Literature DB >> 28729823

Administration of Tauroursodeoxycholic Acid Attenuates Early Brain Injury via Akt Pathway Activation.

Dongdong Sun1,2, Gang Gu1,2, Jianhao Wang1,2, Yan Chai1,2, Yueshan Fan1,2, Mengchen Yang1,2, Xin Xu1,2, Weiwei Gao1,2, Fei Li1,2, Dongpei Yin1,2, Shuai Zhou1,2, Xin Chen1,2, Jianning Zhang1,2.   

Abstract

Traumatic brain injury (TBI) is one of the leading causes of trauma-induced mortality and disability, and emerging studies have shown that endoplasmic reticulum (ER) stress plays an important role in the pathophysiology of TBI. Tauroursodeoxycholic acid (TUDCA), a hydrophilic bile acid, has been reported to act as an ER stress inhibitor and chemical chaperone and to have the potential to attenuate apoptosis and inflammation. To study the effects of TUDCA on brain injury, we subjected mice to TBI with a controlled cortical impact (CCI) device. Using western blotting, we first examined TBI-induced changes in the expression levels of GRP78, an ER stress marker, p-PERK, PERK, p-eIF2a, eIF2a, ATF4, p-Akt, Akt, Pten, Bax, Bcl-2, Caspase-12 and CHOP, as well as changes in the mRNA levels of Akt, GRP78, Caspase-12 and CHOP using RT-PCR. Neuronal cell death was assessed by a terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) assay, and CHOP expression in neuronal cells was detected by double-immunofluorescence staining. Neurological and motor deficits were assessed by modified neurological severity scores (mNSS) and beam balance and beam walking tests, and brain water content was also assessed. Our results indicated that ER stress peaked at 72 h after TBI and that TUDCA abolished ER stress and inhibited p-PERK, p-eIF2a, ATF4, Pten, Caspase-12 and CHOP expression levels. Moreover, our results show that TUDCA also improved neurological function and alleviated brain oedema. Additionally, TUDCA increased p-Akt expression and the Bcl-2/Bax ratio. However, the administration of the Akt inhibitor MK2206 or siRNA targeting of Akt abolished the beneficial effects of TUDCA. Taken together, our results indicate that TUDCA may attenuate early brain injury via Akt pathway activation.

Entities:  

Keywords:  Akt signal pathway; apoptosis; endoplasmic reticulum stress (ER stress); tauroursodeoxycholic acid (TUDCA); traumatic brain injury (TBI)

Year:  2017        PMID: 28729823      PMCID: PMC5498474          DOI: 10.3389/fncel.2017.00193

Source DB:  PubMed          Journal:  Front Cell Neurosci        ISSN: 1662-5102            Impact factor:   5.505


Introduction

Traumatic brain injury (TBI), the most common type of brain injury, is one of the leading causes of death and disability in young Chinese people aged 15–24 years (Chen et al., 2010). However, to date, there are no effective drugs—either in clinical trials or in clinical practice—that are capable of attenuating TBI. TBI mainly comprises primary brain injury and secondary brain injury. Primary brain injury, which occurs immediately after trauma, can induce biochemical changes and ultimately lead to secondary neuronal cell loss (Jindal et al., 2016). The main mechanisms underlying secondary brain injury are associated with endoplasmic reticulum stress (ER stress), oxidative stress, mitochondrial dysfunction, inflammation and apoptosis (Dash et al., 2015; Gao et al., 2016; Wang et al., 2016; Yang et al., 2017). The ER is the largest cellular organelle and plays essential roles in maintaining Ca2+ homeostasis and folding newly synthesized proteins. The accumulation of unfolded and misfolded proteins can induce the unfolded protein response (UPR) to maintain cellular homeostasis. However, severe or persistent stress may activate the three major UPR signaling pathways (i.e., the PERK, IRE1 and ATF6 signaling pathways) and ultimately lead to neuronal cell death in acute central nervous system (CNS) injury (Ron and Walter, 2007; Sano and Reed, 2013; Nakka et al., 2016). However, ER stress can also regulate the inflammatory response following TBI by inhibiting the NF-κB signaling pathway (Logsdon et al., 2016). Several ER stress inhibitors, such as salubrinal, docosahexaenoic acid (DHA) and guanabenz, have been reported to have protective effects after TBI in previous studies. However, few effective treatments for TBI-induced ER stress have been developed by preclinical and clinical studies (Begum et al., 2014; Dash et al., 2015; Logsdon et al., 2016). Therefore, the role of ER stress in TBI and its regulation still require further investigation. Tauroursodeoxycholic acid (TUDCA), a hydrophilic bile acid, has been used for the treatment of cholestatic liver diseases over the past several decades (Paumgartner and Beuers, 2002). In recent years, TUDCA has also been reported to have significant beneficial effects in several CNS diseases, such as stroke, intracerebral hemeorrhage (ICH) and neurodegenerative diseases (Rodrigues et al., 2002, 2003; Castro-Caldas et al., 2012). TUDCA may exert its protective effects by modulating ER stress, mitochondrial function, reactive oxygen species production and cytochrome c release (Beuers et al., 1996; Lim et al., 2010; Fonseca et al., 2016). In addition, TUDCA also reduced microglia activation and migration in an animal model of acute neuroinflammation (Yanguas-Casás et al., 2014). However, the role of TUDCA in TBI, as well as whether treatment with TUDCA can improve functional outcomes after TBI, remains unknown. To determine the effects of TUDCA in TBI, we investigated whether TUDCA (500 mg/kg, 3 days) can modulate neuronal cell apoptosis and improve neurological function. Our results indicated that administration of TUDCA can abolish ER stress and reduce neuronal cell apoptosis following TBI. Furthermore, we found that TUDCA administration increased p-Akt expression and the Bcl-2/Bax ratio and improved neurological function following TBI. However, administration of MK2206, a selective Akt inhibitor, abolished the protective effects of TUDCA. Collectively, these results showed that TUDCA may reduce early brain injury via Akt-related anti-apoptotic pathways.

