Epithelial ovarian cancer (EOC) is one of the most malignant gynecological tumors with a high mortality rate owing to tumor relapse after anticancer therapies. It is widely accepted that a rare tumor cell population, known as cancer stem cells (CSC), is responsible for tumor progression and relapse; intriguingly, these cells are able to survive nutrient starvation (such as in vitro culture in the absence of glucose) and chemotherapy treatment. Recent data also indicated that chemotherapy resistance is associated with autophagy activation. We thus decided to investigate both in vitro and in vivo the autophagic activity and the effects of the perturbation of this pathway in CSC isolated from EOC ascitic effusions. Ovarian CSC, identified according to their CD44/CD117 co-expression, presented a higher basal autophagy compared with the non-stem counterpart. Inhibition of this pathway, by in vitro chloroquine treatment or CRISPR/Cas9 ATG5 knockout, impaired canonical CSC properties, such as viability, the ability to form spheroidal structures in vitro, and in vivo tumorigenic potential. In addition, autophagy inhibition showed a synergistic effect with carboplatin administration on both in vitro CSC properties and in vivo tumorigenic activity. On the whole, these results indicate that the autophagy process has a key role in CSC maintenance; inhibition of this pathway in combination with other chemotherapeutic approaches could represent a novel effective strategy to overcome drug resistance and tumor recurrence.
Epithelial ovarian cancer (EOC) is one of the most malignant gynecological tumors with a high mortality rate owing to tumor relapse after anticancer therapies. It is widely accepted that a rare tumor cell population, known as cancer stem cells (CSC), is responsible for tumor progression and relapse; intriguingly, these cells are able to survive nutrient starvation (such as in vitro culture in the absence of glucose) and chemotherapy treatment. Recent data also indicated that chemotherapy resistance is associated with autophagy activation. We thus decided to investigate both in vitro and in vivo the autophagic activity and the effects of the perturbation of this pathway in CSC isolated from EOC ascitic effusions. Ovarian CSC, identified according to their CD44/CD117 co-expression, presented a higher basal autophagy compared with the non-stem counterpart. Inhibition of this pathway, by in vitro chloroquine treatment or CRISPR/Cas9 ATG5 knockout, impaired canonical CSC properties, such as viability, the ability to form spheroidal structures in vitro, and in vivo tumorigenic potential. In addition, autophagy inhibition showed a synergistic effect with carboplatin administration on both in vitro CSC properties and in vivo tumorigenic activity. On the whole, these results indicate that the autophagy process has a key role in CSC maintenance; inhibition of this pathway in combination with other chemotherapeutic approaches could represent a novel effective strategy to overcome drug resistance and tumor recurrence.
Epithelial ovarian cancer (EOC) is the leading cause of death from gynecological malignancies and the fifth leading cause of all cancer-related deaths among women in the Western world.[1] Early diagnosis of ovarian carcinoma has proved difficult to achieve, largely owing to lack of an identified pre-malignant precursor lesion, and owing to the anatomical location of the ovaries.[2] Indeed, the symptoms associated with this malignancy are shared with several other more common gynecologic, gastrointestinal and urinary pathologies. To date, no validated screening test exists as CA-125 dosage, pelvic and transvaginal sonography have very low sensitivity and specificity.[3] As a consequence, ~75% of patients present with signs of metastatic spread at the time of diagnosis, and ~80% of women with advanced disease have a 5-year survival rate of only 30%.[4] In the last two decades, much effort has been spent in employing more effective surgery and combination treatment regimens, typically platinum- and taxane-based, resulting in complete response in 70% of patients.[5] Despite these results, most patients relapse within 18 months with chemo-resistant disease.One emerging model for the development of drug-resistant carcinomas suggests that a pool of self-renewing malignant progenitor cells exists. These rare cancer-initiating cells, also named cancer stem cells (CSC), present several features that confer chemoresistance, such as the expression of membrane efflux transporters, enhanced DNA repair and low mitotic index.[6] Therefore, eradication of the stem cell compartment of a tumor might be the essential and most effective way of curing cancer and allowing long-lasting remission.Recent studies have also revealed metabolic reprogramming as a new hallmark of cancer. In fact, mutations in cancer genes and alterations in metabolic signaling pathways frequently occur.[7] Among these pathways, autophagy deregulation has been associated to tumor dormancy and resistance to treatment. Indeed, in the later stages of tumorigenesis an upregulation of autophagy may represent a mechanism of resistance to oxidative stress induced by chemotherapeutic drugs and may potentiate the survival to hypoxia and nutrient starvation[8] resulting from the frequently defective tumor vascularization. Thus, we decided to evaluate the contribution of this pathway in CSC isolated from ascitic effusions of EOC-bearing patients. We previously demonstrated that ovarian CSC can be easily identified based on surface co-expression of CD117 (c-Kit) and CD44.[9] These double-positive cells, compared with the CD44+CD117− counterpart, are able to form spheroids, express stem cell-associated markers such as NANOG, SOX2, OCT4, as well as multidrug resistance pumps,[9] and present higher tumorigenic potential when injected into immunocompromised mice, thus fulfilling the canonical requirements to be defined CSC.[10]In the present study, we addressed the role of autophagy in the maintenance of the CD44+CD117+ cell pool; we found that autophagy is hyper-activated in ovarian CSC and that this aberrant activation may contribute to chemoresistance and tumor relapse. As a consequence, targeted therapies that specifically inhibit autophagy could represent an important resource to be used in combination with the conventional treatment of EOC.
