specimens would need to be done by rearing them to adulthood (Goff, 2000), which is time consuming, may delay legal investigations, and relies on the survival of larvae in the laboratory. Given local endemism, the scarce studies on this group in the Caribbean, and the lack of knowledge of immature stages for at least 11 species, developing alternative tools for identification is important. With the advances in molecular methods, DNA barcoding has become a widely used technique for species delimitation and identification. This approach allows the identification of specimens during any development stage, including incomplete or damaged specimens, does not require taxonomic expertise, and it is also useful to recognize cryptic species that morphological approaches may not detect (Hebert et al., 2003; Hebert et al., 2004a; Hebert et al., 2004b). Worldwide many authors have used this method to identify species of the family Calliphoridae and these studies showed the potential of the ‘standard barcoding gene’ cytochrome c oxidase subunit I (COI) to distinguish between forensically significant species (Aly & Wen, 2013; Chen et al., 2009; Harvey et al., 2003; Liu et al., 2011; Nelson, Wallman & Dowton, 2007; Wells & Williams, 2007). However, COI does not reliably distinguish among certain closely related calliphorid species, specifically Chrysomya saffranea and Ch. megacephala (Harvey et al., 2008; Nelson, Wallman & Dowton, 2007), Ch. semimetalica and Ch. latifrons (Nelson, Wallman & Dowton, 2007), Calliphora stygia and C. albifrontalis, C. dubia and C. augur (Harvey et al., 2008; Wallman & Donnellan, 2001), C. aldrichia and C. montana (Tantawi, Whitworth & Sinclair, 2017), Cochliomyia macellaria and Co. aldrichi (Yusseff-Vanegas & Agnarsson, 2016), Lucilia mexicana and L. coeruleiviridis (DeBry et al., 2013; Whitworth, 2014), L. bazini and L. hainanenesis (Chen et al., 2014), L. illustris and L. caesar (Reibe, Schmitz & Madea, 2009; Sonet et al., 2012), L. cuprina and L. sericata (Williams & Villet, 2013). Given the serious implications of misidentification of forensic insects, an improved protocol for accurate identification is necessary. We propose using the nuclear internal transcribed spacer ITS2 as a second barcoding locus for taxonomic species determinations in calliphorids as suggested by GilArriortua et al. (2014). Although evaluations of ITS2 as unique identification marker have limitations for some taxa (Agnarsson, 2010), several studies have shown the potential application of ITS2 for blowfly species identification (Jordaens et al., 2013a; Nelson, Wallman & Dowton, 2007; Nelson, Wallman & Dowton, 2008, Song, Wang & Liang, 2008; Yusseff-Vanegas & Agnarsson, 2016). We expect a combination of barcodes from the nuclear and mitochondrial genomes to offer a general, simple and reliable way of identifying forensically important insects, even problematic sister species, as successfully done in certain other arthropod groups (Anslan & Tedersoo, 2015; Cao et al., 2016). The success of DNA barcoding directly links to the quality of the underlying database (Candek & Kuntner, 2015; Coddington et al., 2016; DeBry et al., 2013; Harvey et al., 2003) not only in terms of the quality of identifications but also in terms of taxon sampling (species, geographic localities, populations). Existing efforts in this respect are lacking for Calliphoridae in the Caribbean, limiting the reliability of this technique for delimitation of species. Hitherto, three studies have included molecular data of a few Calliphoridae from the Caribbean (McDonagh, Garcia & Stevens, 2009; Whitworth, 2014; Yusseff-Vanegas & Agnarsson, 2016); they lack the geographic variation necessary to estimate the ratio between intraspecific variation and interspecific divergence from which barcoding accuracy depends (Meyer & Paulay, 2005). Our study provides the first thorough molecular study of Caribbean Calliphoridae. Our aims are: (1) to establish COI barcode libraries for all Caribbean species and to test if barcodes offer reliable means of their identification, (2) to assess the usefulness of ITS2 as a second barcoding locus in species delimitation and identification, and, (3) to improve online databases with sequences from the Caribbean, including specimens from multiple localities in each island covering the geographic range for each species. To achieve these goals, we sampled 468 specimens of Calliphoridae representing 19 species.

Specimen details, collection information and GenBank accession numbers.

* Estimated coordinate points. ∧ Accession numbers from BOLD systems. – blank. Notes. Whitworth (2014). (Stamper et al., 2012, unpublished data). Jordaens et al. (2013b).

Methods

Specimens and DNA extraction

A total of 473 specimens were included in this study. Of these, 468 represented ingroup taxa and five represented outgroup taxa from the family Sarcophagidae (Sarcophaga Carnaria Linnaeus, 1758; Neobellieria bullata Parker, 1916; Ravinia stimulans Walker, 1849; Blaesoxipha masculina Aldrich, 1916 and Blaesoxipha alcedo Aldrich, 1916). We used a total of 600 DNA sequences and we obtained 521 (COI  = 398, ITS2  = 123) while 79 (COI  = 44, ITS2  = 35) were previously published (Table 1). The specimens were collected throughout the Caribbean (Fig. 1) from between 2011 and 2013 (see Table 1 for details). All specimens were collected under appropriate permits: USA, Florida, Everglades, United States Department of the Interior National Park Service EVER-2013-SCI-0028; Puerto Rico, DRNA: 2011-IC-035 (O-VS-PVS15-SJ-00474-08042011); Jamaica, NEPA, reference number #18/27; USA, USDI National Park Service, EVER-2013-SCI-0028; Costa Rica, SINAC, pasaporte científico no. 05933, resolución no. 019-2013-SINAC; Cuba, Departamento de Recursos Naturales, PE 2012/05, 2012003 and 2012001; Dominican Republic, Ministerio de Medio Ambiente y Recursos Naturales, no 0577; Colombia, Authoridad Nacional de Licencias Ambientales, 18.497.666 issued to Alexander Gómez Mejía; Saba, The Executive Council of the Public Entity Saba, no 112/2013; Martinique, Ministère de L’Écologie, du Développement Durable, et de L‘Énergie; Nevis, Nevis Historical & Conservation Society, no F001; Barbados, Ministry of Environment and Drainage, no 8434∕56∕1 Vol. II. Although L. vulgata, L. mexicana and L. coeruleiviridis are not present in the Caribbean islands, they are included as outgroups to the Calliphoridae from the West Indies. James (1970) reported L. coeruleiviridis from Cuba, however, this is likely an error as no specimens have been seen in collections from the region (Whitworth, 2010) and no specimens were collected during this study. All specimens, except the ones from Mexico, were collected using a novel trap designed for this study. We modified a standard butterfly trap by adding a conic form on the top with a vessel attached to the highest point like in the Malaise trap. Flies entered the trap attracted by the bait (chicken) and funneled into the collecting vessel containing 95% ethanol. Traps were hung 1m off the ground and were used to collect flies for 2–3 days at each locality. These traps proved efficient in collecting specimens for our molecular purposes, given that caught specimens were preserved in ethanol while the trap remained in the field. Collected specimens were transferred to Whirl-paks with 95% ethanol and stored at −20 °C. Adults were identified using the Whitworth (2010) taxonomic keys and the specimens with uncertain identity were sent to Dr. Whitworth at Washington State University for detailed examination and species confirmation. DNA was isolated from thoracic muscle or two legs of each individual with the QIAGEN DNeasy Tissue Kit (Qiagen, Inc., Valencia, CA). The remainder of the specimen was retained as a voucher currently held by the Agnarsson Lab; they will be placed in the Zadock Thompson Zoological Collections at the UVM Natural History Museum following completion of other studies currently being conducted using the material.
Table 1

Specimen details, collection information and GenBank accession numbers.

* Estimated coordinate points. ∧ Accession numbers from BOLD systems. – blank.