Materials and Methods

Animals

Male C57BL/6 mice weighing 20–25 g were obtained from the Beijing Vital River Laboratory Animal Technology Co., Ltd. All the mice were raised in the animal facilities of Tianjin Medical University General Hospital under a standard 12:12-h light/dark cycle. The temperature of the facility was maintained between 18°C and 22°C, the humidity was maintained between 50% and 60%, and the mice were allowed free access to water and food. All animal experiments were approved by the Animal Care and Use Committee of Tianjin Medical University and were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All procedures were approved by the Chinese Small Animal Protection Association Experimental Protocol.

TBI Model

A digital electromagnetically controlled cortical impact (CCI) device (eCCI model 6.3, America) was used to establish the TBI model in C57BL/6 mice. The mice were allowed to adapt to their new environment for 1 week before surgery. The mice were anesthetized with 10% chloral hydrate (3 mg/kg, intraperitoneal injection). The depth of anesthesia was assessed by monitoring the pedal withdrawal reflex and respiratory rate. Then, the mice were placed in a stereotaxic apparatus, and the surgical site was clipped and cleaned with Nolvasan scrubs. A 4.0-mm hole was drilled in the right parietal bone to expose the dura. The CCI device subsequently impacted the skull a depth of 1.2 mm and a velocity of 5 m/s over a period of 200 ms. The incision was closed with interrupted 6-0 silk sutures immediately following injury, and then the mice were placed in heated cages to recover from anesthesia at room temperature (RT). All the mice in the sham group were subjected to the same surgical procedure but were not treated with the CCI device.

Experimental Design

Four experimental procedures were performed to investigate the time course of post-TBI ER stress and the protective effects of TUDCA against ER stress. In Experiment 1, the post-TBI changes in the expression levels of GRP78 (an ER stress marker), p-Akt and Akt over time were determined by western blotting. The mice used for this experiment were assigned to the following five groups: a sham group, a TBI 6 h group, a TBI 12 h group, a TBI 24 h group and a TBI 72 h group. In Experiment 2, we studied the effects of TUDCA (500 mg/kg) on TBI-induced ER stress. The mice used for this experiment were randomly divided into the following three groups: a sham group, a control group and a TBI + TUDCA group. Neurologic scores were measured between 24 h and 14 days after TBI, and brain water content was measured at 72 h following TBI in all groups. p-PERK, PERK, p-elF2α, elF2α, ATF4, Bcl-2, Bax, CHOP, p-Akt Akt, Pten and Caspase-12 expression levels were measured by western blotting and CHOP expression levels were measured by immunohistochemical staining at 72 h following TBI. Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) assay was also performed in each group at 72 h after TBI. In Experiment 3, we studied the mechanism through which TUDCA (500 mg/kg) exerts its effects on ER stress following TBI. The mice used for this experiment were randomly divided into the following five groups: a sham group, a control group, a TBI + TUDCA group, a TBI + MK2206 group and a TBI + TUDCA + MK2206 group. MK2206 (60 mg/kg, Selleck Chemicals, Houston, TX, USA) was administered orally for 3 days beginning at 1 h following TBI. p-elF2α, elF2α, Bcl-2, Bax, CHOP, p-Akt, Akt, Pten and Caspase-12 expression levels were determined by western blotting in each group at 72 h after TBI. In Experiment 4, to provide compelling evidence of the molecular mechanism of TUDCA’s protective role in the TBI animal model, the mice used for this experiment were randomly divided into the following six groups: a sham group, a control group, a TBI + short interfering RNA (siRNA)-control group, a TBI + TUDCA group, a TBI + siRNA-Akt group and a TBI + TUDCA + siRNA-Akt group. The mRNA levels of Akt, Grp78, CHOP and Caspase-12 were determined using RT- PCR in each group at 72 h after TBI. The dose of TUDCA used in the present study was selected on the basis of previous reports (Yanguas-Casás et al., 2016).

SiRNA Transfection

SiRNA transfection was performed in vivo according to the method described by Chen C. et al. (2009). A total of 1.25 μg/5 μL Akt siRNA (Sangon Biotech) and control siRNA (Sangon Biotech) were diluted respectively with the same volume of Entranster™-in vivo transfection reagent (Engreen, Beijing, China). The solution was mixed gently and injected intracerebroventricularly (i.c.v.). For the i.c.v injection, a 1 mm cranial burr hole was drilled into the skull. A 30-gauge needle on a Hamilton syringe was implanted into the lateral ventricle using the following stereotactic coordinates: 1.5 mm posterior to Bregma and 1.0 mm right lateral to the midline, 2 mm in depth.

Modified Neurological Severity Scores

Neurological function, which comprises motor function, sensory function, and reflexes, was evaluated by modified neurological severity scores (mNSSs), as previously reported (Chen et al., 2001). The test was performed by an observer blinded to the experimental conditions on the 1st, 3rd, 7th and 14th days after TBI. Lower scores were indicative of better neurological function.

Motor Function Testing

The beam balance task was used to assess gross vestibulomotor function, as previously reported (Singleton et al., 2010). The time for which the animal remained on an elevated, 1.5-cm-wide wooden beam was recorded (up to a maximum of 60 s). Each animal completed three trials per day and completed training on the day prior to TBI induction. Spinning on the beam was counted as a fall. We assessed vestibulomotor function and coordination by having the mice perform a modified beam-walking task, as previously reported (Feeney et al., 1982). All the mice were trained to traverse a narrow wooden beam (2.5 × 100 cm) and enter a darkened goal box at the far end of the beam in response to bright light and loud white noise. The light and noise were stopped immediately after each mouse entered the goal box. The mice remained in the goal box for at least 30 s between trials. Training was completed on the day prior to TBI induction. The test was administered by an observer blinded to the experimental conditions on the 1st, 3rd, 5th and 7th days after TBI. Shorter times were indicative of better vestibulomotor function and coordination.