To investigate whether CSC could present different autophagy activation compared with tumor non-stem cells, we preliminarily confirmed that the co-expression of CD44 and CD117 is the most reliable marker for CSC identification in EOC. To this aim, we evaluated the mRNA expression levels of stemness-associated master genes NANOG, SOX2 and OCT4 in EOC cells FACS-isolated according to the expression of the most utilized markers in the literature: CD133,[11] CD24,[12] ALDH[13] or CD44/CD117. Although CD24 was excluded from the analysis since it was expressed by most tumor cells in our ascitic effusion samples (Supplementary Figure S1A), CD44+CD117+ cells significantly overexpressed NANOG, SOX2 and OCT4, compared with the negative counterpart CD44+CD117− (Supplementary Figure S1D). No differences were detected in mRNA expression levels of these genes between CD113+ and CD133− or ALDHpos and ALDHneg cells (Supplementary Figure S1B-C), thus supporting our choice of CD44/CD117 co-expression as CSC marker in EOC.Next, we evaluated the autophagic flux of ovarian CSC. Autophagy is invariably associated with the conversion of the microtubule-associated protein LC3 from its cytosolic form (LC3-I) to its autophagosome-associated form (LC3-II).[14] Hence, we analyzed by western blotting (WB) the levels of LC3-II in FACS-sorted CD44+CD117+ and CD44+CD117− cells from primary samples of ascitic effusions, collected from patients affected by EOC (Table 1). We took advantage of the autophagy inhibitor bafilomycin, which blocks the fusion of autophagosomes with lysosomes and therefore allows us to clamp autophagosome consumption, as previously described.[14] As shown in Figure 1a, CD44+CD117+ cells presented a more active basal autophagy compared with CD44+CD117− cells, as represented by the significantly higher ex vivo levels of LC3-II in basal conditions. Treatment with bafilomycin A1 (BafA1) induced in both cell populations an increase in LC3-II (Figure 1a). The different basal autophagy activation between CSC and non-CSC was confirmed by protein level analysis of p62, a well-known target of autophagy. Indeed, p62, also known as sequestosome 1, binds ubiquitinated protein aggregates within the autophagosomes, contributing to their lysosomal degradation. When autophagy is inhibited, p62 levels increase, making it a useful marker for the autophagic flux.[15] Results indicated that CD44+CD117+ cells present significantly lower levels of p62 compared with non-CSC counterpart (Figure 1b), meaning higher p62 degradation within the autophagosomes. However, the autophagic flux (calculated as LC3-II ratio between BafA1-treated and untreated cells) did not show any significant difference in the two cell subsets (Figure 1c). Autophagic activity was also analyzed by intracellular autophagosome staining with Cyto-ID autophagy kit and quantified by flow cytometry. The obtained results confirmed a significantly higher basal autophagic activity in CD44+CD117+ cells, as indicated by a higher MFI of CSC than non-CSC once subtracted the correspondent unstained control, thus corroborating the WB data (Figure 1d). Real-Time PCR performed on ex vivo sorted CD44+CD117− and CD44+CD117+ did not highlight any difference in LC3 mRNA (Figure 1e), indicating that the higher protein levels of LC3-II (Figure 1a) were likely not owing to gene upregulation in CSC but rather an indicator of enhanced autophagic activity.
Table 1
Clinical characteristics of EOC-bearing patients and association with the percentage of CSC
N (% of total)
%CSC (range)
P-valuea
Histotype
NS
Serous
36 (90)
2.05±2.0 (0.62–12.6)
Mucinous
1 (2.5)
1.18 (–)
Undifferentiated/clear cells
3 (7.5)
2.5±1.01 (1.5–3.50)
Stage
NS
3A
1 (2.5)
2.69 (–)
3B
4 (10)
1.29±1.6 (1.28–4.24)
3C
24 (60)
1.59±0.5 (0.62–2.50)
4
11 (27.5)
2.8±3.3 (0.8–12.6)
Grading
NS
G1
3 (7.5)
2.05±1.2 (1.44–3.53)
G2
0 (0)
–
G3
37 (92.5)
2.09±1.95 (0.6–12.6)
Total
40 (100)
Abbreviation: NS, not significant
χ2 test
Figure 1
CD44+CD117+ ovarian CSC show higher basal autophagy than their CD44+CD117− non-stem counterpart. (a, b) WB analysis of LC3-II/LC3-I ratio (a) or p62 (b) protein expression in FACS-sorted CD44+CD117+ and CD44+CD117− cells from primary samples of EOC ascitic effusions. After sorting, cells were either treated with 100 nM BafA1 for 2 h or left untreated. Signal intensities of the LC3-II, LC3-I and p62 bands were quantified by scanning densitometry, and normalized against the actin signal. The graph on the right shows mean expression ratios±S.D. from four different experiments. *P<0.05. (c) The autophagic flux was calculated dividing LC3-II normalized signal intensity of BafA1-treated cells by the signal intensity of untreated cells for each cell subpopulation. The bar shows mean±S.D. from four different experiments. (d) Flow cytometry analysis of autophagic activity in CD44+CD117+ and CD44+CD117– cells from EOC ascitic effusions and PDX. The cells were labeled with anti-CD44, anti-CD117 antibodies and Cyto-ID Autophagy detection kit. One representative experiment out of seven is shown (left panel). The graph shows the mean fluorescence intensity (MFI)±S.D. calculated from seven experiments (right panel). *P<0.05. Auto=unstained cells; Cyto-ID= stained cells. (e) qRT-PCR analysis of LC3 mRNA expression in FACS-sorted CD44+CD117+ and CD44+CD117− cells. Shown are mean relative expression values in CD44+CD117+ cells compared with CD44+CD117− cells (±S.D.) measured in four samples. (f) EOC primary and PDX cells were