GenusSpeciesVoucher IDCountryLatitudeLongitudeCOIITS2
CalliphoramaestricaDR084HispaniolaN18.82138W70.67935 MF097182 MF097580
CalliphoramaestricaDR085HispaniolaN18.82138W70.67935 MF097183
CalliphoramaestricaDR086HispaniolaN18.82138W70.67935 MF097184
CalliphoramaestricaDR087HispaniolaN18.82138W70.67935 MF097185
CalliphoramaestricaDR088HispaniolaN18.82138W70.67935 MF097186 MF097581
ChloroproctaidioideaCU008CubaN20.054178W76.917603 MF097187 MF097582
ChloroproctaidioideaCU047CubaN21.582414W77.783464 MF097188 MF097583
ChloroproctaidioideaCU048CubaN21.582414W77.783464 MF097189 MF097584
ChloroproctaidioideaCU049CubaN21.582414W77.783464 MF097190
ChloroproctaidioideaDR031HispaniolaN18.316572W71.576447* MF097191
ChloroproctaidioideaDR044HispaniolaN18.316572W71.576447* MF097192 MF097585
ChloroproctaidioideaDR045HispaniolaN18.316572W71.576447* MF097193
ChloroproctaidioideaDR051HispaniolaN19.06753W69.46445 MF097194
ChloroproctaidioideaDR052HispaniolaN19.06753W69.46445 MF097195 MF097586
ChloroproctaidioideaME001MexicoN21.07645W89.501083 MF097587
ChloroproctaidioideaME002MexicoN21.07645W89.501083 MF097196 MF097588
ChrysomyaalbicepsCO003ColombiaN5.900544W74.852897* MF097589
ChrysomyaalbicepsCO004ColombiaN5.900544W74.852897* MF097590
ChrysomyaalbicepsCO005ColombiaN5.900544W74.852897* MF097591
ChrysomyaalbicepsLA103MartiniqueN14.47428W60.81463 MF097199 MF097592
ChrysomyaalbicepsLA104MartiniqueN14.47428W60.81463 MF097200 MF097593
ChrysomyaalbicepsLA125Saint LuciaN14.100031W60.92654 MF097201 MF097594
ChrysomyaalbicepsLA135BarbadosN13.2051667W59.5295556 MF097197
ChrysomyaalbicepsLA136BarbadosN13.2051667W59.5295556 MF097198
ChrysomyamegacephalaCO006ColombiaN5.900544W74.852897* MF097202 MF097595
ChrysomyamegacephalaCO007ColombiaN5.900544W74.852897* MF097596
ChrysomyamegacephalaCO008ColombiaN6.266242W77.374903* MF097203 MF097597
ChrysomyamegacephalaCO009ColombiaN5.900544W74.852897* MF097598
ChrysomyamegacephalaDR017HispaniolaN19.89155W071.65806 MF097205
ChrysomyamegacephalaDR018HispaniolaN19.89155W071.65806 MF097206
ChrysomyamegacephalaDR068HispaniolaN19.06710W69.46004 MF097207
ChrysomyamegacephalaDR069HispaniolaN19.06710W69.46004 MF097208
ChrysomyamegacephalaDR101HispaniolaN18.35698W68.61609 MF097209
ChrysomyamegacephalaDR102HispaniolaN18.35698W68.61609 MF097210
ChrysomyamegacephalaDR103HispaniolaN18.35698W68.61609 MF097211
ChrysomyamegacephalaDR104HispaniolaN18.35698W68.61609 MF097212
ChrysomyamegacephalaDR116HispaniolaN18.32902W68.80995 MF097213 MF097599
ChrysomyamegacephalaDR117HispaniolaN18.32902W68.80995 MF097214 MF097611
ChrysomyamegacephalaDR118HispaniolaN18.32902W68.80995 MF097215
ChrysomyamegacephalaDR119HispaniolaN18.32902W68.80995 MF097216
ChrysomyamegacephalaFL003Florida, USAN25.614383W80.584467 KX529521 KX529561
ChrysomyamegacephalaFL004Florida, USAN25.614383W80.584467 MF097218
ChrysomyamegacephalaFL011Florida, USAN25.086633W80.452217 MF097219
ChrysomyamegacephalaJA004JamaicaN18.0598056W77.5311944 MF097600
ChrysomyamegacephalaLA062DominicaN15.34066W61.33351 MF097220
ChrysomyamegacephalaLA001Saint EustatiusN17.47637W62.97470 MF097225
ChrysomyamegacephalaLA003Saint EustatiusN17.47637W62.97470 MF097217
ChrysomyamegacephalaLA025Saint-MartinN18.07779W63.05772 MF097235
ChrysomyamegacephalaLA055Saint BarthélemyN17.91924W62.86366 MF097234
ChrysomyamegacephalaLA063DominicaN15.34066W61.33351 MF097204
ChrysomyamegacephalaLA088GuadeloupeN16.37752W61.47869 MF097221
ChrysomyamegacephalaLA089GuadeloupeN16.37752W61.47869 MF097222
ChrysomyamegacephalaLA093NevisN17.14145W62.57784 MF097226
ChrysomyamegacephalaLA116Saint KittsN17.3404083W62.7410389 MF097223
ChrysomyamegacephalaLA117Saint KittsN17.3404083W62.7410389 MF097224
ChrysomyamegacephalaLA123Saint LuciaN14.100031W60.92654 MF097604
ChrysomyamegacephalaME013MexicoN25.598592W103.441156 MF097601
ChrysomyamegacephalaME014MexicoN25.598592W103.441156 MF097602
ChrysomyamegacephalaPR038Puerto RicoN18.412972W66.026619 MF097227
ChrysomyamegacephalaPR124Puerto RicoN18.370953W66.026619 MF097228
ChrysomyamegacephalaPR125Puerto RicoN18.370953W66.026619 MF097229 MF097603
ChrysomyamegacephalaPR1251Puerto RicoN18.370953W66.026619 MF097230
ChrysomyamegacephalaPR126Puerto RicoN18.370953W66.026619 MF097231
ChrysomyamegacephalaPR138Puerto RicoN18.447911W65.948617 MF097232
ChrysomyamegacephalaPR139Puerto RicoN18.447911W65.948617 MF097233
ChrysomyarufifaciesLA056Saint BarthélemyN17.91924W62.86366 MF097236
ChrysomyarufifaciesLA057Saint BarthélemyN17.91924W62.86366 MF097237
ChrysomyarufifaciesCU001CubaN20.054178W76.917603 MF097238
ChrysomyarufifaciesCU003CubaN20.054178W76.917603 MF097239
ChrysomyarufifaciesCU004CubaN20.054178W76.917603 KX529555 KX529562
ChrysomyarufifaciesCU005CubaN20.054178W76.917603 MF097240
ChrysomyarufifaciesCU009CubaN20.054178W76.917603 MF097241
ChrysomyarufifaciesCU034CubaN22.621386W83.725944 MF097242
ChrysomyarufifaciesCU035CubaN22.621386W83.725944 MF097243
ChrysomyarufifaciesCU036CubaN22.621386W83.725944 MF097244
ChrysomyarufifaciesCU037CubaN22.621386W83.725944 MF097245
ChrysomyarufifaciesDR001HispaniolaN19.89155W71.65806 MF097248
ChrysomyarufifaciesDR002HispaniolaN19.89155W71.65806 MF097249
ChrysomyarufifaciesDR003HispaniolaN19.89155W71.65806 MF097250
ChrysomyarufifaciesDR004HispaniolaN19.89155W71.65806 MF097251
ChrysomyarufifaciesDR006HispaniolaN19.89155W71.65806 MF097252
ChrysomyarufifaciesDR007HispaniolaN19.89155W71.65806 MF097253
ChrysomyarufifaciesDR008HispaniolaN19.89155W71.65806 MF097254
ChrysomyarufifaciesDR016HispaniolaN19.89155W71.65806 MF097255
ChrysomyarufifaciesDR036HispaniolaN18.316572W71.576447* MF097256
ChrysomyarufifaciesDR037HispaniolaN18.316572W71.576447* MF097257
ChrysomyarufifaciesDR038HispaniolaN18.316572W71.576447* MF097258
ChrysomyarufifaciesDR039HispaniolaN18.316572W71.576447* MF097259
ChrysomyarufifaciesDR070HispaniolaN19.06710W69.46004 MF097260
ChrysomyarufifaciesDR071HispaniolaN19.06710W69.46004 MF097261 MF097605
ChrysomyarufifaciesDR0711HispaniolaN19.06710W69.46004 MF097606
ChrysomyarufifaciesDR093HispaniolaN18.35698W68.61609 MF097262
ChrysomyarufifaciesDR094HispaniolaN18.35698W68.61609 MF097263
ChrysomyarufifaciesDR095HispaniolaN18.35698W68.61609 MF097264
ChrysomyarufifaciesDR096HispaniolaN18.35698W68.61609 MF097265
ChrysomyarufifaciesDR097HispaniolaN18.35698W68.61609 MF097266
ChrysomyarufifaciesDR098HispaniolaN18.35698W68.61609 MF097267
ChrysomyarufifaciesDR099HispaniolaN18.35698W68.61609 MF097268
ChrysomyarufifaciesDR100HispaniolaN18.35698W68.61609 MF097269
ChrysomyarufifaciesDR132HispaniolaN18.32902W68.80995 MF097270
ChrysomyarufifaciesDR133HispaniolaN18.32902W68.80995 MF097271
ChrysomyarufifaciesDR135HispaniolaN19.741319W70.654975* MF097272
ChrysomyarufifaciesDR150HispaniolaN19.34405W70.14824 MF097273
ChrysomyarufifaciesDR151HispaniolaN19.34405W70.14824 MF097274
ChrysomyarufifaciesDR152HispaniolaN19.34405W70.14824 MF097275
ChrysomyarufifaciesDR155HispaniolaN19.34405W70.14824 MF097276
ChrysomyarufifaciesDR157HispaniolaN18.32902W68.80995 MF097277
ChrysomyarufifaciesDR158HispaniolaN18.32902W68.80995 MF097278
ChrysomyarufifaciesDR159HispaniolaN18.32902W68.80995 MF097279
ChrysomyarufifaciesDR160HispaniolaN18.32902W68.80995 MF097280
ChrysomyarufifaciesDR161HispaniolaN18.32902W68.80995 MF097281
ChrysomyarufifaciesDR162HispaniolaN18.32902W68.80995 MF097282
ChrysomyarufifaciesDR163HispaniolaN18.32902W68.80995 MF097283
ChrysomyarufifaciesFL001Florida, USAN25.614383W80.584467 MF097288
ChrysomyarufifaciesFL010Florida, USAN25.086633W80.452217 MF097289 MF097607
ChrysomyarufifaciesJA003JamaicaN18.0598056W77.5311944 MF097293 MF097608
ChrysomyarufifaciesLA002Saint EustatiusN17.47637W62.97470 MF097284
ChrysomyarufifaciesLA004Saint EustatiusN17.47637W62.97470 MF097285
ChrysomyarufifaciesLA005Saint EustatiusN17.47637W62.97470 MF097286
ChrysomyarufifaciesLA006Saint EustatiusN17.47637W62.97470 MF097287
ChrysomyarufifaciesLA041Saint-MartinN18.11677W63.03902 MF097316
ChrysomyarufifaciesLA042Saint-MartinN18.11677W63.03902 MF097317
ChrysomyarufifaciesLA043Saint-MartinN18.11677W63.03902 MF097318
ChrysomyarufifaciesLA044Saint-MartinN18.11677W63.03902 MF097319
ChrysomyarufifaciesLA069DominicaN15.34066W61.33351 MF097246
ChrysomyarufifaciesLA072DominicaN15.34066W61.33351 MF097247
ChrysomyarufifaciesLA090GuadeloupeN16.37752W61.47869 MF097290
ChrysomyarufifaciesLA091GuadeloupeN16.37752W61.47869 MF097291
ChrysomyarufifaciesLA092GuadeloupeN16.37752W61.47869 MF097292
ChrysomyarufifaciesLA101MartiniqueN14.47428W60.81463 MF097310
ChrysomyarufifaciesLA108MontserratN16.77608W62.30904 MF097309
ChrysomyarufifaciesLA110Saint KittsN17.3404083W62.7410389 MF097294 MF097609
ChrysomyarufifaciesM074Mona, Puerto RicoN18.086239W67.906339 MF097295
ChrysomyarufifaciesM075Mona, Puerto RicoN18.086239W67.906339 MF097296
ChrysomyarufifaciesM082Mona, Puerto RicoN18.11125W67.933447 MF097297
ChrysomyarufifaciesM083Mona, Puerto RicoN18.11125W67.933447 MF097298
ChrysomyarufifaciesM089Mona, Puerto RicoN18.06301W67.88728 MF097299
ChrysomyarufifaciesM090Mona, Puerto RicoN18.06301W67.88728 MF097300
ChrysomyarufifaciesM091Mona, Puerto RicoN18.06301W67.88728 MF097301
ChrysomyarufifaciesM093Mona, Puerto RicoN18.084222W67.939417 MF097302
ChrysomyarufifaciesM094Mona, Puerto RicoN18.084222W67.939417 MF097303
ChrysomyarufifaciesM095Mona, Puerto RicoN18.084222W67.939417 MF097304
ChrysomyarufifaciesM096Mona, Puerto RicoN18.084222W67.939417 MF097305
ChrysomyarufifaciesM101Mona, Puerto RicoN18.084222W67.939417 MF097306
ChrysomyarufifaciesM108Mona, Puerto RicoN18.11125W67.933447 MF097307
ChrysomyarufifaciesM109Mona, Puerto RicoN18.11125W67.933447 MF097308
ChrysomyarufifaciesPR117Puerto RicoN18.370953W66.026619 MF097311
ChrysomyarufifaciesPR118Puerto RicoN18.370953W66.026619 MF097312
ChrysomyarufifaciesPR119Puerto RicoN18.370953W66.026619 MF097313
ChrysomyarufifaciesPR120Puerto RicoN18.370953W66.026619 MF097314
ChrysomyarufifaciesPR130Puerto RicoN18.093306W65.556083 MF097315 MF097610
CochliomyiaaldrichiM080Mona, Puerto RicoN18.084222W65.939417 KX529529 KX529563
CochliomyiaaldrichiM084Mona, Puerto RicoN18.11125W67.933447 MF097320
CochliomyiaaldrichiM085Mona, Puerto RicoN18.11125W67.933447 KX529530 KX529564
CochliomyiaaldrichiM086Mona, Puerto RicoN18.06301W67.88728 KX529531 KX529565