Brain Water Content

Brain water content was measured by the wet-dry weight method at 72 h following TBI, as previously reported (Yan et al., 2011). Brains were obtained without transcardiac perfusion, after which their weights were determined by an electronic analytical balance. The brains were subsequently dried in an electrothermostatic blast oven for 72 h at 80°C, after which their dry weights were determined by the same electronic analytical balance. Brain water content (%) was calculated as (wet brain weight − dry brain weight)/wet brain weight × 100%.

Western Blotting

Mice were sacrificed by transcardiac perfusion with cold PBS to eliminate the proteins expressed by blood cells. Brain were homogenized in ice-cold RIPA buffer (Beyotime) with PMSF (final concentration 1 mM) for 30 min and then centrifuged for 10 min (12,000 rpm, 4°C). After centrifugation, the supernatants were collected and boiled with 4× sample buffer at 95°C for 10 min. The total protein content was determined by the BCA protein assay kit (Thermo). Protein samples (8 μg per lane) and prestained molecular weight markers (Thermo) were separated by SDS/PAGE. After SDS-PAGE, the resolved proteins were transferred to a PVDF membrane (Roche, Canada) and then blocked by 5% non-fat dry milk in Tris-buffered saline (TBS) for 2 h at RT. After blocking, the blots were incubated overnight at 4°C with primary antibodies (for more information, see Table 1).
Table 1

Antibodies for western blot.

AntibodyCatalog #VendorDilutionMolecular weight (kDa)
GRP78NBP1-06274Novusbio1:25075
p-PERK (Thr981)SC-32577Santa1:500170
PERK3192CST1:1000140
p-eIF2a (Ser51)Ab32157CST1:100036
eIF2a9722CST1:100038
ATF411815CST1:100049
p-Akt (Ser473)4060CST1:100060
Akt9272CST1:100060
Pten9552CST1:100054
CHOP2895CST1:100027
Caspase-12AB62484Abcam1:100042
Bax2722CST1:100020
Bcl-22876CST1:100028
β-Actin3700CST1:100045
Peroxidase-Conjugated anti-Rabbit IgG (H + L)ZB-2305ZSGB-BIO1:5000
Peroxidase-Conjugated anti-Mouse IgG (H + L)ZB-2301ZSGB-BIO1:5000
Antibodies for western blot. After rinsing with TBS, the blots were incubated with the appropriate HRP-conjugated secondary IgG for 1 h at RT and then developed with the ECL System (Millipore, Billerica, MA, USA). Protein expression was quantified by ImageJ software according to the mean pixel density of each protein band and β-actin was employed as a loading control.

Immunohistochemical Staining

The mice were anesthetized with 10% chloral hydrate and then transcardially perfused first with PBS and then with 4% paraformaldehyde at 72 h following TBI. Their brains were rapidly embedded in OCT medium (Sakura, Oakland, CA, USA), after which they were cut into 8-μm-thick coronal sections, which were subsequently treated with 3% BSA for 30 min at 37°C to block nonspecific binding before being incubated with the appropriate primary antibodies overnight at 4°C. After being rinsed with PBS, the sections were incubated with Alexa Fluor-conjugated anti-mouse or anti-rabbit IgG (1:500, Molecular Probes) for 1 h at RT. The nuclei were counterstained with DAPI for 5 min.

TUNEL Assay

Tissue sections obtained from the brains of 72-h post-injury mice were used to examine cell death with an In-Situ Cell Death Detection Kit, as previously described (Cuello-Carrión and Ciocca, 1999). After being warmed to RT for 30 min, the sections were fixed in acetone for 8 min at 4°C. After being rinsed with PBS, the sections were treated with 3% BSA for 30 min at 37°C before being incubated with TUNEL reaction mixture in the dark for 90 min at 37°C. The nuclei were counterstained with DAPI for 5 min.

Quantitative Real-Time PCR

RNA was harvested from acquired tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA (10 ng) was reverse transcribed into single-stranded complementary DNA with a PrimeScript RT Reagent Kit (TaKaRa, Dalian, China, DRR037S) following the manufacturer’s instructions, and used for real-time PCR. Amplification and quantification were carried out with the SYBR Premix Ex Taq II (TaKaRa, DRR081A) and MJ Research real-time PCR system (Bio-Rad, Hercules, CA, USA). Reactions were performed in a 25-μL reaction mixture consisting of 12.5 μL 2 × SYBR Green, 10 ng RNA, and 0.4 μmol/L of each primer, and run in triplicate using the under the following conditions: 95°C for 2 min, followed by 45 cycles of 95°C for 15 s, and 62°C for 1 min. The primers are listed in Table 2. β-actin was used as an endogenous control.
Table 2

Polymerase chain reaction primer sets in real-time PCR.

GenePrimer sequencesSize (bp)
GRP78Forward TCAGCATCAAGCAAGGATTG115
Reverse CATGGTAGAGCGGAACAGGT
AktForward GAACGACGTAGCCATTGTGA122
Reverse GCCGTTCCTTGTAGCCAATA
CHOPForward CTCGCTCTCCAGATTCCAGT137
Reverse CTGCTCCTTCTCCTTCATGC
Caspase-12Forward GAGGAACGTGTGTTGAGCTG122
Reverse CCAGTCTTGCCTACCTTCCA
β-actinForward CAGGCATTGCTGACAGGATG155
Reverse TGCTGATCCACATCTGCTGG
Polymerase chain reaction primer sets in real-time PCR.