analysed by qRT-PCR for the expression of CD117. Shown are mean relative expression values (±S.D.) in samples cultured in spheroid-forming conditions compared with the same samples cultured in adherent conditions (n=4). *P<0.05. (g) WB analysis of LC3-II/LC3-I ratio protein expression in adherent cells versus spheroid cells from EOC effusions (left panel). Cells were either treated with 100 nM BafA1 for 2 h or left untreated. Signal intensities of the LC3-II and LC3-I bands were quantified by scanning densitometry and normalized against the actin signal. The graph shows mean expression ratios±S.D. from four consecutive experiments (right panel). (h) The autophagic flux was calculated by dividing LC3-II normalized signal intensity of BafA1-treated cells by the signal intensity of untreated cells for each cell subpopulation. The bar shows mean±S.D. from four experiments
We next took advantage of a spheroid-formation assay as a model to further study the autophagic flux in ovarian CSC-enriched population. Cancer cells obtained from primary EOC samples and patient-derived xenografts (PDX), generated by orthotopic injection of EOC cells into immunodeficient animals,[16] were cultured for 2 weeks under stem cell conditions (as detailed in Materials and Methods). PDX fully recapitulate the composition of the corresponding primary samples, as well as the CSC theory (Supplementary Figure S2). The enrichment in CSC was measured by evaluating the mRNA expression levels of CD117 in cells maintained in normal (adhesion) and in stem cell culture conditions (spheroids) (Figure 1f). Both cultures were treated with BafA1 as above, and LC3-II protein levels compared with the corresponding untreated samples. As demonstrated in FACS-sorted CSC, also the CSC-enriched spheroids presented higher basal autophagy compared with the adherent counterpart (Figure 1g). The autophagic flux, instead, calculated as the ratio between BafA1-treated and untreated cells, was again comparable in adherent cells and spheroids (Figure 1h).Altogether, these experiments indicate that both ex vivo-derived and PDX-derived ovarian CSC show a prominent autophagic activity, compared with the bulk of tumor cells.
Inhibition of autophagy affects canonical CSC properties
The interconnection between autophagy and maintenance of the CSC phenotype was further investigated by culturing EOC cells in CSC-enriched spheroid culture for 2 weeks. The cells were then treated with different concentrations of the autophagy inhibitor chloroquine (CQ; 10, 20 and 50 μM) for 72 h. In parallel, chloroquine treatment was performed on the same samples cultured in adherent conditions. Interestingly, we observed a higher sensitivity to chloroquine treatment of spheroids (in terms of cell viability reduction) when compared with the counterpart maintained in adherent conditions (Figure 2a), suggesting that autophagy might be particularly important for the maintenance of ovarian CSC viability. In another set of experiments, in which chloroquine (2, 5 and 10 μM) was added at the beginning of culture in stemness conditions and spheroid generation was evaluated 1 week later, we observed a dose-dependent cell viability reduction (Figure 2b) as well as a decrease in the mean diameter of the obtained spheroids (Figure 2c).
Figure 2
Autophagy inhibition by chloroquine reduces in vitro spheroid-forming ability of ovarian CSC. (a) Cell viability analysis by Live/Dead staining of EOC ascitic effusion cells cultured either in adherent or spheroid-forming conditions for 2 weeks and then treated with chloroquine (CQ, 10, 20 or 50 μM) for 72 h. The graph represents the mean cell viability of three experiments normalized by the untreated cells (CTRL) for each culture condition. *P<0.05. (b) Cell viability analysis by Live/Dead staining of EOC effusion cells maintained for 1 week in spheroid-culture conditions in the presence of chloroquine (CQ, 2, 5 or 10 μM). The bar shows mean±S.D. from three consecutive experiments. *P<0.05. (c) Spheroid diameter evaluation of EOC effusion cells cultured in the presence (CQ) or absence of chloroquine (CTRL). The bars on the left panel show mean±S.D. of treated cells normalized by the untreated ones of three different experiments. *P<0.05. On the right, representative pictures of spheroids obtained in the different culture conditions from two primary EOC samples
To further demonstrate the importance of autophagy in CSC maintenance, we took advantage of the CRISPR/Cas9 genome editing technique to stably knockout the autophagy-related gene-5 (ATG5) in an EOC cell line (OVCAR-3). ATG5 acts as an E3-ubiquitin ligase involved in the elongation of autophagosome, the initial step of the autophagic process. Cells lacking ATG5 fail to induce autophagy, resulting in impaired LC3-I conversion into LC3-II and accumulation of p62.In our setting, WB analysis demonstrated that the reduction of ATG5 protein levels in OVCAR-3 cells was obtained only with two constructs (ATG5 KO#1 and KO#2) out of three tested (Supplementary Figure S3A). The ATG5-knockout cells presented significantly lower LC3-II protein levels and a correlated accumulation of p62 compared with cells transduced with the empty vector (EV; Figure 3a). Accordingly, treatment with BafA1 increased LC3-II/LC3-I ratio and p62 protein levels in control OVCAR-3 cells, whereas only a slight but not significant increase of the ratio was detected in ATG5 KO#1- and #2-transduced cells after 2 h of BafA1 treatment (Figure 3a).