CochliomyiaaldrichiM087Mona, Puerto RicoN18.06301W67.88728 MF097321
CochliomyiaaldrichiM088Mona, Puerto RicoN18.06301W67.88728 MF097322
CochliomyiaaldrichiM102Mona, Puerto RicoN18.11125W67.933447 MF097323
CochliomyiaaldrichiM103Mona, Puerto RicoN18.11125W67.933447 KX529532 KX529566
CochliomyiaaldrichiM104Mona, Puerto RicoN18.085972W67.933447 MF097324
CochliomyiaaldrichiM105Mona, Puerto RicoN18.085972W67.933447 KX529533 KX529567
CochliomyiaaldrichiM106Mona, Puerto RicoN18.084222W67.939417 MF097325
CochliomyiaaldrichiM107Mona, Puerto RicoN18.084222W67.939417 KX529534 KX529568
CochliomyiahominivoraxCO001ColombiaN5.900544W74.852897* MF097612
CochliomyiahominivoraxCU020CubaN22.621386W83.725944 MF097613
CochliomyiahominivoraxCU033CubaN22.621386W83.725944 KX529556 KX529571
CochliomyiahominivoraxDR042HispaniolaN18.316572W71.576447* KX529557 KX529572
CochliomyiahominivoraxDR105HispaniolaN18.35698W68.61609 KX529558 KX529573
CochliomyiamacellariaLA137Saint BarthélemyN17.910299W62.847221 MF097326
CochliomyiamacellariaLA139Saint BarthélemyN17.910299W62.847221 MF097327
CochliomyiamacellariaCO002ColombiaN5.900544W74.852897* KX529522 KX529574
CochliomyiamacellariaCO010ColombiaN6.266242W77.374903* KX529545 KX529575
CochliomyiamacellariaCU012CubaN22.621386W83.725944 MF097330
CochliomyiamacellariaCU013CubaN22.621386W83.725944 MF097331
CochliomyiamacellariaCU014CubaN22.621386W83.725944 KX529541 KX529577
CochliomyiamacellariaCU015CubaN22.621386W83.725944 MF097332
CochliomyiamacellariaCU016CubaN22.621386W83.725944 MF097333
CochliomyiamacellariaCU017CubaN22.621386W83.725944 MF097334
CochliomyiamacellariaCU018CubaN22.621386W83.725944 KX529526 KX529578
CochliomyiamacellariaCU019CubaN22.621386W83.725944 MF097335 MF097614
CochliomyiamacellariaCU050CubaN21.582414W77.750131 MF097336
CochliomyiamacellariaCU051CubaN21.582414W77.750131 MF097337
CochliomyiamacellariaDR009HispaniolaN19.89155W71.65806 MF097341
CochliomyiamacellariaDR010HispaniolaN19.89155W71.65806 KX529536 KX529579
CochliomyiamacellariaDR011HispaniolaN19.89155W71.65806 MF097342
CochliomyiamacellariaDR012HispaniolaN19.89155W71.65806 MF097343
CochliomyiamacellariaDR013HispaniolaN19.89155W71.65806 MF097344
CochliomyiamacellariaDR014HispaniolaN19.89155W71.65806 MF097345
CochliomyiamacellariaDR015HispaniolaN19.89155W71.65806 MF097346
CochliomyiamacellariaDR043HispaniolaN18.316572W71.576447* MF097347
CochliomyiamacellariaDR062HispaniolaN19.06710W69.46004 MF097348
CochliomyiamacellariaDR063HispaniolaN19.06710W69.46004 MF097349
CochliomyiamacellariaDR064HispaniolaN19.06710W69.46004 MF097350
CochliomyiamacellariaDR065HispaniolaN19.06710W69.46004 MF097351
CochliomyiamacellariaDR066HispaniolaN19.06710W69.46004 MF097352
CochliomyiamacellariaDR106HispaniolaN18.35698W68.61609 MF097353
CochliomyiamacellariaDR107HispaniolaN18.35698W68.61609 MF097354
CochliomyiamacellariaDR108HispaniolaN18.35698W68.61609 MF097355
CochliomyiamacellariaDR109HispaniolaN18.35698W68.61609 MF097356
CochliomyiamacellariaDR1091HispaniolaN18.35698W68.61609 MF097357
CochliomyiamacellariaDR120HispaniolaN18.32902W68.80995 MF097358
CochliomyiamacellariaDR121HispaniolaN18.32902W68.80995 MF097359
CochliomyiamacellariaDR134HispaniolaN19.741319W70.654975* KX529527 KX529580
CochliomyiamacellariaDR154HispaniolaN19.34405W70.14824 MF097360
CochliomyiamacellariaFL006Florida, USAN25.614383W80.584467 MF097615
CochliomyiamacellariaFL009Florida, USAN25.457514W80.4863 MF097361
CochliomyiamacellariaJA002JamaicaN18.0598056W77.5311944 MF097616
CochliomyiamacellariaLA022Saint-MartinN18.07779W63.05772 MF097384
CochliomyiamacellariaLA023Saint-MartinN18.07779W63.05772 MF097385
CochliomyiamacellariaLA024Saint-MartinN18.07779W63.05772 MF097386
CochliomyiamacellariaLA032Saint-MartinN18.11677W63.03902 MF097387
CochliomyiamacellariaLA033Saint-MartinN18.11677W63.03902 MF097388
CochliomyiamacellariaLA034Saint-MartinN18.11677W63.03902 MF097389
CochliomyiamacellariaLA035Saint-MartinN18.11677W63.03902 MF097390
CochliomyiamacellariaLA036Saint-MartinN18.11677W63.03902 MF097391
CochliomyiamacellariaLA049Saint BarthélemyN17.91924W62.86366 MF097371
CochliomyiamacellariaLA0491Saint BarthélemyN17.91924W62.86366 MF097372
CochliomyiamacellariaLA050Saint BarthélemyN17.91924W62.86366 MF097373
CochliomyiamacellariaLA053Saint BarthélemyN17.91924W62.86366 MF097383
CochliomyiamacellariaLA054Saint BarthélemyN17.91924W62.86366 MF097374
CochliomyiamacellariaLA066DominicaN15.34066W61.33351 MF097338
CochliomyiamacellariaLA067DominicaN15.34066W61.33351 MF097339
CochliomyiamacellariaLA068DominicaN15.34066W61.33351 MF097340
CochliomyiamacellariaLA071DominicaN15.34066W61.33351 KX529525 KX529583
CochliomyiamacellariaLA079GuadeloupeN16.37752W61.47869 MF097362
CochliomyiamacellariaLA080GuadeloupeN16.37752W61.47869 MF097363
CochliomyiamacellariaLA081GuadeloupeN16.37752W61.47869 MF097364
CochliomyiamacellariaLA094NevisN17.14145W62.57784 MF097368
CochliomyiamacellariaLA096MartiniqueN14.47428W60.81463 KX529524 KX529584
CochliomyiamacellariaLA097MartiniqueN14.47428W60.81463 MF097367
CochliomyiamacellariaLA115Saint KittsN17.3404083W62.7410389 MF097365
CochliomyiamacellariaLA118Saint KittsN17.3404083W62.7410389 MF097392
CochliomyiamacellariaLA131BarbudaN17.6054722W61.8005833 MF097328
CochliomyiamacellariaLA132BarbudaN17.6054722W61.8005833 MF097329
CochliomyiamacellariaLA138Saint BarthélemyN17.897522W62.849694 MF097375
CochliomyiamacellariaLA140Saint BarthélemyN17.897522W62.849694 MF097376
CochliomyiamacellariaLA141Saint BarthélemyN17.897522W62.849694 MF097377
CochliomyiamacellariaLA142Saint BarthélemyN17.897522W62.849694 KX529523 KX529592
CochliomyiamacellariaLA143Saint BarthélemyN17.897522W62.849694 MF097378
CochliomyiamacellariaLA144Saint BarthélemyN17.897522W62.849694 MF097379
CochliomyiamacellariaLA145Saint BarthélemyN17.897522W62.849694 MF097380
CochliomyiamacellariaLA146Saint BarthélemyN17.897522W62.849694 MF097381
CochliomyiamacellariaLA147Saint BarthélemyN17.897522W62.849694 MF097382
CochliomyiamacellariaME015MexicoN25.598592W103.441156 MF097617
CochliomyiamacellariaM077Mona, Puerto RicoN18.086239W67.906339 KX529539 KX529585
CochliomyiamacellariaM081Mona, Puerto RicoN18.11125W67.933447 KX529537 KX529586
CochliomyiamacellariaM112Mona, Puerto RicoN18.11125W67.933447 KX529544 KX529589
CochliomyiamacellariaME004MexicoN21.07645W89.501083 MF097366
CochliomyiamacellariaPR029Puerto RicoN17.961111W66.863806 MF097369
CochliomyiamacellariaPR047Puerto RicoN18.178722W66.488111 MF097370
CochliomyiamacellariaPR121Puerto RicoN18.370953W66.026619 KX529544 KX529589
CochliomyiamacellariaPR128Puerto RicoN18.093306W65.552111 KX529540 KX529590
CochliomyiamacellariaPR129Puerto RicoN18.093306W65.552111 KX529542 KX529591
CochliomyiaminimaCU010CubaN20.054178W76.917603 MF097393
CochliomyiaminimaCU021CubaN22.621386W83.725944 MF097394
CochliomyiaminimaCU022CubaN22.621386W83.725944 KX529549 KX529593
CochliomyiaminimaCU023CubaN22.621386W83.725944 KX529550 KX529594
CochliomyiaminimaCU024CubaN22.621386W83.725944 MF097395
CochliomyiaminimaCU025CubaN22.621386W83.725944 MF097396
CochliomyiaminimaCU026CubaN22.621386W83.725944 MF097397
CochliomyiaminimaCU027CubaN22.621386W83.725944 MF097398
CochliomyiaminimaCU043CubaN20.517817W74.65865 MF097399
CochliomyiaminimaCU044CubaN20.517817W74.65865 MF097400
CochliomyiaminimaCU045CubaN20.517817W74.65865 MF097401
CochliomyiaminimaCU046CubaN20.517817W74.65865 KX529547 KX529595
CochliomyiaminimaDR026HispaniolaN19.04995W70.89046 MF097402
CochliomyiaminimaDR027HispaniolaN19.04995W70.89046 MF097403
CochliomyiaminimaDR028HispaniolaN19.04995W70.89046 MF097404
CochliomyiaminimaDR029HispaniolaN19.04995W70.89046 MF097405
CochliomyiaminimaPR013HispaniolaN18.316572W71.576447* MF097406
CochliomyiaminimaDR032HispaniolaN18.316572W71.576447* MF097407
CochliomyiaminimaDR033HispaniolaN18.316572W71.576447* MF097408
CochliomyiaminimaDR034HispaniolaN18.316572W71.576447* MF097409
CochliomyiaminimaDR035HispaniolaN18.316572W71.576447* MF097410
CochliomyiaminimaDR053HispaniolaN19.06753W69.46445 MF097411
CochliomyiaminimaDR054HispaniolaN19.06753W69.46445 MF097412
CochliomyiaminimaDR055HispaniolaN19.06753W69.46445 KX529552 KX529596
CochliomyiaminimaDR056HispaniolaN19.06753W69.46445 MF097413
CochliomyiaminimaDR067HispaniolaN19.06710W69.46004 MF097414
CochliomyiaminimaDR072HispaniolaN19.34864W70.14910 MF097415
CochliomyiaminimaDR073HispaniolaN19.34864W70.14910 MF097416
CochliomyiaminimaDR074HispaniolaN19.34864W70.14910 MF097417
CochliomyiaminimaDR075HispaniolaN19.34864W70.14910 MF097418
CochliomyiaminimaDR076HispaniolaN19.34864W70.14910 MF097419
CochliomyiaminimaDR136HispaniolaN19.741319W70.654975 KX529548 KX529597
CochliomyiaminimaDR137HispaniolaN19.741319W70.654975 MF097420
CochliomyiaminimaDR138HispaniolaN19.741319W70.654975 MF097421
CochliomyiaminimaDR139HispaniolaN19.741319W70.654975 MF097422
CochliomyiaminimaDR153HispaniolaN19.34405W70.14824 MF097423
CochliomyiaminimaDR164HispaniolaN18.32902W68.80995 MF097424
CochliomyiaminimaPR006Puerto RicoN18.412972W66.727222 MF097425
CochliomyiaminimaPR007Puerto RicoN18.412972W66.727222 MF097426
CochliomyiaminimaPR016Puerto RicoN18.321333W65.818722 MF097427
CochliomyiaminimaPR018Puerto RicoN18.321333W65.818722 MF097428
CochliomyiaminimaPR019Puerto RicoN18.321333W65.818722 MF097429
CochliomyiaminimaPR041Puerto RicoN18.174722W66.491861 MF097430
CochliomyiaminimaPR131Puerto RicoN18.093306W65.552111 MF097431
CochliomyiaminimaPR132Puerto RicoN18.093306W65.552111 KX529553 KX529598
CochliomyiaminimaPR133Puerto RicoN18.093306W65.552111 KX529554 KX529599
CochliomyiaminimaPR140Puerto RicoN18.447911W65.948617 MF097432 MF097618
CochliomyiaminimaPR141Puerto RicoN18.447911W65.948617 KX529551 KX529600
CochliomyiaminimaPR145Puerto RicoN18.449889W65.595333 MF097433
CochliomyiaminimaPR146Puerto RicoN18.449889W65.595333 MF097434
LuciliacluviaFL005Florida, USAN25.614383W80.584467 MF097619
LuciliacluviaFL017Florida, USAN25.136917W80.94855 MF097436 MF097620
LuciliacluviaFL018Florida, USAN25.136917W80.94855 MF097621
LuciliacluviaFL019Florida, USAN25.323331W80.833094 MF097437
LuciliacluviaFL020Florida, USAN25.323331W80.833094 MF097438 MF097622
LuciliacluviaFL025Florida, USAN25.423053W80.679114 MF097439 MF097623