Statistical Analysis

All data are based on at least three independent experiments. One-way ANOVA followed by the Tukey’s multiple comparisons test was used for comparisons between groups. All data are expressed as the mean ± SEM. A p-value less than 0.05 was considered significant.

Results

GRP78 and p-Akt Expression Levels Were Altered after TBI

The experimental protocols for the sham, control and TUDCA treatment groups are shown in Figure 1. Biochemical assays and neurological functional analyses were performed in the above groups from 1 to 14 days after TBI. We found that the expression of GRP78, an ER stress marker, was significantly elevated at 6 h following TBI and peaked on the 3rd day after TBI (Figure 2A, p < 0.05). However, the ratio of p-Akt/Akt was decreased at 6 h after TBI and reached its lowest level on the 3rd day after TBI (Figure 2B, p < 0.05).
Figure 1

The experimental protocol. Controlled cortical impact (CCI) animals were treated with tauroursodeoxycholic acid (TUDCA), saline, MK2206 or Akt siRNA. TUDCA, saline or MK2206 were treated for 3 days following traumatic brain injury (TBI), whereas Akt siRNA were treated for once. The time points at which we chose the samples from each group for western blotting, immunofluorescence, TUNEL staining and RT-PCR are also indicated.

Figure 2

TBI altered the expression of GRP78 and the ratio of p-Akt/Akt. Data described in (A,B) represented the time course of GRP78 and p-Akt/Akt following TBI. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham.

The experimental protocol. Controlled cortical impact (CCI) animals were treated with tauroursodeoxycholic acid (TUDCA), saline, MK2206 or Akt siRNA. TUDCA, saline or MK2206 were treated for 3 days following traumatic brain injury (TBI), whereas Akt siRNA were treated for once. The time points at which we chose the samples from each group for western blotting, immunofluorescence, TUNEL staining and RT-PCR are also indicated. TBI altered the expression of GRP78 and the ratio of p-Akt/Akt. Data described in (A,B) represented the time course of GRP78 and p-Akt/Akt following TBI. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham.

CHOP Expression in Neuronal Cells Was Altered after TBI

Double immunofluorescence of CHOP with NeuN in both the sham and TBI groups indicated that CHOP expression in neuronal cells subjected to TBI was significantly elevated compared with that in sham groups on the 3rd day after TBI (Figure 3).
Figure 3

Coronal brain sections from C57/BL6 mice (Bregma −2.20) were double immune stained for CHOP protein (green) and NeuN (red). Levels of CHOP in neuronal cells were assessed immunofluorescence. Images show CHOP positive neuronal cells was considerably higher in the lesion area of the cerebral cortex 72 h following TBI. n = 5 for each group. Scale bar = 50 μm.

Coronal brain sections from C57/BL6 mice (Bregma −2.20) were double immune stained for CHOP protein (green) and NeuN (red). Levels of CHOP in neuronal cells were assessed immunofluorescence. Images show CHOP positive neuronal cells was considerably higher in the lesion area of the cerebral cortex 72 h following TBI. n = 5 for each group. Scale bar = 50 μm.

TUDCA Reduced Brain Oedema and Attenuated Neurological Deficits after TBI

We evaluated effects of TUDCA on the neurological function of TBI mice with mNSSs and the beam balance and beam walking tests from 0 to 14 days post-TBI. mNSSs were determined to evaluate long-term neurological function. The mice in the control and TUDCA groups exhibited higher mNSSs than the mice in the sham group on the first day following TBI. However, there was no significant difference in mNSSs between the control and TUDCA groups, which indicated that all the mice had sustained relatively comparable injuries. Neurological function began to recover between the 3rd and 14th days post-TBI, and treatment with TUDCA decreased mNSSs between the 7th and 14th days post-TBI (Figure 4A, p < 0.05). The beam balance and beam walking tests were performed to evaluate short-term sensorimotor function. The mice in the control and TUDCA groups displayed significant deficits in motor function compared with the mice in the sham group from 1–7 days post-TBI. Treatment with TUDCA improved motor function in the corresponding group compared with the sham group between the 5th and 7th days post-TBI (Figures 4B,C, p < 0.05). In addition, TBI induced increases in brain oedema on the 3rd day following TBI. However, treatment with TUDCA significantly decreased brain water content compared with treatment with saline (Figure 4D, p < 0.05).
Figure 4

Effects of TUDCA on neurological function and brain oedema following TBI. Neurological function was evaluated with the modified neurological severity scores (mNSSs) (A) and beam walking latency (B) and beam balance tests (C). Brain oedema was evaluated by calculating brain water content (D). All data are expressed as the mean ± SEM, and n = 5 in each group. *p < 0.05 vs. the sham group, #p < 0.05 vs. the control group.

Effects of TUDCA on neurological function and brain oedema following TBI. Neurological function was evaluated with the modified neurological severity scores (mNSSs) (A) and beam walking latency (B) and beam balance tests (C). Brain oedema was evaluated by calculating brain water content (D). All data are expressed as the mean ± SEM, and n = 5 in each group. *p < 0.05 vs. the sham group, #p < 0.05 vs. the control group.