Figure 3
ATG5 is critical for CSC in vitro spheroid-forming ability and in vivo tumorigenic potential. (a) Western blot analysis of ATG5, p62 and LC3-II/LC3-I expression in CRISPR/Cas9 knockout OVCAR-3 cells either treated with 100 nM BafA1 for 2 h or left untreated. The cells were transduced with empty vector (EV), or two different constructs for ATG5 knockout (KO#1 and KO#2). Signal intensities of the bands were normalized against the actin signal. One representative blot is shown on the left panel; on the right panel, the graph shows mean expression ratios±S.D. from five different experiments. *P<0.05. (b) Flow cytometry analysis of CD44/CD117 co-expression in OVCAR-3 cells transduced with empty vector (EV), or two different constructs for ATG5 knockout (KO#1 and KO#2) after 2 weeks in normal (Adhesion) or stemness-culture conditions (Spheroids). Data are expressed as mean±S.D. from three experiments. *P<0.05. (c) Extreme Limiting Dilution Assay (ELDA) of EV, ATG5 KO#1 and ATG5 KO#2 OVCAR-3 cells. Data are expressed as mean±S.D. from three experiments. *P<0.05. (d) Spheroid diameter evaluation of EV, ATG5 KO#1 and ATG5 KO#2 OVCAR-3 cells. The mean spheroid diameter (±S.D.) from three experiments normalized by the EV is plotted in the left graph; representative pictures of spheroids are shown on the right. *P<0.05. (e) Tumor growth curves of non-transduced (NT), EV, ATG5 KO#1 and ATG5 KO#2 OVCAR-3 cells s.c. injected into NSG mice. Data are mean values±S.D.; n=5 for NT, n=6 for EV, n=7 for ATG5 KO#1 and #2; *P<0.05. *ATG5 KO#1, ATG5 KO#2 versus NT; §ATG5 KO#1, ATG5 KO#2 versus EV. (f) Representative pictures of tumors at the end of the experiments (45 days). (g) Ex vivo flow cytometry analysis of CD117 expression within the CD44pos cells isolated from tumors generated from non-transduced (NT), EV, ATG5 KO#1 and ATG5 KO#2 OVCAR-3 cells s.c. injected into NSG mice. On the left representative plots; on the right the histogram showing the mean values±S.D.; n=5 for NT, n=6 for EV, n=7 for ATG5 KO#1 and #2; *P<0.05. (h) Histogram showing the mean values±S.D. of ex vivo flow cytometry analysis of Ki67 expression within CD44+CD117+ cells isolated from NT, EV, ATG5 KO#1 and #2 tumors. n=5 for NT, n=6 for EV, n=7 for ATG5 KO#1 and #2
We then evaluated the effects of ATG5 silencing on CSC ability to form spheroidal structures in vitro. After 2 weeks in stemness-culture conditions we observed an expansion of the CSC compartment in OVCAR-3 cells transduced with the EV (Figure 3b) compared with cells maintained in adhesion. On the contrary, the percentage of CD44+CD117+ cells only slightly increased in ATG5 KO#1- and ATG5 KO#2-transduced cells under spheroid-forming culture condition. In both culture conditions, the percentage of double-positive cells in ATG5-knockout cells was significantly lower compared with EV cells (Figure 3b). In line with this finding, Extreme Limiting Dilution Assay (ELDA) analysis demonstrated that autophagy inhibition by stable gene silencing was correlated with a reduction in the ratio of spheroid-forming cells (Figure 3c). However, the ATG5 knockout was not associated with an alteration in the mean spheroid diameter (Figure 3d), indicating that autophagy blockade may interfere with CSC self-renewal rather than proliferation. Indeed, cell cycle analysis and colony formation assay performed in ATG5-knockout cells maintained in adhesion culture conditions did not show any difference between EV, ATG5 KO#1- or KO#2-transduced OVCAR-3 cells (Supplementary Figure S3B, S3C and S3D). Finally, we evaluated the effects of ATG5 silencing on CSC tumorigenic potential. To this end, we injected subcutaneously (s.c.) non-transduced (NT), EV- or ATG5 KO#1- and KO#2-transduced OVCAR-3 cells into immunodeficientmice. As shown in Figures 3e and f, tumors from ATG5 knockout cells grew more slowly than those obtained from NT cells or cells transduced with the EV. Ex vivo flow cytometry analysis revealed a significant reduction of the CD44+CD117+ cell percentage in ATG5-KO tumors compared with NT and EV-transduced ones (Figure 3g). However, no difference was detected in the proliferative potential of CSC, as demonstrated by the evaluation of Ki67 expression (Figure 3h).Altogether, these results show that autophagy blockade by different pharmacologic and genetic approaches severely impairs canonical CSC properties, such as the ability to form spheroids and the efficiency of tumor generation in immunodeficient animals, without affecting CSC proliferation.