LuciliacluviaFL026Florida, USAN25.423053W80.679114 MF097440 MF097624
LuciliacluviaPR147Puerto RicoN18.429222W66.178022 MF097441 MF097625
LuciliacluviaPR148Puerto RicoN18.429222W66.178022 MF097442 MF097626
LuciliacoeruleiviridisFL007Florida, USAN25.457514W80.4863 MF097627
LuciliacoeruleiviridisFL013Florida, USAN25.136917W80.94885 MF097443 MF097628
LuciliacoeruleiviridisFL014Florida, USAN25.136917W80.94855 MF097629
LuciliacoeruleiviridisFL015Florida, USAN25.136917W80.94885 MF097444 MF097630
LuciliacoeruleiviridisFL016Florida, USAN25.136917W80.94885 MF097445 MF097631
LuciliacoeruleiviridisFL023Florida, USAN25.457514W80.4863 MF097446 MF097632
LuciliacoeruleiviridisFL024Florida, USAN25.457514W80.4863 MF097447 MF097633
LuciliacuprinaFL027Florida, USAN25.457514W80.4863 MF097448 MF097634
LuciliacuprinaFL028Florida, USAN25.457514W80.4863 MF097449 MF097635
LuciliacuprinaFL029Florida, USAN25.457514W80.4863 MF097450 MF097636
LuciliacuprinaFL030Florida, USAN25.457514W80.4863 MF097451 MF097637
LuciliacuprinaPR070Puerto RicoN18.370953W66.026619 MF097452
LuciliacuprinaPR071Puerto RicoN18.370953W66.026619 MF097453
LuciliacuprinaPR072Puerto RicoN18.370953W66.026619 MF097454
LuciliacuprinaPR073Puerto RicoN18.370953W66.026619 KX529559 KX529602
LuciliacuprinaPR122Puerto RicoN18.370953W66.026619 MF097455 MF097638
LuciliacuprinaPR123Puerto RicoN18.370953W66.026619 MF097456
LuciliacuprinaPR153Puerto RicoN18.461053W66.729803 MF097457
LuciliacuprinaPR154Puerto RicoN18.461053W66.729803 MF097458 MF097639
LuciliaeximiaCO011ColombiaN5.900544W74.852897* MF097459
LuciliaeximiaCO012ColombiaN5.900544W74.852897* MF097460 MF097640
LuciliaeximiaCO013ColombiaN5.900544W74.852897* MF097461 MF097641
LuciliaeximiaCO015ColombiaN5.900544W74.852897* MF097462 MF097642
LuciliaeximiaCO016ColombiaN5.900544W74.852897* MF097643
LuciliaeximiaCO022ColombiaN6.067217W73.645411 MF097463 MF097644
LuciliaeximiaCO023ColombiaN6.067217W73.645411 MF097464 MF097645
LuciliaeximiaCU002CubaN20.054178W76.917603 MF097646
LuciliaeximiaCU006CubaN20.054178W76.917603 MF097647
LuciliaeximiaDR019HispaniolaN19.89155W071.65806 MF097467 MF097650
LuciliaeximiaDR049HispaniolaN18.316572W71.576447* MF097468
LuciliaeximiaDR050HispaniolaN18.316572W71.576447 MF097651
LuciliaeximiaDR129HispaniolaN18.32902W68.80995 MF097469
LuciliaeximiaFL021Florida, USAN25.086633W80.452217 MF097470 MF097652
LuciliaeximiaFL022Florida, USAN25.086633W80.452217 MF097471 MF097653
LuciliaeximiaLA064DominicaN15.34066W61.33351 MF097465 MF097648
LuciliaeximiaLA065DominicaN15.34066W61.33351 MF097466 MF097649
LuciliaeximiaLA124Saint LuciaN14.100031W60.92654 MF097483 MF097665
LuciliaeximiaLA126Saint LuciaN14.100031W60.92654 MF097666
LuciliaeximiaLA127Saint LuciaN14.100031W60.92654 MF097484 MF097667
LuciliaeximiaM076Mona, Puerto RicoN18.086239W67.906339 MF097472 MF097654
LuciliaeximiaM099Mona, Puerto RicoN18.084222W67.939417 MF097473
LuciliaeximiaM100Mona, Puerto RicoN18.084222W67.939417 MF097474
LuciliaeximiaM110Mona, Puerto RicoN18.11125W67.933447 MF097475 MF097655
LuciliaeximiaM111Mona, Puerto RicoN18.11125W67.933447 MF097476 MF097656
LuciliaeximiaME005MexicoN21.07645W89.501083 MF097477 MF097657
LuciliaeximiaME006MexicoN21.07645W89.501083 MF097658
LuciliaeximiaME007MexicoN21.07645W89.501083 MF097478 MF097659
LuciliaeximiaPR050Puerto RicoN18.449889W66.595333 MF097479 MF097660
LuciliaeximiaPR060Puerto RicoN17.971611W66.865361 MF097480 MF097661
LuciliaeximiaPR111Mona, Puerto RicoN18.11125W67.933447 MF097662
LuciliaeximiaPR114Puerto RicoN18.370953W66.026619 MF097481
LuciliaeximiaPR134Puerto RicoN18.093306W65.552111 MF097663
LuciliaeximiaPR135Puerto RicoN18.093306W65.552111 MF097664
LuciliaeximiaPR150Puerto RicoN18.084222W67.939417 MF097482
LuciliafayeaeM079Mona, Puerto RicoN18.084222W67.939417 MF097485 MF097668
LuciliafayeaePR008Puerto RicoN18.412972W67.727222 MF097486 MF097669
LuciliafayeaePR012Puerto RicoN18.412972W67.727222 MF097487
LuciliafayeaePR020Puerto RicoN18.321333W65.818722 MF097488
LuciliafayeaePR022Puerto RicoN18.321333W65.818722 MF097489
LuciliafayeaePR023Puerto RicoN18.293444W65.791917 MF097490 MF097670
LuciliafayeaePR045Puerto RicoN18.174722W66.491861 MF097491 MF097671
LuciliafayeaePR053Puerto RicoN18.449889W66.595333 MF097492 MF097672
LuciliafayeaePR116Puerto RicoN18.370953W66.032175 MF097493
LucilialucigerensJA005JamaicaN18.0598056W77.5311944 MF097494 MF097673
LucilialucigerensJA006JamaicaN18.0598056W77.5311944 MF097495
LucilialucigerensJA007JamaicaN18.0598056W77.5311944 MF097496 MF097674
LuciliamexicanaME016MexicoN25.598592W103.441156 MF097497 MF097675
LuciliamexicanaME020MexicoN25.598592W103.441156 MF097498 MF097676
LuciliamexicanaME021MexicoN25.598592W103.441156 MF097499 MF097677
LuciliaretroversaCU007CubaN20.054178W76.917603 MF097500 MF097678
LuciliaretroversaCU028CubaN22.621386W83.725944 MF097501
LuciliaretroversaCU029CubaN22.621386W83.725944 MF097502
LuciliaretroversaCU030CubaN22.621386W83.725944 MF097503 MF097679
LuciliaretroversaCU031CubaN22.621386W83.725944 MF097504
LuciliaretroversaCU038CubaN20.517817W20.517817 MF097505
LuciliaretroversaCU039CubaN20.517817W20.517817 MF097506
LuciliaretroversaCU040CubaN20.517817W20.517817 MF097507
LuciliaretroversaCU041CubaN20.517817W20.517817 MF097508 MF097680
LuciliaretroversaCU042CubaN20.517817W20.517817 MF097509
LuciliaretroversaDR020HispaniolaN19.04871W70.88084 MF097510
LuciliaretroversaDR021HispaniolaN19.04871W70.88084 MF097511
LuciliaretroversaDR022HispaniolaN19.04871W70.88084 MF097512
LuciliaretroversaDR023HispaniolaN19.04871W70.88084 MF097513
LuciliaretroversaDR024HispaniolaN19.04871W70.88084 MF097514 MF097681
LuciliaretroversaDR025HispaniolaN19.04871W70.88084 MF097515
LuciliaretroversaDR030HispaniolaN19.04871W70.88084 MF097516
LuciliaretroversaDR040HispaniolaN18.316572W71.576447 MF097517
LuciliaretroversaDR046HispaniolaN18.316572W71.576447 MF097518
LuciliaretroversaDR047HispaniolaN18.316572W71.576447 MF097519
LuciliaretroversaDR048HispaniolaN18.316572W71.576447 MF097520
LuciliaretroversaDR057HispaniolaN19.06753W69.46445 MF097521
LuciliaretroversaDR058HispaniolaN19.06753W69.46445 MF097522
LuciliaretroversaDR059HispaniolaN19.06753W69.46445 MF097523
LuciliaretroversaDR060HispaniolaN19.06753W69.46445 MF097524
LuciliaretroversaDR061HispaniolaN19.06753W69.46445 MF097525
LuciliaretroversaDR079HispaniolaN19.34864W70.14910 MF097526
LuciliaretroversaDR080HispaniolaN19.34864W70.14910 MF097527
LuciliaretroversaDR081HispaniolaN19.34864W70.14910 MF097528
LuciliaretroversaDR082HispaniolaN19.34864W70.14910 MF097529
LuciliaretroversaDR083HispaniolaN19.34864W70.14910 MF097530
LuciliaretroversaDR089HispaniolaN19.34864W70.14910 MF097531
LuciliaretroversaDR090HispaniolaN19.34864W70.14910 MF097532
LuciliaretroversaDR091HispaniolaN19.34864W70.14910 MF097533
LuciliaretroversaDR092HispaniolaN19.34864W70.14910 MF097534
LuciliaretroversaDR111HispaniolaN18.35698W68.61609 MF097535
LuciliaretroversaDR110HispaniolaN18.35698W68.61609 MF097536
LuciliaretroversaDR112HispaniolaN18.35698W68.61609 MF097537
LuciliaretroversaDR122HispaniolaN18.32902W68.80995 MF097538
LuciliaretroversaDR123HispaniolaN18.32902W68.80995 MF097539 MF097682
LuciliaretroversaDR124HispaniolaN18.32902W68.80995 MF097540 MF097683
LuciliaretroversaDR125HispaniolaN18.32902W68.80995 MF097541
LuciliaretroversaDR126HispaniolaN18.32902W68.80995 MF097542
LuciliaretroversaDR128HispaniolaN18.32902W68.80995 MF097543
LuciliaretroversaDR140HispaniolaN19.741319W70.654975* MF097544
LuciliaretroversaDR141HispaniolaN19.741319W70.654975* MF097545
LuciliaretroversaDR142HispaniolaN18.09786W71.18925 MF097546
LuciliaretroversaDR143HispaniolaN18.09786W71.18925 MF097547
LuciliaretroversaDR144HispaniolaN18.09786W71.18925 MF097548
LuciliaretroversaDR145HispaniolaN18.09786W71.18925 MF097549
LuciliaretroversaDR146HispaniolaN18.09786W71.18925 MF097550
LuciliaretroversaDR147HispaniolaN18.09786W71.18925 MF097551
LuciliaretroversaDR148HispaniolaN18.09786W71.18925 MF097552
LuciliaricaLA007Saint EustatiusN17.47637W62.97470 MF097558
LuciliaricaLA008Saint EustatiusN17.47637W62.97470 MF097559
LuciliaricaLA009Saint EustatiusN17.47637W62.97470 MF097684
LuciliaricaLA010Saint EustatiusN17.47637W62.97470 MF097560
LuciliaricaLA016Saint-MartinN18.07779W63.05772 MF097572
LuciliaricaLA017Saint-MartinN18.07779W63.05772 MF097573 MF097697
LuciliaricaLA026SabaN17.63980W63.23373 MF097435
LuciliaricaLA027SabaN17.63980W63.23373 MF097692
LuciliaricaLA028SabaN18.07779W63.05772 MF097569 MF097693
LuciliaricaLA037Saint-MartinN18.11677W63.03902 MF097574
LuciliaricaLA045Saint BarthélemyN17.91924W62.86366 MF097570 MF097694
LuciliaricaLA061Saint BarthélemyN17.91924W62.86366 MF097571 MF097696
LuciliaricaLA073NevisN17.14145W62.57784 MF097567 MF097690
LuciliaricaLA074NevisN17.14145W62.57784 MF097568 MF097691
LuciliaricaLA098MartiniqueN14.47428W60.81463 MF097565 MF097688
LuciliaricaLA099MartiniqueN14.47428W60.81463 MF097566 MF097689
LuciliaricaLA106MontserratN16.77608W62.30904 MF097564 MF097687
LuciliaricaLA114Saint KittsN17.3404083W62.7410389 MF097563
LuciliaricaLA128AntiguaN17.0358611W61.8246389 MF097553
LuciliaricaLA129AntiguaN17.0358611W61.8246389 MF097554
LuciliaricaLA130AntiguaN17.0358611W61.8246389 MF097555
LuciliaricaLA133BarbudaN17.6054722W61.8005833 MF097556
LuciliaricaLA134BarbudaN17.6054722W61.8005833 MF097557
LuciliaricaLA083GuadeloupeN16.37752W61.47869 MF097561 MF097685
LuciliaricaLA087GuadeloupeN16.37752W61.47869 MF097562 MF097686
LuciliaricaTLW042Antigua and BarbudaAs publisheda BNNR042
LuciliaricaTLW043Antigua and BarbudaAs publisheda BNNR043
LuciliaricaTLW044Antigua and BarbudaAs publisheda BNNR044
LuciliaricaTLW046Antigua and BarbudaAs publisheda BNNR046
Luciliasp.CO027ColombiaN6.067217W73.645411 MF097575 MF097698
LuciliavulgataCO019ColombiaN6.067217W73.645411 MF097576 MF097699
LuciliavulgataCO025ColombiaN6.067217W73.645411 MF097577 MF097700
LuciliavulgataCO026ColombiaN6.067217W73.645411 MF097578 MF097701
LuciliavulgataCO028ColombiaN6.067217W73.645411 MF097579 MF097702
Outgroups
NeobellieriabullataBG64As publishedb JQ807156.1
RaviniastimulansAZ60As publishedb JQ807112.1
SarcophagacarnariaNICC0410As publishedc JQ582094.1
BlaesoxiphaalcedoAY09As publishedb JQ806830.1
BlaesoxiphamasculinaAW36As publishedb JQ806832.1