TUDCA Inhibited ER Stress and Promoted Neuronal Survival after TBI

As stated previously, TBI clearly triggered increases in ER stress marker levels, which peaked on the 3rd day following TBI; thus, we investigated the effects of TUDCA on ER stress on the 3rd day after TBI. We found that treatment with TUDCA significantly decreased p-PERK (Figure 5A, p < 0.05), p-eIF2α (Figure 5B, p < 0.05) and ATF4 (Figure 5D, p < 0.05) expression levels compared with treatment with saline. In addition, we also investigated the effects of TUDCA on ER stress-induced apoptosis. We found that TUDCA significantly increased the Bcl-2/Bax ratio (Figure 5C, p < 0.05) and significantly decreased Caspase-12 (Figure 5E, p < 0.05) and CHOP expression levels (Figure 5F, p < 0.05) in the corresponding group compared with the control group. TUDCA also decreased the percentages of CHOP-positive neuronal cells in the lesion area of the cerebral cortex and the dentate gyrus of the ipsilateral hippocampus in the corresponding group compared with the control group (Figures 6A–C, p < 0.05). TUNEL assay and NeuN double-staining were used to quantify brain neuronal cell apoptosis on the 3rd day after TBI. The results indicated that TUDCA significantly reduced the percentages of TUNEL-positive neuronal cells in the lesion area of the cerebral cortex and the dentate gyrus of the ipsilateral hippocampus in the corresponding group compared with the control group (Figures 7A–C, p < 0.05).
Figure 5

Effects of TUDCA on the PERK-ATF4-CHOP signaling pathway, the Bcl-2/Bax ratio and the expression level of Caspase-12 at 72 h after TBI. Representative results of p-PERK/PERK (A), p-eIF2α/ eIF2α (B), Bcl-2/Bax (C), ATF4 (D), Caspase-12 (E) and CHOP (F) alterations in the different groups. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control.

Figure 6

Effects of TUDCA on the CHOP-positive neuronal cells at 72 h after TBI. Representative immunofluorescences images showing the colocalization of CHOP (green) with NeuN positive cells (red) in the lesion area of the cerebral cortex and the dentate gyrus of the ipsilateral hippocampus at 72 h after TBI (A). Quantitative data indicating that the expression of CHOP in neuronal cells was greater in TBI group than in TUDCA treated group both in the lesion area (B) and in the dentate gyrus (C). All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control. Scale bar = 50 μm.

Figure 7

Effects of TUDCA on the TUNEL-positive neuronal cells at 72 h after TBI. Representative microphotographs showing the colocalization of TUNEL (green)-positive cells with neuronal cells (red) in the lesion area of the cerebral cortex and the dentate gyrus of the ipsilateral hippocampus at 72 h after TBI (A). Quantitative data indicating that TUNEL-positive neuronal cells was greater in TBI group than in TUDCA treated group both in the lesion area (B) and in the dentate gyrus (C). All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control. Scale bar = 50 μm.

Effects of TUDCA on the PERK-ATF4-CHOP signaling pathway, the Bcl-2/Bax ratio and the expression level of Caspase-12 at 72 h after TBI. Representative results of p-PERK/PERK (A), p-eIF2α/ eIF2α (B), Bcl-2/Bax (C), ATF4 (D), Caspase-12 (E) and CHOP (F) alterations in the different groups. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control. Effects of TUDCA on the CHOP-positive neuronal cells at 72 h after TBI. Representative immunofluorescences images showing the colocalization of CHOP (green) with NeuN positive cells (red) in the lesion area of the cerebral cortex and the dentate gyrus of the ipsilateral hippocampus at 72 h after TBI (A). Quantitative data indicating that the expression of CHOP in neuronal cells was greater in TBI group than in TUDCA treated group both in the lesion area (B) and in the dentate gyrus (C). All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control. Scale bar = 50 μm. Effects of TUDCA on the TUNEL-positive neuronal cells at 72 h after TBI. Representative microphotographs showing the colocalization of TUNEL (green)-positive cells with neuronal cells (red) in the lesion area of the cerebral cortex and the dentate gyrus of the ipsilateral hippocampus at 72 h after TBI (A). Quantitative data indicating that TUNEL-positive neuronal cells was greater in TBI group than in TUDCA treated group both in the lesion area (B) and in the dentate gyrus (C). All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control. Scale bar = 50 μm.

TUDCA Activated the Akt Signaling Pathway after TBI

To elucidate the molecular mechanisms underlying the effects of TUDCA in TBI, we examined the effects of TUDCA on the Pten/PI3K-Akt signaling pathway on the 3rd day following TBI. We found that PTEN protein expression levels were decreased in the TUDCA group compared with the control group on the 3rd day after TBI (Figure 8A, p < 0.05). PTEN loss can promote Akt activation by promoting its phosphorylation at Thr308 and/or Ser473. Thus, we detected p-Akt protein expression levels. The results indicated that p-Akt protein expression levels were significantly decreased in the TUDCA group compared with the control group on the 3rd day after TBI (Figure 8B, p < 0.05).
Figure 8

Effects of TUDCA on the expression of Pten and the ratio of p-Akt/Akt. Representative results of Pten (A), p-Akt/Akt (B) alterations in the different groups. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control.

Effects of TUDCA on the expression of Pten and the ratio of p-Akt/Akt. Representative results of Pten (A), p-Akt/Akt (B) alterations in the different groups. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control.

The Protective Effects of TUDCA Are Dependent on Akt Signaling Pathway Activation in TBI

To elucidate the mechanisms underlying the protective effects of TUDCA in TBI further, we treated neuronal cells with MK2206, a highly selective Akt inhibitor, at 1 h after TBI. As stated previously, TUDCA can activate the Akt signaling pathway and reduce ER stress-related apoptotic protein expression levels. However, the administration of MK2206 significantly suppressed the increases in p-Akt expression induced by treatment with TUDCA (Figure 9A, p < 0.05). MK2206 also abolished TUDCA-induced decreases in Pten (Figure 9D, p < 0.05), Caspase-12 (Figure 9E, p < 0.05), and CHOP (Figure 9F, p < 0.05) expression levels and the Bcl-2/Bax ratio (Figure 9C, p < 0.05). Moreover, MK2206 prevented the beneficial effects of TUDCA on oedema (Figure 10, p < 0.05). However, MK2206 did not affect p-eIF2α expression (Figure 9B, p > 0.05).
Figure 9

Effects of MK2206-mediated Akt inhibition on the protective effects of TUDCA at 72 h following TBI. Representative results of p-Akt/Akt (A), p-eIF2α/ eIF2α (B), Bcl-2/Bax (C), Pten (D), Caspase-12 (E) and CHOP (F) alterations in the different groups. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control; &p < 0.05 vs. TUDCA.