Autophagy blockade reduces CSC ability to resist in vitro and in vivo chemotherapy treatment
Another feature of CSC, which represents an important limit to conventional therapy, is their ability to resist chemotherapeutic treatment. It has been reported that autophagy is induced in established ovarian cancer cell lines in response to platinum salts as a survival mechanism, resulting in a sensitization of the cells to the treatment when autophagy is suppressed.[17] Thus, we evaluated carboplatin-mediated autophagy activation by intracellular autophagosome staining in primary EOC and PDX samples. As shown in Figure 4a, 72 h of in vitro carboplatin treatment induced a significant MFI increase in CD44+CD117+ cells.
Figure 4
Autophagy blockade impairs CSC resistance to chemotherapy treatment. (a) Flow cytometry analysis of autophagic activity in CD44+CD117+ and CD44+CD117− cells by Cyto-ID Autophagy detection kit. Cells were either treated in vitro with carboplatin (20 μg/ml) for 72 h or left untreated. Data are expressed as Mean Fluorescent Intensity (MFI)±S.D. calculated from three experiments *P<0.05. (b) Extreme Limiting Dilution Assay (ELDA) of EOC ascitic effusion cells, isolated from both primary and PDX samples, following different treatment regimens. FACS-sorted alive tumor cells were cultured in vitro for 72 h under normal culture conditions in the presence of CQ (20 μM), CPT (20 μg/ml) or the combination of the two drugs, and subsequently plated in spheroid-forming conditions for ELDA. Data are expressed as mean±S.D. from three consecutive experiments, *P<0.05. (c) Spheroid diameter evaluation of EOC effusion cells, isolated from both primary and PDX samples, following different treatment regimens, as described in c. The mean spheroid diameter (±S.D.) from three experiments normalized by the untreated cells (CTRL) is plotted in the graph. *P<0.05. (d–e) Flow cytometry analysis of CD44/CD117 co-expression (d) and cell viability (e) in OVCAR-3 cells transduced with empty vector (EV), or two different constructs for ATG5 knockout (KO#1 and KO#2), treated in vitro for 72 h with carboplatin (20 μg/ml) or left untreated. Data are expressed as mean±S.D. from three experiments. *P<0.05. (f) Tumor growth curves in NSG mice treated with saline solution (as a control, CTRL), carboplatin (CPT, 50 mg/Kg weekly), chloroquine (CQ, 100 mg/Kg every 2 days) or the combination of the two, after s.c. injection of EOC effusion cells from PDX samples. Data are mean values±S.D. of six tumors/group. P<0.05.*CPT+CQ versus CQ alone; §CPT+CQ versus CPT alone; #CPT+CQ versus CTRL. The arrow indicates when treatment started. On the right representative pictures of tumors (two tumors/group) at the end of one (out of three) experiments performed. (g) Ex vivo flow cytometry analysis of CD44/CD117 co-expression (left panel) and Ki67 (right panel) in tumor harvested from mice treated with saline solution (CTRL), carboplatin (CPT), chloroquine (CQ) or the combination of the two drugs (CPT+ CQ). Data are expressed as mean±S.D. from four tumors/group. *P<0.05
Therefore, we addressed the role of autophagy in stress conditions by evaluating the effect of carboplatin, alone and in combination with chloroquine, on the spheroid-forming ability of tumor cells from EOC patients. To this end, EOC cells derived from primary samples or PDX were pulsed for 72 h with carboplatin, chloroquine or the combination of the two; subsequently, equal numbers of live cells were plated in spheroid-forming conditions according to the ELDA protocol (see Materials and Methods). As shown in Figure 4b, pre-treatment of tumor cells with the autophagy inhibitor chloroquine or with carboplatin alone did not cause any significant change in the spheroid-forming ratio, compared-to-untreated cells. On the contrary, pre-treatment for 72 h with a combination of carboplatin and chloroquine caused a dramatic decrease in the number of spheroid-forming cells (Figure 4b). In addition, the mean spheroid diameter was lower in samples pre-treated with chloroquine or carboplatin alone or the combination of the two (Figure 4c). These data indicate that autophagy is a key mechanism exploited by ovarian CSC to survive carboplatin treatment. To better demonstrate the efficacy of carboplatin-chloroquine combined treatment, we determined the combination index (CI) in primary and PDX samples (as described in Materials and Methods). As reported in Supplementary Table S1, the results indicated a synergistic effect of the two drugs when used at the concentration of 20 μg/ml (for carboplatin) and 20 μM (for chloroquine). Similar conclusions could be drawn from experiments in which ATG5 knockout OVCAR-3 cells were treated in vitro with carboplatin (20 μg/ml). Treatment of control cells transduced with the EV induced, as previously reported, a statistically significant selection of double-positive, drug-resistant CSC (Figure 4d). On the contrary, carboplatin treatment was not associated with an increase in the percentage of CD44+CD117+ cells in ATG5 KO#1- and ATG5 KO#2-transduced cells, thus indicating that autophagy blockade increases CSC platinum sensitivity (Figure 4d). Indeed, cell viability of ATG5 KO#1 and #2 CD44+CD117+ cells was significant reduced by carboplatin treatment, compared with CSC from EV-transduced cells (Figure 4e).Finally, to evaluate the effect of autophagy inhibition on the CSC tumorigenic potential, PDX cells were injected s.c. into NSG mice. The animals were then treated with different therapeutic regimens: saline solution (as a control), chloroquine, carboplatin or a combination of the two. Both treatments with carboplatin and chloroquine alone significantly slowed tumor growth, compared with control. Strikingly, combination treatment had a synergistic effect inducing an even more pronounced tumor growth reduction (Figure 4f). Again, ex vivo analysis demonstrated that autophagy can represent a survival mechanism adopted by CSC to resist chemotherapy treatment. Indeed, the percentage of CD44+CD117+ cells was significantly lower in tumor harvested from combined-treated mice (carboplatin+chloroquine) compared with untreated or single-treated mice (Figure 4g, left panel). Moreover, ex vivo Ki67 analysis within the CD44+CD117+ compartment further demonstrated that autophagy blockade did not affect CSC proliferation (Figure 4g, right panel).