Notes.

Whitworth (2014).

(Stamper et al., 2012, unpublished data).

Jordaens et al. (2013b).

Figure 1

Map of collecting localities of all specimens used for the molecular analysis.

(Image credit: https://commons.wikimedia.org/wiki/File:Caribbean_map_blank.png#filelinks).

Map of collecting localities of all specimens used for the molecular analysis.

(Image credit: https://commons.wikimedia.org/wiki/File:Caribbean_map_blank.png#filelinks).

PCR amplification and sequencing

A region of the mitochondrial genome encoding COI was amplified in a single fragment using the primers LCO1490 (Folmer et al., 1994), and C1-N-2776 (Hedin & Maddison, 2001). Those primers amplified successfully in all Calliphoridae except Lucilia Robineau-Desvoidy. From the eight Caribbean species of Lucilia, only Lucilia retroversa amplified successfully using these primers. For the remaining Lucilia species two different primer-pairs were used. The Primer 1 (Gibson et al., 2011) with C1-N-2191 (Simon et al., 1994) and the C1-J-1751 (Gibson et al., 2011) with C2-N-3014. For the second internal transcribed spacer ITS2 we used the primers ITS4 and ITS5.8 (White et al., 1990). The primer sequences and protocols are listed in Table 2. Amplified fragments were sequenced in both directions by University of Arizona Genetics Core. Sequences were interpreted from chromatograms using Phred and Phrap (Green, 1999; Green & Ewing, 2002) using the Chromaseq module (Maddison & Maddison, 2010a) in Mesquite 3.03 (Maddison & Maddison, 2010b) with default parameters. The sequences were then proofread by examining chromatograms by eye. Alignments were done using MAFFT (Katoh et al., 2002) through the online portal EMBL-EBI with default settings. The matrices were exported to Mesquite 3.03 (Maddison & Maddison, 2010b) and the translation of coding sequences to proteins for COI were checked for potential errors.
Table 2

COI amplification primers and protocols.

Primer nameSequence (5′–3′)ProtocolSource protocol
IDCYDANEFE
LCO1490FGGTCAACAAATCATAAAGATATTGG95 °C 2 min3595 °C 30 s44 °C 45 s72 °C 45 s72 °C 10 minAgnarsson, Maddison & Aviles (2007)
CI-N-2776RGGATAATCAGAATATCGTCGAGG
Primer 1FTACAATTTATCGCCTAAACTTCAGCC95 °C 3 min3594 °C 15 s51 °C 15 s72 °C 30 s72 °C 5 minDeBry et al. (2013)
C1-N-2191RCCCGGTAAAATTAAAATATAAACTTC
C1-J-1751FGGAGCTCCTGACATAGCATTCCC94 °C 90 s3694 °C 22 s48 °C 30 s72 °C 80 s72 °C 60 sHarvey et al. (2003)
C2-N-3014RTCCATTGCACTAATCTGCCATATTA
ITS4FTCCTCCGCTTATTGATATGC94 °C 2 min3894 °C 30 s44 °C 35 s72 °C 30 s72 °C 3 minAgnarsson (2010)
ITS5.8RGGGACGATGAAGAACGCAGC

Notes.

Forward

Reverse

Initial denaturation

cycles

Denaturation

annealing

Extension

Final extension

Notes. Forward Reverse Initial denaturation cycles Denaturation annealing Extension Final extension

Phylogenetic analysis

The COI gene was partitioned by codon positions, each partition and ITS2 gene were exported from Mesquite for model choice. The appropriate models were chosen using jModeltest v2.1.4 (Posada & Crandall, 1998), and the AIC criterion (Posada & Buckley, 2004). The corresponding model of evolution was used for the Bayesian analysis: GTR + Γ + I for COI1st, F81+ I for COI2nd, GTR + Γ for COI3rd and HKY + Γ + I for ITS2. We ran the MC3(Metropolis Coupled Markov Chain Monte Carlo) chain in MrBayes v3.2.3 (Huelsenbeck & Ronquist, 2001) through the online portal Cipres Science Gateway v3.3 (Miller, Pfeiffer & Schwartz, 2010). The analysis was run for 20,000,000 generations, sampling every 1,000 generations, and the sample points of the first 5,000,000 generations were discarded as ‘burnin’, after which the chains had reached stationarity as determined by analysis in Tracer (Rambaut & Drummond, 2009). Maximum likelihood (ML) analysis of the concatenated matrix was done in Garli (Zwickl, 2006) using the same partitioning scheme and models. Sequences were submitted to GenBank and BOLD.

Species delimitation

We used MEGA6 to calculate genetic distances within and among species level clades suggested by the barcoding analysis of the COI data and by morphology. We used the species delimitation plugin in Geneious 8.1.5 (Kearse et al., 2012; Masters, Fan & Ross, 2011) to estimate species limits under Rosenberg’s reciprocal monophyly P(AB) (Rosenberg, 2007) and Rodrigo’s P(RD) method (Rodrigo et al., 2008). For this analysis we used a 317 taxa subset of our data, produced by reducing the most densely sampled species like Co. minima, Co. macellaria, Ch. rufifacies and L. retroversa to 38 exemplars since P(RD) probability cannot be computed when there are more than 40 exemplars per clade. We also estimated the probability of population identification of a hypothetical sample based on the groups being tested P ID (Strict) and P ID (Liberal). The genealogical sorting index (gsi) statistic (Cummings, Neel & Shaw, 2008) was calculated using the gsi webserver (http://genealogicalsorting.org) on the estimated tree. As genetic distances in MEGA6, gsi and species delimitation metrics from Geneious require a priory species designation, 26 putative species were assigned to the data based on combined analysis of phylogenetic topology from COI and morphological and geographic information. Finally, we used a single locus Bayesian implementation (bPTP) of the Poisson tree processes model (Zhang et al., 2013) to infer putative species boundaries on a given single locus phylogenetic input tree available on the webserver: http://species.h-its.org/ptp/. The analysis was run as a rooted tree from the MrBayes analysis, for 500,000 generations with 10% burnin removed. For gsi and bPTP analysis we reduced the data to 103 taxa representing the 26 putative species because of limitations of the server.

Summary of the Bayesian tree based on the COI dataset including 442 individuals, with the results of four different species delimitation approaches in addition to morphology, genetic distances of >2% mtDNA, ITS2 and the concatenated matrix.

See Fig. S1 for bootstrap support values.

Results

We present by far the most extensive DNA barcoding dataset of Calliphoridae from the Caribbean. It includes a ∼1,200 bp fragment of the mitochondrial COI gene from 437 Calliphoridae specimens and ∼450 bp of the ITS2 gene from 158 specimens chosen to represent unique COI haplotypes of all putative species and all localities (20 different islands in the Caribbean plus Florida, Colombia and Mexico). Ninety nine of the sequences are from specimens collected in the mainland and the other 496 are from the Caribbean Islands. In total, we included 19 species of Calliphoridae identified morphologically (Whitworth, 2006; Whitworth, 2010), 16 of them reported from the Caribbean and three species, L. coeruleiviridis, L. mexicana and L. vulgata, from the mainland. The sequences from the Caribbean represent 16 of the 18 species of forensically important Calliphoridae that occur in the West Indies plus one of the most important livestock pest parasites in the Americas, C. hominivorax (Whitworth, 2010). The two species not included in this dataset are reported from Bahamas (Phormia regina) and Trinidad (Hemilucilia segmentaria), where we were not able to sample. For most species we included numerous exemplars, covering the geographic range of each species in the region.

Species delimitation using COI

Although based on traditional taxonomy we recognized 19 species of Calliphoridae in this study, COI gene analyses suggest that the diversity of Calliphoridae in the Caribbean is greater than morphology can detect. The phylogenetic analysis of COI recuperates 24 distinct clades (Fig. 2, Fig. S1), showing substantial geographic variation for L. eximia (four clades), C. idioidea (three clades), L. retroversa (two clades) and L. rica (two clades). However, COI did not distinguish between the pairs, Co. macellaria and Co. aldrichi from the Caribbean and L. coeruleiviridis and L. mexicana from the mainland. These four species are clearly identifiable based on morphological characteristics. Most putative species lineages showed genetic distances >2.7% (Table 3) and most of them are separated by a barcoding gap (Table 4). All species delimitation methods supported Ca. maestrica, C. idioidea-DR, Co. minima, Co. hominivorax, Ch. albiceps, Ch. rufifacies, Ch. megacephala, L. cluvia, L. cuprina, L. eximia-CO+ME, L. eximia-LA, Lucilia eximia-GA L. lucigerens, Lucilia retroversa-DR, and L. rica 1 and 2 (Fig. 2, Table 5); however, the other eight putative species were poorly supported in our analyses. Lower divergences, between 0.5 and 1.2% were found between clades, L. coeruleiviridis+L. mexicana, L. vulgata and L. eximia-FL, L. fayeae and L. retroversa CU, and between L. rica 1 and 2 (Table 3). All but bPTP methods of species determination supported L. eximia-FL clade, L. vulgata, L. fayeae, L. retroversa-CU (Table 5). Regarding C. idioidea, the Cuban and Mexico species-clades are only supported by bPTP and P ID (liberal). The bPTP analysis estimated between 21 and 29 species including the initial 26 putative species. Other species delimitation methods showed similar results, 22 putative species had P ID (liberal) higher of 89, 20 had significant Rosenberg values and 21 had GSI values of 100. All species determination methods fail in distinguishing between the pairs Co. macellaria and Co. aldrichi, and L. coeruleiviridis and L. mexicana as sequence divergences between species pairs are extremely low <0.08%. Given that no one method can distinguish between these species, the addition of ITS2 as a second barcoding locus was necessary to clarify the monophyly and validity of these species and increase the confidence of delimitation and identification of species with low genetic divergences.
Figure 2

Summary of the Bayesian tree based on the COI dataset including 442 individuals, with the results of four different species delimitation approaches in addition to morphology, genetic distances of >2% mtDNA, ITS2 and the concatenated matrix.

See Fig. S1 for bootstrap support values.

Table 3

Genetic distances expressed in percentage among the 26 putative species groups as determined by an analysis in MEGA6.

Putative species1234567891011121314151617181920212223242526
1Ca. maestrica
2C. idioidea-CU16.3
3C. idioidea-DR15.32.8
4C. idioidea-ME15.62.12.1
5Ch. albiceps15.513.813.113.1
6Ch. megacephala14.49.510.610.25.7
7Ch. rufifacies15.514.514.114.12.86.7
8Co. aldrichi14.410.69.59.910.29.212.0
9Co. hominivorax13.78.79.18.011.59.812.68.4
10Co. macellaria14.410.69.59.910.39.212.00.18.4
11Co. minima15.710.510.510.29.88.811.04.29.74.2
12L.. cluvia11.111.412.112.114.911.414.512.411.612.413.7
13L.. coeruleiviridis12.111.313.413.415.912.715.211.712.611.611.44.6
14L. cuprina11.69.29.510.213.19.513.810.611.910.611.28.28.5
15L. eximia-CO-ME12.412.311.712.414.011.814.012.813.012.813.45.47.17.6
16L. vulgata11.411.312.712.715.912.715.911.712.611.712.03.90.78.56.4
17L. eximia-FL11.611.012.412.415.512.414.812.012.411.911.14.81.28.76.91.2
18L. eximia-GA13.512.013.414.114.512.715.212.713.712.713.07.14.99.57.44.95.5
19L. eximia-LA12.111.39.911.313.111.313.811.711.511.612.34.36.06.72.65.35.86.4
20L. fayeae13.211.212.612.613.511.713.912.610.912.613.34.74.98.45.74.95.45.64.5
21L. lucigerens11.911.712.412.414.511.714.112.711.912.712.73.24.97.83.74.24.86.03.24.2
22L. mexicana12.111.313.413.415.912.715.211.712.611.611.44.60.08.57.10.71.24.96.04.94.9
23L. retroversa-CU13.711.212.612.614.012.214.412.611.412.613.35.24.88.45.64.85.45.34.50.54.14.8
24L. retroversa-DR13.512.413.113.114.813.414.512.713.312.713.44.05.09.25.44.34.85.74.62.83.65.02.7
25L. rica_113.912.112.111.614.811.914.713.011.113.013.66.16.88.26.66.16.67.55.45.05.46.84.75.0
26L. rica_213.411.911.911.214.711.614.812.610.712.613.35.66.38.06.45.66.17.35.65.65.26.35.35.31.0

Notes.