Figure 10

Effects of MK2206-mediated Akt inhibition on the beneficial effects of TUDCA on oedema at 72 h after TBI. Brain water content was detected at 72 h after TBI. However, this protective effect of TUDCA was reversed by MK2206 administration. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control; &p < 0.05 vs. TUDCA.

Effects of MK2206-mediated Akt inhibition on the protective effects of TUDCA at 72 h following TBI. Representative results of p-Akt/Akt (A), p-eIF2α/ eIF2α (B), Bcl-2/Bax (C), Pten (D), Caspase-12 (E) and CHOP (F) alterations in the different groups. β-actin was used as the loading control. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control; &p < 0.05 vs. TUDCA. Effects of MK2206-mediated Akt inhibition on the beneficial effects of TUDCA on oedema at 72 h after TBI. Brain water content was detected at 72 h after TBI. However, this protective effect of TUDCA was reversed by MK2206 administration. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control; &p < 0.05 vs. TUDCA. To provide compelling evidence of the molecular mechanism of TUDCA’s protective role, we detected the mRNA levels of GRP78, Akt, Caspase-12 and CHOP after RNA interference assays using siRNA against Akt. Our results indicated that AKT siRNA decreased Akt mRNA levels, which was not affected by TUDCA treatment (Figure 11A, p > 0.05). This result may suggest that TUDCA plays a protective role via increasing Akt phosphorylation but has no effect on Akt mRNA transcription. Meanwhile, Akt siRNA abolished TUDCA-induced decreases in Caspase-12 (Figure 11C, p < 0.05) and CHOP (Figure 11D, p < 0.05) mRNA levels but had no effect on GRP78 mRNA levels (Figure 11B, p > 0.05).
Figure 11

Detection of the mRNA levels of Akt, GRP78, Caspase-12 and CHOP by RT-PCR following Akt Silencing. Mice were transfected with Akt siRNA or control siRNA. Brains were removed for the detection of Akt (A), GRP78 (B), Caspase-12 (C) and CHOP (D) by RT- PCR 3 days after TBI. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control; &p < 0.05 vs. TUDCA.

Detection of the mRNA levels of Akt, GRP78, Caspase-12 and CHOP by RT-PCR following Akt Silencing. Mice were transfected with Akt siRNA or control siRNA. Brains were removed for the detection of Akt (A), GRP78 (B), Caspase-12 (C) and CHOP (D) by RT- PCR 3 days after TBI. All the results are expressed as the mean ± SEM, and n = 5 for each group. *p < 0.05 vs. sham; #p < 0.05 vs. control; &p < 0.05 vs. TUDCA.