Discussion
One of the major hurdles in EOC treatment is to overcome tumor relapse. By now, it is largely accepted that tumor growth, progression and relapse are sustained by CSC,[18] a small cell subset able to resist both chemo- and radio-therapy treatment in vitro and in vivo. Several mechanisms may be involved in CSC resistance, including the ability to enter quiescence, and the expression of multidrug resistance pumps or detoxifying enzymes; in the last decade, the activation of autophagy has also been identified as a survival mechanism potentially exploited by CSC. The term ‘autophagy’ defines a cellular process of lysosomal degradation of self-components. It refers to a multistep mechanism that has been thoroughly characterized at the molecular level (reviewed by Yang and Klionsky[19]). In cancer, autophagy plays a complex role depending on tumor stage, type and genetic background.[20] In the early stages of tumorigenesis, it has a protective effect by preventing the accumulation of defective organelles, such as pro-oxidative mitochondria, which could enhance the rate of DNA mutation. Consistent with this, inactivating mutations of genes that positively regulate autophagy facilitate tumor formation. In later stages of tumor progression, autophagy activation seems to be a survival mechanism that counteracts the damage induced by chemotherapy or nutrient/oxygen starvation and sustains tumor growth by recycling of degraded metabolites.[21] High autophagy levels have been detected in CSC derived from different solid and hematologic malignancies.[22, 23, 24, 25, 26] However, the precise role of autophagy in cancer progression and the contribution of this pathway to CSC resistance to treatment is still unknown in ovarian tissue. Thus, we decided to evaluate autophagy activation and the effects of its perturbation in CD44+CD117+ CSC isolated from ascitic effusions collected from EOC-bearing patients.[9, 27, 28, 29]
Ex vivo analysis indicated that FACS-sorted CD44+CD117+ cells present a higher basal autophagy activation compared with the non-stem counterpart, as demonstrated by higher LC3-II protein levels and autophagosome staining, and lower p62 levels. Similarly, cells maintained in spheroid cultures, enriched in CSC, showed higher protein levels of the LC3-II marker of autophagosome formation (Figure 1).The relevance of autophagy activation for the maintenance of canonical CSC features was first addressed by treating for 72 h EOC cell cultures with chloroquine, a known inhibitor of this pathway. Our results indicated that chloroquine affects CSC viability in a dose-dependent manner, inducing a stronger cell viability reduction in EOC cells cultured in vitro in spheroid-forming conditions compared with cells maintained in a differentiated/adhesion state. Moreover, treatment with lower doses of chloroquine for 1 week inhibited in vitro spheroid growth, as demonstrated by the reduction of spheroid diameter (Figure 2).Next to chloroquine treatment, we knocked-out ATG5, involved in the regulation of the initial phase of the autophagy process. ATG5 knockout also impaired all the canonical features of CSC: indeed, ATG5-KO cells presented a lower percentage of CD44/CD117 co-expressing CSC, lower spheroid-forming ability and reduced tumorigenicity when injected s.c. into immunocompromised mice (Figure 3). Moreover, ATG5 silencing increased in vitro CSC sensitivity to chemotherapy as demonstrated by the significant reduction in the co-expression of CD44 and CD117 and their cell viability upon 72 h of carboplatin treatment (Figure 4).However, unlike in vitro chloroquine treatment, the absence of ATG5 did not affect CSC proliferation, as demonstrated by cell cycle analysis, Ki67 expression, spheroid diameter evaluation and colony formation assay (Figure 3 and Supplementary Figure S3). These data indicated that autophagy is mainly involved in self-renewal/maintenance rather than in growth inhibition of CSC. The different results obtained with chloroquine treatment and ATG5 knockout could be in part explained by the autophagy-independent cytotoxic effect of chloroquine which has been reported to induce apoptosis both through p53-dependent and p53-indipendent mechanisms in melanoma and glioma cells.[30, 31]As a whole, our results suggest that autophagy is profoundly involved into CSC regulation. Thus, to better demonstrate that autophagy inhibition could be a strategy to reduce CSC survival during anticancer treatment, we treated immunodeficientmice, s.c. injected with PDX cells, with carboplatin and chloroquine. Interestingly, the combination of the two treatments acted synergistically by significantly reducing tumor growth, compared with chloroquine or carboplatin alone (Figure 4). Ex vivo analysis demonstrated that such tumor growth delay was due to a reduction in the CSC compartment, rather than a reduction in CSC proliferative potential. The enhancement of chemotherapy effectiveness associated with chloroquine treatment has been already demonstrated in other tissues such as liver, pancreas, breast and colon,[32, 33, 34, 35, 36] and our results suggest a possible clinical application of the combined therapy in the treatment of EOC: at the same time, this approach would offer the possibility to counteract tumor growth and impair the CSC compartment, thus reducing tumor relapse.In conclusion, these results point to the combination of autophagy inhibition with anticancer treatment as a possible strategy to overcome the limits of current therapies in the eradication of EOC CSC population.