Colombia

Cuba

Dominican Republic

Florida

Greater Antilles

Lesser Antilles

Mexico

Table 4

Genetic distances within the 26 putative species groups, as determined by an analysis in MEGA6.

The values are expressed as a percentage.

Putative species% variation within species
Ca. maestrica0.14
C. idioidea-CU0.00
C. idioidea-DR0.00
C. idioidea-MEn/a
Ch. albiceps0.00
Ch. megacephala0.00
Ch. rufifacies0.01
Co. aldrichi0.00
Co. hominivorax0.24
Co. macellaria0.15
Co. minima0.29
L.. cluvia0.10
L.. coeruleiviridis0.00
L. cuprina0.00
L. eximia-CO-ME0.61
L. vulgata0.00
L. eximia-FL1.06
L. eximia-GA0.00
L. eximia-LA0.00
L. fayeae0.14
L. lucigerens0.00
L. mexicana0.00
L. retroversa-CU0.18
L. retroversa-DR0.08
L. rica_10.40
L. rica_20.15

Notes.

Colombia

Cuba

Dominican Republic

Florida

Greater Antilles

Lesser Antilles

Mexico

Table 5

Results of species delimitation analysis based on COI.

The various measures of distance, isolation and exclusivity metrics of these clades follow including: (D), the probability of population identification of a hypothetical sample based on the groups being tested (P ID (Strict) and P ID (Liberal)), Rosenberg’s reciprocal monophyly (P(AB)), the genealogical sorting index (gsi), and a single locus Bayesian implementation of the Poisson tree processes model (bPTP). Sp congru. refers to species hypothesis that are congruent with all methods, and Sp cons. is our conservative estimate of actual species richness based on agreement among all methods and >2% mtDNA sequence divergence. Morph refers to species richness based morphology and Concat. refers to species richness based on the concatenated tree.

Putative speciesMonoD IntraD InterDtra/ DterP ID(Strict)P ID(Liberal)P(AB)GSIbPTPSp congruSp consMorphConcat
1. C. maestricayes0.0010.0960.010.93 (0.80, 1.0)0.98 (0.88, 1.0)NAN1Y1111
2. C. idioidea-CUyes0.00090.0120.070.74 (0.57, 0.92)0.97 (0.82, 1.0)0.171Y2222
3. C. idioidea-MEyesn/a0.012n/an/a0.96 (0.83, 1.0)0.17NAY
4. C. idioidea-DRyes0.0030.0140.190.81 (0.68, 0.93)0.95 (0.85, 1.0)1.98E −031Y333
5. Co. aldrichino0.00080.0020.460.82 (0.75, 0.89)0.95 (0.91, 0.99)NA0.39N4434
6. Co. macellariano0.0030.0021.470.00 (0.00, 0.00)0.31 (0.28, 0.34)NA0.61N45
7. Co. minimayes0.0020.0300.070.97 (0.92, 1.0)0.99 (0.96, 1.0)6.30E −271Y5556
8. Co. hominivoraxyes0.0040.0660.070.75 (0.57, 0.92)0.97 (0.83, 1.0)1.90E −071Y6667
9. Ch. albicepsyes0.0020.0330.050.90 (0.77, 1.0)0.97 (0.87, 1.0)4.90E −081Y7778
10. Ch. rufifaciesyes0.00090.0330.030.99 (0.93, 1.0)1.00 (0.97, 1.0)4.90E −081Y8889
11. Ch. megacephalayes0.0010.0540.020.99 (0.94, 1.0)1.00 (0.97, 1.0)1.40E −241Y99910
12. L. cluviayes0.0020.0330.070.91 (0.81, 1.0)0.98 (0.92, 1.0)7.10E −121Y10101011
13. L. coeruleiviridisno0.00080.00081.120.18 (0.05, 0.31)0.49 (0.38, 0.59)NA0.59N11111112
14. L. mexicanano0.00070.00080.880.20 (0.02, 0.39)0.51 (0.36, 0.66)NA0.49N1213
15. L. eximia-FLyes0.0020.0050.400.39 (0.24, 0.54)0.74 (0.58, 0.89)0.031N1314
16. L. vulgatayes0.0020.0070.320.65 (0.51, 0.79)0.89 (0.78, 1.0)0.031N1415
17. L. eximia-ME-COyes0.0040.0160.270.82 (0.71, 0.92)0.93 (0.87, 0.99)3.60E −041Y121216
18. L. eximia-LAyes0.0020.0160.120.79 (0.64, 0.93)0.95 (0.84, 1.0)3.60E −041Y1313
19. L. fayeaeyes0.0020.0080.310.82 (0.73, 0.91)0.94 (0.89, 0.99)2.40E −061N14141517
20. L. retroversa-CUyes0.0040.0080.460.75 (0.67, 0.84)0.92 (0.87, 0.97)2.40E −061N1618
21. L. retroversa-DRyes0.0020.0240.090.96 (0.91, 1.0)0.99 (0.96, 1.0)2.60E −141Y151519
22. L. lucigerensyes0.0020.0350.050.76 (0.58, 0.94)0.98 (0.84, 1.0)9.90E −071Y16161720
23. L. eximia-GAyes0.0010.0480.030.98 (0.91, 1.0)1.00 (0.96, 1.0)1.30E −111Y171721
24. L. rica_1yes0.0030.0110.240.90 (0.83, 0.96)0.97 (0.92, 1.0)4.40E −091Y18181822
25. L. rica_2yes0.0020.0110.220.90 (0.83, 0.97)0.97 (0.92, 1.0)4.40E −091Y1923
26. L. cuprinayes0.0020.0760.030.98 (0.91, 1.0)1.00 (0.96, 1.0)4.30E −191Y20191924

Notes.

Colombia

Cuba

Dominican Republic

Florida

Greater Antilles

Lesser Antilles

Mexico

Notes. Colombia Cuba Dominican Republic Florida Greater Antilles Lesser Antilles Mexico

Genetic distances within the 26 putative species groups, as determined by an analysis in MEGA6.

The values are expressed as a percentage. Notes. Colombia Cuba Dominican Republic Florida Greater Antilles Lesser Antilles Mexico

Results of species delimitation analysis based on COI.

The various measures of distance, isolation and exclusivity metrics of these clades follow including: (D), the probability of population identification of a hypothetical sample based on the groups being tested (P ID (Strict) and P ID (Liberal)), Rosenberg’s reciprocal monophyly (P(AB)), the genealogical sorting index (gsi), and a single locus Bayesian implementation of the Poisson tree processes model (bPTP). Sp congru. refers to species hypothesis that are congruent with all methods, and Sp cons. is our conservative estimate of actual species richness based on agreement among all methods and >2% mtDNA sequence divergence. Morph refers to species richness based morphology and Concat. refers to species richness based on the concatenated tree. Notes. Colombia Cuba Dominican Republic Florida Greater Antilles Lesser Antilles Mexico

Phylogenetic inference

From the 26 putative species analyzed here, 25 were represented by multiple individuals and one by a single individual in the COI analysis. All phylogenetic analyses (COI, ITS2, COI+ITS2) yielded well resolved trees with strong posterior probability support for most of the branches and broadly agreed on species limits but with some differences in topology (Figs. 2–4, Figs. S1–S3). The Bayesian analysis of the ITS2 supported the monophyly of 21 of 26 putative species. It recovered the monophyly of Co. aldrichi, Co. macellaria, L. mexicana and L. coeruleiviridis, which failed with all other analysis. However it did not recover the geographic variation of C. idioidea from Mexico and Dominican Republic, L. retroversa from Cuba and Dominican Republic or L. rica 1 and 2, and it only recovers three of the four L. eximia clades indicated by COI analyses (Fig. 3, Fig. S2). The concatenated tree supports 24 of the 26 putative species including two clades within L. retroversa, L. rica, and C. idioidea, and three clades within L. eximia. The concatenated matrix did not support the monophyly of C. idioidea-CU that is nested within C. idioidea-ME and L. eximia-CO+ME nested within L. eximia-LA (Fig. 4, Fig. S3).
Figure 4

Bayesian tree based on the concatenate dataset including 137 specimens.

Individual terminal taxa have been replaced with species names, while full taxon clade structure is retained. Colors represent different species based on morphology. See Fig. S3 for bootstrap support values.

Figure 3

Bayesian tree based on ITS2 dataset including 158 specimens.

Individual terminal taxa have been replaced with species names, while full taxon clade structure is retained. Colors represent different species based on morphology. See Fig. S2 for bootstrap support values.

Discussion

Accurate identification of insects is a crucial step to using them as reliable evidence in legal investigations. Although morphology has been successfully used to identify immature specimens involved in cadaveric decomposition (Cardoso et al., 2014; Florez & Wolff, 2009; Szpila et al., 2013a; Szpila et al., 2013b; Szpila et al., 2014; Szpila & Villet, 2011; Wells, Byrd & Tantawi, 1999), this approach depends on the availability of taxonomic keys of the species present in the region. In the Caribbean, the immature stages of 11 species are unknown and other approaches are needed in order to identify them. Besides this, morphology may overlook potentially cryptic species and cannot be used on incomplete or destroyed specimens found on a crime scene. Here, we show DNA barcoding to be useful in overcoming these problems and provide tools to accelerate the identification and discovery of species. This is particularly important in areas like the Caribbean, where studies of insects involved in cadaveric decomposition are scarce (Whitworth, 2010; Yusseff-Vanegas & Agnarsson, 2016; Yusseff-Vanegas, 2007; Yusseff-Vanegas, 2014). One of the first steps required for this approach is creating a reliable DNA barcode database that can be used with confidence in order to identify unknown specimens found in death scenes investigation (DeBry et al., 2013; Harvey et al., 2003).

Bayesian tree based on ITS2 dataset including 158 specimens.

Individual terminal taxa have been replaced with species names, while full taxon clade structure is retained. Colors represent different species based on morphology. See Fig. S2 for bootstrap support values.

Bayesian tree based on the concatenate dataset including 137 specimens.

Individual terminal taxa have been replaced with species names, while full taxon clade structure is retained. Colors represent different species based on morphology. See Fig. S3 for bootstrap support values. The success of DNA barcoding relies on the quality of the underlying database used to compare DNA sequences of new samples. A good database should contain DNA barcodes of expertly identified individuals, and preferably taxon sampling covering the distribution range of each species. Our study complies with both requirements and is the first thorough molecular study of Calliphoridae from the Caribbean. It includes a representative collection from all but two forensically relevant Calliphoridae from the region, and covers the whole geographic range of most of the investigated species (Table 1). All specimens in this study were carefully identified using traditional morphological taxonomy (Whitworth, 2006; Whitworth, 2010; Whitworth, 2014) and each individual was successfully allocated to one of the currently recognized calliphorid species, except for specimen CO027 that could only be identified to the genus level. Although morphological identification of specimens collected in this study corresponded to 19 previously reported species (Whitworth, 2010), our results based on molecular data indicate higher diversity. In all, 26 putative species lineages were identified, and in particular our results indicate that Lucilia and Chloroprocta are more diverse than suggested by current taxonomy. COI recovered substantial geographic variation for C. idioidea, L. eximia, L. retroversa and L. rica such that molecular data indicate up to eleven putative species lineages that cannot be, or at least have not been, recognized by morphology. Lucilia eximia is considered a widespread species found from the southern United States through Central America to southern South America (Whitworth, 2014). Nevertheless, our molecular results show four distinct genetic clusters with an average inter-cluster divergence from 2.5 to 7.4% (Table 3). The clusters are geographically structured and three of them are widely separated (Fig. 2, Fig. S1). The first one is the Greater Antilles cluster (GA) that includes specimens from Puerto Rico, Mona Island and Dominican Republic, the second is a small cluster that includes specimens from Florida (FL), the third one contains specimens from Colombia and Mexico (CO-MEX), and the fourth contains specimens from the Lesser Antilles islands of Dominica and Saint Lucia (LA). Similar results were reported by Solano, Wolff & Castrol (2013) and Whitworth (2014) where widely separate clades of L. eximia were found using DNA barcodes. All species delimitation methods supported the uniqueness and genetic isolation of the four clades, each showing low intra-clade divergence (<1%, Table 4), and thus likely representing four distinct species. Although we found some morphological variation between L. eximia from the mainland and islands and among islands as previously reported (James, 1967; Whitworth, 2010; Woodley & Hilburn, 1994), detailed revision of those specimens by Dr. Whitworth from Washington State University concluded that there is not enough evidence to separate them as different morphological species, suggesting they may be morphologically cryptic species. Further studies on these populations will be necessary to establish their taxonomic status. Lucilia rica was collected throughout the Lesser Antilles and is very abundant in most of the islands (personal observation). Although James (1970) listed this species from Puerto Rico, we did not find any specimens after very extensive collections on the island. Thus, we believe that L. rica is restricted to the Lesser Antilles and has not dispersed beyond Anguilla. Whitworth (2010) reported this species from Antigua, Bermuda, Guadalupe and St. Lucia; however, we found it in eight more islands (Table 1) and our data showed two geographic clusters (Figs. 2, 4; Figs. S1, S3). The first cluster (L. rica-1) contains specimens from St Martin, Saba, St. Eustatius, St. Kitts, Nevis and Martinique and the second one (L. rica 2) from Barbuda, Antigua, Montserrat and Guadeloupe. Although the genetic distance between clades is low (1%), it is much greater than the intra-clade divergences (<0.3%). While all species delimitation methods support the possibility of two different species (Tables 5 and 6), we did not find morphological evidence to support it. Nevertheless, given that this is the most abundant Lucilia species of the Lesser Antilles, additional studies on these populations are important to determine if the genetic difference is due to intraspecific variation or if they are cryptic species.
Table 6

Results of species delimitation analysis based on the concatenated tree.