Discussion

The neuroprotective effects of TUDCA have been demonstrated in previous studies involving models of Huntington’s disease, Alzheimer’s disease and stroke; however, little is known about the effects of TUDCA in TBI or the mechanisms underlying these effects (Rodrigues et al., 2000, 2002; Keene et al., 2002). Thus, in this study, we investigated the neuroprotective effects of TUDCA in mice subjected to TBI. We found that TUDCA administration inhibited ER stress and improved neurologic outcomes after TBI. Furthermore, we uncovered convincing evidence indicating that TUDCA can attenuate early brain injury by activating the Akt pathway. We found that TUDCA can effectively alleviate brain oedema in mice. Following severe TBI, the blood brain barrier is disrupted, and the resulting cerebral oedema causes increases in intracranial pressure (ICP) and thus leads to poor outcomes (Zhao et al., 2016). Therefore, pharmacological therapies designed to slow the development of cerebral oedema and attenuate disruption of the BBB are expected to improve neurologic outcomes after TBI. A previous study showed that TUDCA can attenuate oedema in acute pancreatitis, a finding that served as a basis for our study (Seyhun et al., 2011).The affection of TUDCA on alleviating brain oedema can be abolished by Akt inhibitor. This may be the reason why inhibition of Akt increases death and stress markers and provide evidence for the protective effect of TUDCA by activating Akt. Neuronal cell apoptosis in the hippocampus following TBI is responsible for the neurological deficits induced by TBI (Lu et al., 2007). Although various studies have shown that TBI can induce neuronal cell apoptosis and neurological deficits, the molecular mechanisms underlying TBI-induced neurodegeneration have not been fully elucidated. A recent study showed that ER stress and UPR activation can trigger a variety of neuronal cell death pathways and play a critical role in the pathophysiology of TBI (Larner et al., 2006). UPR activation is facilitated by three ER-transmembrane effector proteins, namely, PERK, IRE1 and ATF6 (Nakka et al., 2016). As PERK is the central regulator of ER stress, increases in its expression are the first indicator of UPR activation in the early hours of CNS injury, and uncontrolled PERK pathway activation may promote ATF4 and CHOP activation and eventually induce cell death (Kumar et al., 2001; Begum et al., 2014). Consistent with the results of previous studies, the results of our study revealed that the PERK-ATF4-CHOP signaling pathway was activated and that the number of CHOP positive neuronal cells increased significantly on the 3rd day following TBI. Administration of TUDCA can inhibit PERK-ATF4-CHOP signaling pathway activation, attenuate neuronal damage and improve both motor function and neurological functional recovery. In addition, TUDCA can also increase the ratio of Bcl-2/Bax and decrease the expression of Caspase-12, a unique marker of ER stress-related apoptosis, and plays an important role in TBI-induced apoptosis. Double-immunofluorescence staining demonstrated that the numbers of CHOP- and TUNEL-positive neuronal cells were elevated after TBI, indicating that neuronal apoptosis was induced by TBI. However, TUDCA significantly promoted neuronal survival. These results are supported by those of a previous study, which showed that selective inhibition of PERK could reduce neuronal damage and improve neurological deficits in animal models of subarachnoid hemeorrhage (Yan et al., 2017). Akt is a serine/threonine kinase and plays critical roles in intracellular signal transduction pathways involved in cell proliferation, cell survival, inflammation and metabolism (Brazil et al., 2004; Wang et al., 2015, 2017). A previous study showed that neuronal apoptosis can aggravate tissue damage and neurological deficits following TBI (Chen X. et al., 2009). Evidence suggests that PI3K/Akt signaling pathway activation plays a critical neuroprotective role in TBI by regulating anti-apoptosis (Noshita et al., 2002; Zhao et al., 2012; Zhang et al., 2014). Akt phosphorylation can attenuate neuronal apoptosis by altering the expression of downstream molecules, such as Bcl-2, Bax and Caspase-3, after TBI (Ge et al., 2014). To investigate the mechanism underlying the neuroprotective effects of TUDCA, we measured the the ratio of p-Akt/Akt following TBI. The results indicated that the ratio of p-Akt/Akt decreased significantly at 6 h after TBI and reached its lowest level at 72 h after TBI. PTEN is a negative regulator of PI3K/Akt signaling pathway activity (Maehama and Dixon, 1998). Administration of TUDCA increased the ratio of p-Akt/Akt and decreased PTEN expression in the corresponding group compared with the control group on the 3rd day after TBI. Furthermore, administration of TUDCA also increased the Bcl-2/Bax ratio and decreased the mRNA level and protein level of Caspase-12 and CHOP, changes that could be inhibited by co-administration of the selective Akt inhibitor MK2206 or Akt siRNA. Taken together, these results suggest that TUDCA inhibits PERK activity and attenuates early brain injury by activating the Akt signaling pathway. However, this study had some limitations. The pathological changes associated with TBI mainly include mitochondrial dysfunction, ER stress, Ca2+ homeostasis disruptions, oxidative stress, excitotoxicity and free-radical generation, all of which can induce inflammation and apoptosis (Faridar et al., 2011; Pearn et al., 2017). In this study, we focused our attention on the potential anti-apoptotic effects of TUDCA and its downstream signaling proteins and did not investigate its role in neuroinflammation following TBI. Additional studies are required to determine the effects of TUDCA in neuroinflammation following TBI. In summary, we conclude that TUDCA, a hydrophilic bile acid, can modulate neuronal apoptosis and improve neurological function following TBI. The potential mechanisms through which TUDCA attenuates early brain injury may involve the activation of Akt-related anti-apoptotic signaling pathways.

Author Contributions

JZ and XC designed experiments. DS, GG, JW and YC carried out experiments. DS and YC analyzed experimental results. DS, GG and JW wrote the manuscript. YF, MY, XX, WG, FL, DY and SZ took part in the experiment and proposed some suggestions.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  45 in total

1.  Inhibition of Eukaryotic Initiation Factor 2 Alpha Phosphatase Reduces Tissue Damage and Improves Learning and Memory after Experimental Traumatic Brain Injury.

Authors:  Pramod K Dash; Michael J Hylin; Kimberly N Hood; Sara A Orsi; Jing Zhao; John B Redell; Andrey S Tsvetkov; Anthony N Moore
Journal:  J Neurotrauma       Date:  2015-07-20       Impact factor: 5.269

2.  Erratum to: Tauroursodeoxycholic Acid Protects Against Mitochondrial Dysfunction and Cell Death via Mitophagy in Human Neuroblastoma Cells.

Authors:  Inês Fonseca; Gisela Gordino; Sara Moreira; Maria João Nunes; Carla Azevedo; Maria João Gama; Elsa Rodrigues; Cecília Maria Pereira Rodrigues; Margarida Castro-Caldas
Journal:  Mol Neurobiol       Date:  2017-10       Impact factor: 5.590

3.  Neuroprotective and anti-apoptotic effects of valproic acid on adult rat cerebral cortex through ERK and Akt signaling pathway at acute phase of traumatic brain injury.

Authors:  Chi Zhang; Jie Zhu; Jing Zhang; Haoyu Li; Zijin Zhao; Yiwei Liao; Xiangyu Wang; Jun Su; Shushan Sang; Xianrui Yuan; Qing Liu
Journal:  Brain Res       Date:  2014-02-05       Impact factor: 3.252

4.  TGFβ Contributes to the Anti-inflammatory Effects of Tauroursodeoxycholic Acid on an Animal Model of Acute Neuroinflammation.

Authors:  Natalia Yanguas-Casás; M Asunción Barreda-Manso; Sandra Pérez-Rial; Manuel Nieto-Sampedro; Lorenzo Romero-Ramírez
Journal:  Mol Neurobiol       Date:  2016-10-15       Impact factor: 5.590

5.  SIRT1 plays a neuroprotective role in traumatic brain injury in rats via inhibiting the p38 MAPK pathway.

Authors:  Hong Yang; Zheng-Tao Gu; Li Li; Mac Maegele; Bi-Ying Zhou; Feng Li; Ming Zhao; Ke-Sen Zhao
Journal:  Acta Pharmacol Sin       Date:  2016-12-26       Impact factor: 6.150

6.  Activation of G-protein coupled estrogen receptor 1 improves early-onset cognitive impairment via PI3K/Akt pathway in rats with traumatic brain injury.