Materials and methods
Primary samples, cell lines and in vitro culture
This study was approved by the Institutional Ethics Committee for patient studies, according to the principles of the Declaration of Helsinki. Ascitic effusions were obtained from 40 EOC patients that provided written informed consent. Patients' clinical and pathologic features are summarized in Table 1. Tumor cells were isolated and maintained in RPMI-1640 medium supplemented with 10% FBS (GIBCO Invitrogen, Monza, Italy), 1% Penicillin/Streptomycin (Lonza, Basel, Switzerland), 1% sodium pyruvate (Lonza), and 1% l-glutamine (GIBCO). Cells were cultured at 37 °C, 5% CO2, and harvested at confluence using trypsin-EDTA (Invitrogen). OVCAR-3 cells were purchased from ATCC (Manassas, VA, USA) and cultured in the same conditions as primary samples. The cells were harvested, when 80–90% confluent, using Trypsin-EDTA (Invitrogen) and used within six months from resuscitation.For spheroid-culture conditions, cells were plated in poly-2-hydroxyethyl methacrylate (PhEMA)-coated plates (Corning, NY, USA) in serum-free DMEM/F12 medium (Invitrogen) supplemented with bFGF (20 ng/ml, Peprotech, Rocky Hill, NJ, USA), EGF (20 ng/ml, Peprotech) and B27 (GIBCO) at a density of 5 × 104 cells/well. Medium was replaced every 7 days. To evaluate spheroid-forming capacity and diameter modulation induced by chloroquine or carboplatin, cells were pre-treated in normal culture condition to avoid the effect of serum deprivation culture. After 72 h, cells were transferred to phEMA-coated plates as described above. Before evaluating LC3 protein levels and the cytotoxic effect of chloroquine on spheroid compared with adherent cells, the spheroid culture were kept in complete medium over-night.For autophagy flux evaluation, BafA1 (Sigma-Aldrich, St Louis, MO, USA) was added to the cells for 2 h at the final concentration of 100 nM.[37]According to experimental designs, cells were treated in vitro with chloroquine (CQ; Sigma-Aldrich) at the final concentration of 2, 5, 10, 20 or 50 μM, or with carboplatin (CPT, 20 μg/ml). For CI evaluation, cells were in vitro treated with different doses of chloroquine and carboplatin and their combination; after 72 h cell viability was evaluated by AnnexinV/PI staining and data were subjected to automatic calculation of CI using CompuSyn software.[38]
Flow cytometry
The cells were stained with Live-Dead to discriminate living cells. The following anti-human antibodies were used: anti-CD44 (1:1,000; Abcam, Cambridge, UK), anti-CD117 (non-activating AC126 clone, 1:10; Miltenyi-Biotec, Bergish Gladbach, Germany), anti-CD45 (1:10; Miltenyi-Biotec) and anti-Ki67 (1:10; BD Bioscience, Franklin Lakes, NJ, USA). All the cytofluorimetric analyses were performed using a FACS LSRII (BD); data were collected from at least 1 × 105 cells/sample and elaborated with FlowJo software (TreeStar, Ashland, OR, USA). For FACS sorting, antibody-labeled cells were separated with a MoFloAstrios Cell Sorter (Beckman Coulter, Brea, CA, USA); the purity of the sorted populations always exceeded 90%. To evaluate autophagic activity, EOC effusion cells were labeled with Cyto-ID Autophagy detection kit (Enzo Life Sciences).For cell cycle analysis, cells were fixed with cold ethanol and then incubated for 1 h in a Dapi/RNAse solution. For cell viability analysis, cells were incubated for 15 min at 37 °C with AnnexinV/PI staining kit (Roche, Basel, Switzerland).