(D), the probability of population identification of a hypothetical sample based on the groups being tested (P ID (Strict) and P ID (Liberal)), Rosenberg’s reciprocal monophyly (P(AB)).

Putative speciesClosest speciesMonoD IntraD InterDtra/ DterP ID(Strict)P ID(Liberal)P(AB)
1. Ca. maestricaL. cuprinayes0.0050.190.030.58 (0.43, 0.73)0.97 (0.82, 1.0)1.00E−05
2. L. cluviaL. coeruleiviridisyes0.0050.050.100.87 (0.74, 0.99)0.97 (0.87, 1.0)5.50E−09
3 L. coeruleiviridisL. eximia-FLyes0.0010.010.140.84 (0.72, 0.97)0.96 (0.86, 1.0)0.01
4. L. mexicanaL. coeruleiviridisyes0.00090.020.060.75 (0.58, 0.93)0.97 (0.83, 1.0)0.01
5. L. eximia-FLL. coeruleiviridisyes0.0050.010.480.34 (0.19, 0.50)0.69 (0.53, 0.84)4.94E−03
6. L. vulgataL. coeruleiviridisyes0.0030.020.180.75 (0.60, 0.89)0.94 (0.83, 1.0)0.1
7. L. eximiaCO-MEL. eximia-LAyes0.0060.020.320.79 (0.69, 0.90)0.92 (0.86, 0.99)0.01
8. L. fayeaeL. retroversa-CUyes0.0060.040.150.84 (0.71, 0.96)0.96 (0.86, 1.0)4.30E−04
9. L. retroversa-CUL. retroversa-DRyes0.0040.020.180.50 (0.35, 0.65)0.87 (0.72, 1.0)0.03
10. L. lucigerensL. eximia-LAyes0.0030.040.080.55 (0.40, 0.70)0.93 (0.78, 1.0)3.10E−04
11 L. eximia-GAL. rica 2yes0.0020.060.040.91 (0.78, 1.0)0.98 (0.87, 1.0)2.70E−06
12. L. rica 1L. rica 2yes0.0050.020.330.81 (0.72, 0.90)0.94 (0.88, 0.99)4.20E−04
13. L. rica 2L. rica 1yes0.0040.020.300.59 (0.42, 0.77)0.84 (0.69, 0.98)4.20E−04
14. L. cuprinaL. cluviayes0.0030.150.020.94 (0.83, 1.0)1.00 (0.94, 1.0)1.90E−11
15. Ch. albicepsCh. rufifaciesyes0.0030.040.060.75 (0.57, 0.93)0.97 (0.83, 1.0)2.98E−03
16. Ch. rufifaciesCh. albicepsyes0.0020.040.050.90 (0.78, 1.0)0.97 (0.87, 1.0)2.98E−03
17. Ch. megacephalaCh. albicepsyes0.0030.110.020.92 (0.79, 1.0)0.98 (0.87, 1.0)2.80E−05
18. Co. aldrichiCo. macellariayes0.0020.010.130.85 (0.72, 0.97)0.96 (0.86, 1.0)4.70E−07
19. Co. macellariaCo. aldrichiyes0.0070.010.520.84 (0.78, 0.89)0.96 (0.93, 0.99)4.70E−07
20. Co. minimaCo. aldrichiyes0.0070.050.140.88 (0.77, 0.99)0.96 (0.90, 1.0)4.50E−09
21. Co. hominivoraxCo. aldrichiyes0.0070.090.080.88 (0.76, 1.0)0.97 (0.87, 1.0)1.00E−07
22. C. idioidea-DRC. idioidea-MEyes0.0030.020.190.74 (0.60, 0.88)0.94 (0.83, 1.0)4.08E−03
23 C. idioidea-CUC. idioidea-MEyes0.0010.010.060.56 (0.41, 0.71)0.94 (0.79, 1.0)0.33
24: L. retroversa-DRL. retroversa-CUyes0.0040.020.160.76 (0.62, 0.90)0.94 (0.83, 1.0)0.03
25: C. idioidea-MEC. idioidea-CUno0.0050.010.380.40 (0.24, 0.55)0.75 (0.59, 0.90)NA
26. L. eximia-LAL. eximiaCO-MEno0.0070.020.360.63 (0.48, 0.77)0.88 (0.77, 0.99)NA

Notes.

Colombia

Cuba

Dominican Republic

Florida

Greater Antilles

Lesser Antilles

Mexico

For Lucilia retroversa we find two geographic clusters, one from Cuba and one from the Dominican Republic with an average mtDNA distance of 2.5% (Table 3) and with low intra-clade divergence (<0.2%, Table 4). Whitworth (2010) reported some morphological differences between specimens from Bahamas (which share morphology with Cuban specimens) and the Dominican Republic, but after examination of male and female genitalia he concluded that those differences were intraspecific variation. However, he noticed that our L. retroversa specimens have a brown basicosta instead of white or yellow basicosta which is an important character used to separate L. retroversa from other species (see taxonomic key in Whitworth, 2010). Given that all of our species delimitation results support two possible cryptic species, we recommend further detailed molecular and morphological studies of these populations to determine if they merit the description of a separate species.

Results of species delimitation analysis based on the concatenated tree.

(D), the probability of population identification of a hypothetical sample based on the groups being tested (P ID (Strict) and P ID (Liberal)), Rosenberg’s reciprocal monophyly (P(AB)). Notes. Colombia Cuba Dominican Republic Florida Greater Antilles Lesser Antilles Mexico Chloroprocta idioidea, the only species of Chloroprocta, is a widespread species found from southern North America to southern South America (Dear, 1985; Whitworth, 2010). Our results show that C. idioidea is also geographically structured into three clades: one from Dominican Republic, one from Cuba and one from Mexico (Fig. 2, Fig. S1). Analysis of the genetic divergence between clades show more than 2% divergence between the Cuba and Dominican Republic clades but less than 2% divergence between the Mexico and Cuba clades (Table 3). Some authors (Hall, 1948; Shannon, 1926) believed there were two species of the genus in the Americas, however (Dear, 1985) concluded that there was only one single widespread species that exhibits some color variations which is dependent upon geographic distribution. Our molecular results indicate at least two, and perhaps three, separate species of Chloroprocta. All species delimitation methods (Table 5) and the concatenated matrix (Fig. 4, Fig. S3) suggest that the Dominican Republic versus the Cuba and Mexico clade are separate species, but were ambiguous about the status of C. idioidea-CU that is nested within C. idioidea-ME. Cuban and Mexican specimens are morphologically similar, dark-bluish in color with brownish to orange legs, however, as reported by Dear (1985) the Cuban females have brownish, instead of yellow-white calypters. Our specimens from Dominican Republic are similar to the southern USA specimens described by Dear (1985) but have darker post spiracles and clear wings with only the costa faintly tinted. Although we could see morphological differences between populations, those differences were based on a limited number of specimens (e.g., five specimens from Dominican Republic and three from Mexico). Further studies with larger number of specimens of C. idioidea, including detailed morphological descriptions and expanded molecular analysis, are necessary to further test species limits within this genus. Our focus here is not to fully resolve calliphorid taxonomy. However, it is important to highlight the consequences of our findings for forensic entomology studies. Currently L. eximia is one of the most widespread and abundant Lucilia in the Neotropics (Whitworth, 2014). However, our results suggest that, in fact, this is not one widely distributed species, but potentially several species that differ in geographic range and possibly in biological traits (rates of development, diapause, habitat preference, feeding habits etc.). The same is true for L. retroversa and C. idioidea, both have genetically distinct clades in the Dominican Republic and in Cuba (Figs. 2 and 4). This finding will have direct consequences for the use of these species in legal investigations, if that variation reflects differences in behavior and biology, that can affect post mortem interval estimations (Tarone, Singh & Picard, 2015). Previous studies of Phormia regina (Byrd & Allen, 2001), C. macellaria and C. rufifacies (Yusseff-Vanegas, 2007) have shown that their developmental rate differ from different populations. Picard & Wells (2009) suggested that that variation is in part due to differences in population genetic structure, and for that reason, ecological data obtained from one population should not be generalized or extrapolated to other populations (Byrne et al., 1995). This is important at least for specimens collected in Cuba where both populations are present, probably as the result of recent dispersal of L. retroversa and C. idoidea from the Dominican Republic to Cuba. Our results (S1) show that two of the southeast Cuban specimens, CU007 (L. retroversa) and CU008 (C. idioidea), collected in Turquino National Park in Cuba (Table 1), cluster tightly with Dominican Republic specimens (S1). To confirm the genetic affinity of these specimens we added three more nuclear genes for a limited number of individuals from both populations and re-ran the analysis. The multi-gene analysis again strongly clustered CU007 and CU008 with the Dominican Republic specimens for each species. Thus, both the Dominican Republic and Cuban populations are clearly present in Cuba. COI recuperated substantial geographic variation with high COI sequences divergence between populations of Lucilia eximia, L. retroversa, L. rica and C. idioidea (Fig. 2, Fig. S1), suggesting the possibility of different species (Hebert et al., 2003; Hebert, Ratnasingham & deWaard, 2003). However, genetic variation is not always indicative of species differentiation. For instance, studies including Phormia regina have found that the genetic distance between N American and W European populations is higher than 4% (Boehme, Amendt & Zehner, 2012; Desmyter & Gosselin, 2009). But after detailed molecular and morphological analysis of both populations, Jordaens et al. (2013a) concluded that the high differentiation at COI, COII and cytb, but low (16S, nDNA) and lack of morphological differentiation, was indicative of substantial intraspecific mtDNA sequence divergence, rather than a species level differentiation. In light of those results, definite conclusions cannot yet be drawn regarding the taxonomy of these species. Further population level studies of the four species in question are therefore necessary. A comprehensive molecular analysis including several mitochondrial and nuclear genes in combination with morphological examination and detailed description of the genitalia, are required to determine if they are in fact different species, or if the genetic difference between populations is the product of intraspecific variation. Meanwhile the use of these species for forensic purposes should be evaluated carefully and with reference to genetic and behavioral differences among its populations. Regarding the other Calliphoridae species, Ca. maestrica, Co. minima, Co hominivorax, Ch. albiceps, Ch. rufifacies, Ch. megacephala, L. cluvia, L. cuprina and L. lucigerens, all showed reciprocal monophyly with strong posterior probability support and all can be successfully identified using the DNA barcoding approach. All species delimitation methods, phylogenetic analysis of ITS2, and the concatenated tree support their monophyly and species status, and the results are congruent with morphology. Calliphora maestrica is the only Calliphora species reported for the Caribbean and is endemic from the region. This species was originally described from Sierra Maestra region in Cuba (Peris et al., 1998) and later reported also from Jamaica and Dominican Republic (Whitworth, 2010). Although we collected on all three islands, we only found C. maestrica in Villa Pajon, Dominican Republic, a cold region at altitudes >2,140 m. We did not find it in Cuba or Jamaica, likely due to lack of sampling at altitudes above 1,200 m on both islands. The three species of Chrysomya were recently introduced to the New World (Baumgartner & Greenberg, 1984). Although Whitworth (2010) reported Ch. megacephala and Ch. rufifacies from Dominica, Dominican Republic, Jamaica and Puerto Rico, they are abundantly present in most of the islands being found from Cuba to Martinique (Table 1). In contrast, Chrysomya albiceps has more restricted distribution being found in islands closer to South America (Table 1, Whitworth, 2010). Although Dear (1985) reported this species from Puerto Rico, we did not find it after extensive collections on the island. That report was based on a single larva found in a goat, probably of Ch. albiceps but the species was not confirmed (Gagne, 1981). We believe that Ch. albiceps has not dispersed beyond Dominica and that the species reported by Dear (1985) was in fact Ch. rufifacies. Given the high dispersal abilities of the species of this genus (Baumgartner & Greenberg, 1984) and their invasive behavior (Aguiar-Coelho & Milward-De-Azevedo, 1998; De Andrade et al., 2002; Faria et al., 1999; Wells & Greenberg, 1992), it is not surprising to find them widely distributed and very well established throughout the Caribbean. They do not show any geographic structure, suggesting their recent colonization from the mainland and the constant gene flow among populations. Lucilia cluvia and L. cuprina, are widely distributed flies found in different parts of the world (Byrd & Castner, 2010). Lucilia cluvia is considered rare (Whitworth, 2010). Although it has been reported from several locations in Puerto Rico, Cuba, and Martinique, we have only found two specimens in a suburban area in Toa Baja, Puerto Rico. Lucilia cuprina is reported from several islands in the Caribbean, but we only found it in urban areas of Puerto Rico as our focus on other islands was in non-urban areas. Finally L. lucigerens is an endemic species from Jamaica and was collected abundantly throughout the island. DNA barcoding in animals typically employs a single mitochondrial marker for identification and delimitation of species (Hebert et al., 2003; Hebert, Ratnasingham & DeWaard, 2003), and this approach has shown to be useful in Calliphoridae species identification. However it does not reliably distinguish among some recently diverged species (Harvey et al., 2003; Nelson, Wallman & Dowton, 2007), leading to doubt that COI alone is sufficient for identification of species (Nelson, Wallman & Dowton, 2007; Wells, Wall & Stevens, 2007). Rather, the use of multiple markers has been suggested as a means to increase the accuracy of species identification. Indeed, our results show that COI barcoding successfully identified most species, but did not distinguish between the pairs L. mexicana and L. coeruleiviridis as previously reported (DeBry et al., 2013; Whitworth, 2014; Williams, Lamb & Villet, 2016) and between Co. aldrichi and Co. macellaria (Tables 3 and 5, Fig. S1 ). The latter species is considered one of the most important Calliphoridae for forensic studies in the Americas (see discussion in Yusseff-Vanegas & Agnarsson, 2016). Additionally, COI showed very low genetic divergences (<0.7%, Table 3) between the putative species L. vulgata and L. coeruleiviridis, and L. fayeae and L. retroversa-CU; species that are clearly distinguished based on morphological characteristics. This low genetic divergence may reflect short histories of reproductive isolation (Hebert, Ratnasingham & DeWaard, 2003), or mitochondrial introgression. In either case the addition of the nuclear gene ITS2 resolved the monophyly of the four species that COI alone did not support, and added resolution for uncertain groups with mtDNA genetic distances lower than 2%. These findings agreed with previous studies where the analysis of ITS2 resolved complex species delimitation (GilArriortua et al., 2014; Song, Wang & Liang, 2008), however, not always addition of more genes resolved the monophyly of the sister species like the case of L. illustris and L. caesar, where, after analysis including six genes, the monophyly remain unresolved (Sonet et al., 2012). In sum, our study demonstrates the importance employing a second nuclear marker for barcoding analyses and species delimitation of calliphorids and the power of molecular data in combination with a complete reference database to enable identification of taxonomically and geographically diverse insects of forensic importance. The combination of the two markers supported the higher diversity of Calliphoridae in the Caribbean recovering the monophyly of nine of the eleven possible cryptic species. However, definite conclusion about the taxonomy of these species will depend on further studies combining molecular and morphological approaches.