Authors:  Ze-Fen Wang; Zhi-Yong Pan; Cheng-Shi Xu; Zhi-Qiang Li
Journal:  Biochem Biophys Res Commun       Date:  2016-11-28       Impact factor: 3.575

7.  HDAC inhibition prevents white matter injury by modulating microglia/macrophage polarization through the GSK3β/PTEN/Akt axis.

Authors:  Guohua Wang; Yejie Shi; Xiaoyan Jiang; Rehana K Leak; Xiaoming Hu; Yun Wu; Hongjian Pu; Wei-Wei Li; Bo Tang; Yun Wang; Yanqin Gao; Ping Zheng; Michael V L Bennett; Jun Chen
Journal:  Proc Natl Acad Sci U S A       Date:  2015-02-17       Impact factor: 11.205

8.  Tauroursodeoxycholic acid partially prevents apoptosis induced by 3-nitropropionic acid: evidence for a mitochondrial pathway independent of the permeability transition.

Authors:  C M Rodrigues; C L Stieers; C D Keene; X Ma; B T Kren; W C Low; C J Steer
Journal:  J Neurochem       Date:  2000-12       Impact factor: 5.372

9.  Tauroursodeoxycholic acid reduces endoplasmic reticulum stress, acinar cell damage, and systemic inflammation in acute pancreatitis.

Authors:  Ersin Seyhun; Antje Malo; Claus Schäfer; Christopher A Moskaluk; Ralf-Thorsten Hoffmann; Burkhard Göke; Constanze H Kubisch
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2011-07-21       Impact factor: 4.052

10.  Pharmacological Inhibition of PERK Attenuates Early Brain Injury After Subarachnoid Hemorrhage in Rats Through the Activation of Akt.

Authors:  Feng Yan; Shenglong Cao; Jianru Li; Brandon Dixon; Xiaobo Yu; Jingyin Chen; Chi Gu; Wang Lin; Gao Chen
Journal:  Mol Neurobiol       Date:  2016-02-18       Impact factor: 5.590

View more
  18 in total

1.  Induction of Neuronal PI3Kγ Contributes to Endoplasmic Reticulum Stress and Long-Term Functional Impairment in a Murine Model of Traumatic Brain Injury.

Authors:  Shan Liu; Rong Jin; Adam Y Xiao; Rui Chen; Jarvis Li; Wei Zhong; Xiaozhou Feng; Guohong Li
Journal:  Neurotherapeutics       Date:  2019-10       Impact factor: 7.620

2.  An Integrative Pharmacology-Based Analysis of Refined Qingkailing Injection Against Cerebral Ischemic Stroke: A Novel Combination of Baicalin, Geniposide, Cholic Acid, and Hyodeoxycholic Acid.

Authors:  Chongyang Ma; Xueqian Wang; Tian Xu; Shuang Zhang; Shuling Liu; Changming Zhai; Zisong Wang; Jie Mu; Changxiang Li; Fafeng Cheng; Qingguo Wang
Journal:  Front Pharmacol       Date:  2020-05-08       Impact factor: 5.810

3.  Activation of Sigma-1 Receptor Alleviates ER-Associated Cell Death and Microglia Activation in Traumatically Injured Mice.

Authors:  Mingming Shi; Liang Liu; Xiaobin Min; Liang Mi; Yan Chai; Fanglian Chen; Jianhao Wang; Shuyuan Yue; Jianning Zhang; Quanjun Deng; Xin Chen
Journal:  J Clin Med       Date:  2022-04-22       Impact factor: 4.964

4.  Probiotics ameliorate intestinal pathophysiology in a mouse model of Alzheimer's disease.

Authors:  Harpreet Kaur; Kumi Nagamoto-Combs; Svetlana Golovko; Mikhail Y Golovko; Marilyn G Klug; Colin Kelly Combs
Journal:  Neurobiol Aging       Date:  2020-04-18       Impact factor: 4.673

5.  Stretch-Induced Deformation as a Model to Study Dopaminergic Dysfunction in Traumatic Brain Injury.

Authors:  Hector Rosas-Hernandez; Susan M Burks; Elvis Cuevas; Syed F Ali
Journal:  Neurochem Res       Date:  2019-09-16       Impact factor: 3.996

Review 6.  Synergistic effects of brain injury and aging: common mechanisms of proteostatic dysfunction.

Authors:  Janani Saikumar; Nancy M Bonini
Journal:  Trends Neurosci       Date:  2021-07-20       Impact factor: 16.978

7.  Dynamic changes in growth factor levels over a 7-day period predict the functional outcomes of traumatic brain injury.

Authors:  Shuai Zhou; Dong-Pei Yin; Yi Wang; Ye Tian; Zeng-Guang Wang; Jian-Ning Zhang
Journal:  Neural Regen Res       Date:  2018-12       Impact factor: 5.135

Review 8.  Bile Acid Signaling in Neurodegenerative and Neurological Disorders.

Authors:  Stephanie M Grant; Sharon DeMorrow
Journal:  Int J Mol Sci       Date:  2020-08-20       Impact factor: 5.923

9.  Sevoflurane post-conditioning attenuates traumatic brain injury-induced neuronal apoptosis by promoting autophagy via the PI3K/AKT signaling pathway.

Authors:  Hefan He; Weifeng Liu; Yingying Zhou; Yibin Liu; Peiqing Weng; Yasong Li; Huangde Fu
Journal:  Drug Des Devel Ther       Date:  2018-03-23       Impact factor: 4.162

Review 10.  Tauroursodeoxycholate-Bile Acid with Chaperoning Activity: Molecular and Cellular Effects and Therapeutic Perspectives.

Authors:  Magdalena Kusaczuk
Journal:  Cells       Date:  2019-11-20       Impact factor: 6.600

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.