Conclusion

From almost a decade many studies have applied DNA-based methods for the identification of insects of forensic importance to enable identification of unknown insect specimens found in death scene investigations. However, this technique is not being implemented and the traditional time consuming methods of raising immature stages to adulthood is still in practice. The use of this approach has been unsuccessful because of lack of confidence due to sequence gaps and errors, unauthenticated reference DNA sequences in the database, and incomplete reference data set with partial taxon sampling. Thus, the base science foundation for application of DNA sequences analysis is unsolid for identification of evidentiary samples. Despite all studies of DNA based identification for insects involved in forensics, only a few of them include a complete reference data set. But even with a complete reference database, COI has failed in demonstrating reciprocal monophyly for several recently diverged species creating uncertainty about its use for identification. The addition of ITS2 as a second marker may be the key to increase certainty in identification and make this technique useful for forensic purposes. A great effort to build complete reference databases including extensive collections, accurate identification, geographical genetic variation for each targeted insect group and the addition of ITS2 as a second marker is needed. In general, COI barcodes are highly useful for species identification of the Caribbean calliphorids. ITS2 appears to be a good second marker that allows higher resolution and accurate identification of specimens that cannot be separated by COI alone. Our study provides, for the first time, a reliable dataset to accurately identify species of the family Calliphoridae from the Caribbean, and opens the door for future studies on biodiversity, biogeography, distribution and ecology of these forensically important flies.

Phylogenetic relationship within Calliphoridae based on a Bayesian analysis of nucleotide data from COI

Numbers indicate posterior probability support values. Specimen voucher codes referred to in Table 1 are shown following species names. For specimens from Lesser Antilles (LA), the three capital letters before the voucher code refers to the name of the islands abbreviated a follows: SBA, St. Barthelemy; SAB, Saba; BAR, Barbuda; NEV, Nevis; KIT, St. Kitts; MTQ, Martinique; ANT, Antigua; GUA, Guadeloupe; MON, Montserrat; EUS, St. Eustatius; SMA, St. Martin, SLU, St. Lucia; BBD Barbados. Click here for additional data file.

Phylogenetic relationship within Calliphoridae based on a Bayesian analysis of nucleotide data from ITS

Numbers indicate posterior probability support values. Specimen voucher codes referred to in Table 1 are shown following species names. For specimens from Lesser Antilles (LA), the three capital letters before the voucher code refers to the name of the islands abbreviated a follows: SBA, St. Barthelemy; SAB, Saba; BAR, Barbuda; NEV, Nevis; KIT, St. Kitts; MTQ, Martinique; ANT, Antigua; GUA, Guadeloupe; MON, Montserrat; EUS, St. Eustatius; SMA, St. Martin, SLU, St. Lucia; BBD Barbados. Click here for additional data file.

Phylogenetic relationship within Calliphoridae based on based on partitioned Bayesian analysis of the combined gene (COI and ITS2) data set

Numbers indicate posterior probability support values. Specimen voucher codes referred to in Table 1 are shown following species names. For specimens from Lesser Antilles (LA), the three capital letters before the voucher code refers to the name of the islands abbreviated a follows: SBA, St. Barthelemy; SAB, Saba; BAR, Barbuda; NEV, Nevis; KIT, St. Kitts; MTQ, Martinique; ANT, Antigua; GUA, Guadeloupe; MON, Montserrat; EUS, St. Eustatius; SMA, St. Martin, SLU, St. Lucia; BBD Barbados. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  58 in total

1.  A combined molecular approach to phylogeny of the jumping spider subfamily dendryphantinae (araneae: salticidae).

Authors:  M C Hedin; W P Maddison
Journal:  Mol Phylogenet Evol       Date:  2001-03       Impact factor: 4.286

2.  Molecular identification of some forensically important blowflies of southern Africa and Australia.

Authors:  M L Harvey; M W Mansell; M H Villet; I R Dadour
Journal:  Med Vet Entomol       Date:  2003-12       Impact factor: 2.739

3.  Revision of the Nearctic <i>Calliphora</i> Robineau-Desvoidy (Diptera: Calliphoridae).

Authors:  Tarek I Tantawi; Terry L Whitworth; Bradley J Sinclair
Journal:  Zootaxa       Date:  2017-01-26       Impact factor: 1.091

4.  Using COI barcodes to identify forensically and medically important blowflies.

Authors:  L A Nelson; J F Wallman; M Dowton
Journal:  Med Vet Entomol       Date:  2007-03       Impact factor: 2.739

5.  Identification of forensically important Chrysomya (Diptera: Calliphoridae) species using the second ribosomal internal transcribed spacer (ITS2).

Authors:  Leigh A Nelson; James F Wallman; Mark Dowton
Journal:  Forensic Sci Int       Date:  2008-03-04       Impact factor: 2.395

6.  Survey of the genetic diversity of Phormia regina (Diptera: Calliphoridae) using amplified fragment length polymorphisms.

Authors:  C J Picard; J D Wells
Journal:  J Med Entomol       Date:  2009-05       Impact factor: 2.278

7.  A revision of the Neotropical species of Lucilia Robineau-Desvoidy (Diptera: Calliphoridae).

Authors:  Terry Whitworth
Journal:  Zootaxa       Date:  2014-05-29       Impact factor: 1.091

8.  DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

Authors:  O Folmer; M Black; W Hoeh; R Lutz; R Vrijenhoek
Journal:  Mol Mar Biol Biotechnol       Date:  1994-10

9.  Forensic implications of biochemical differences among geographic populations of the black blow fly, Phormia regina (Meigen).

Authors:  A L Byrne; M A Camann; T L Cyr; E P Catts; K E Espelie
Journal:  J Forensic Sci       Date:  1995-05       Impact factor: 1.832

10.  Rapid dissemination of taxonomic discoveries based on DNA barcoding and morphology.

Authors:  Xiaowei Cao; Jie Liu; Jian Chen; Guo Zheng; Matjaž Kuntner; Ingi Agnarsson
Journal:  Sci Rep       Date:  2016-12-19       Impact factor: 4.379

View more
  7 in total

1.  Virus discovery in all three major lineages of terrestrial arthropods highlights the diversity of single-stranded DNA viruses associated with invertebrates.

Authors:  Karyna Rosario; Kaitlin A Mettel; Bayleigh E Benner; Ryan Johnson; Catherine Scott; Sohath Z Yusseff-Vanegas; Christopher C M Baker; Deby L Cassill; Caroline Storer; Arvind Varsani; Mya Breitbart
Journal:  PeerJ       Date:  2018-10-11       Impact factor: 2.984

2.  New Distribution Record for Lucilia cuprina (Diptera: Calliphoridae) in Indiana, United States.

Authors:  Charity G Owings; Christine J Picard
Journal:  J Insect Sci       Date:  2018-07-01       Impact factor: 1.857

3.  Influence of montane altitudinal ranges on species distribution models; evidence in Andean blow flies.

Authors:  Mariano Altamiranda-Saavedra; Eduardo Amat; Luz Miryam Gómez-P
Journal:  PeerJ       Date:  2020-12-07       Impact factor: 2.984

4.  Testing the Accuracy of Vegetation-Based Ecoregions for Predicting the Species Composition of Blow Flies (Diptera: Calliphoridae).

Authors:  K Ketzaly Munguía-Ortega; Eulogio López-Reyes; F Sara Ceccarelli
Journal:  J Insect Sci       Date:  2021-01-01       Impact factor: 1.857

5.  Integrative taxonomy of the genus Pseudostegana (Diptera, Drosophilidae) from China, with descriptions of eleven new species.

Authors:  Jinming Lu; Yuan Zhang; Hongwei Chen
Journal:  PeerJ       Date:  2018-09-05       Impact factor: 2.984

6.  Ecological and geographical speciation in Lucilia bufonivora: The evolution of amphibian obligate parasitism.

Authors:  G Arias-Robledo; R Wall; K Szpila; D Shpeley; T Whitworth; T Stark; R A King; J R Stevens
Journal:  Int J Parasitol Parasites Wildl       Date:  2019-09-22       Impact factor: 2.674

Review 7.  The Forensic Entomology Case Report-A Global Perspective.

Authors:  Zanthé Kotzé; Sylvain Aimar; Jens Amendt; Gail S Anderson; Luc Bourguignon; Martin J R Hall; Jeffery K Tomberlin
Journal:  Insects       Date:  2021-03-25       Impact factor: 2.769

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.