WB
FACS-sorted CD44+CD117+ and CD44+CD117− cells, cells cultured in adhesion or spheroid-forming conditions, or OVCAR-3 cells were lysed and subjected to SDS-PAGE and WB. Immunoreactivity was evaluated using the following antibodies: anti-actin (1:500; Sigma-Aldrich), anti-LC3B (1:1000; Cell Signaling Technology, Boston, MD, USA), anti-ATG5 (1:1000; Cell Signaling Technology) and anti-p62 (1:1000; Genetex, San Antonio, TX). The blots were hybridized with a 1:5000 dilution of HRP-conjugated anti-mouse or anti-rabbit antibody (Amersham-Pharmacia, Little Chalfont, UK), as appropriate. Finally, the signal was detected by chemiluminescence with SuperSignal kit (Pierce, Rockford, IL, USA), and lane densitometry analyzed by standard procedures.
ELDA
To determine the frequency of spheroid-forming precursors, we performed an ELDA in EOC or OVCAR-3 cells. Cells were pre-treated in adhesion culture condition with chloroquine (20 μM), carboplatin (20 μg/ml), the combination of the two, or left untreated. After 72 h, the cells were counted and plated at different concentrations in 96-well flat-bottom ultra-low attachment PhEMA-coated plates (Corning) in a total volume of 0.1 ml of serum-free DMEM/F12 medium supplemented with B27 (Gibco), EGF (20 ng/ml, Peprotech) and bFGF (20 ng/ml, Peprotech). Thirty replicate wells were set up for each cell concentration. After 10 days of incubation, the wells were scored for spheroid formation; the frequency of spheroid-forming precursors in each population was calculated by ELDA web tool (http://bioinf.wehi.edu.au/software/elda). Data are expressed as the number of spheroid-forming cells/103 cells.
Colony formation assay
For colony formation assay, cells were plated at different densities under normal culture conditions in complete RPMI medium. After 10 days, cells were washed in PBS and then fixed with cold methanol for 10 min at +4 °C. Staining was performed with crystal violet 33% solution for 2 min at RT. Pictures were acquired with Leica EC3 microscope.
RNA extraction, reverse transcription and quantitative PCR
Total RNA was extracted by the TRIzol method according to manufacturer’s instructions. The PCR step was performed using an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Results were analyzed using the comparative ΔΔCt method; ΔΔCt values were utilized to calculate the RQ=2−ΔΔCt. Data were expressed as the fold difference in gene expression (normalized to the housekeeping gene β2-microglobulin) relative to a reference sample, as indicated in the individual figure legends. qRT-PCR efficiency ranged from 95% to 105%. Primer sequences were CD117: 5′-GGATTCCCAGAGCCCACAAT-3′ and 5′-GGCAGTACAGAAGCAGAGC-3′ B2-micro: 5′-TCTCTCTTTCTGGCCTGGAG-3′ 5′-TCTCTGCTGGATGACGTGAG-3′ LC3: 5′-AGACCTTCAAGCAGCGCCG-3′ and 5′-ACACTGACAATTTCATCCCG-3′
CRISPR/Cas9 ATG5 knockout
Single Guide RNAs (sgRNAs) to ATG5 were designed using the online guide http://www.e-crisp.org/E-CRISP/designcrispr.html. The following sgRNAs were used: ATG5 KO#1 GTGCTTCGAGATGTGTGGTT, KO#2 GATCACAAGCAACTCTGGAT and KO#3 GGCCATCAATCGGAAACTCA, targeting, respectively, exon 2, 5 and 6. The LentiCRISPR v2 vector, gift from Feng Zhang (Addgene plasmid # 52961), was digested with BsmB1 and ligated with annealed sgRNAs.[39]
In vivo studies
Severe combined immunodeficiency (NOD/SCID) and NSG mice were obtained from internal breeding. Procedures involving animals and their care were performed according to institutional guidelines that comply with national and international laws and policies (EEC Council Directive 86/609, OJ L358, 12 December 1987). PDX were generated by injecting intraperitoneally into NOD/SCIDmice 5 × 105 tumor cells from ascitic effusions of EOC patients.[16]For chloroquine and carboplatin treatment, 5 × 105 CD45-CD44+ tumor cells or OVCAR-3 cells were isolated by FACS sorting from high-grade serous ovarian cancer PDX, and injected s.c. in 200 μl of Matrigel in both dorsolateral flanks of NSG mice. When tumors reached 100 mm3 volume, mice were randomized in four groups, and treated with chloroquine (100 mg/kg every 2 days), carboplatin (50 mg/Kg weekly), both drugs, or with equal saline amounts as a control. Tumor growth was evaluated by caliper measurements. Mice were killed when the tumors of the control group reached 600–800 mm3 volume.
Statistical analysis
Data from replicate experiments were shown as mean values±S.D. Comparisons between groups were done by the two-tail Student’s t-test and Mann–Whitney test, as appropriate.
Authors: Paul P Szotek; Rafael Pieretti-Vanmarcke; Peter T Masiakos; Daniela M Dinulescu; Denise Connolly; Rosemary Foster; David Dombkowski; Frederic Preffer; David T Maclaughlin; Patricia K Donahoe Journal: Proc Natl Acad Sci U S A Date: 2006-07-18 Impact factor: 11.205
Authors: Michael D Curley; Vanessa A Therrien; Christine L Cummings; Petra A Sergent; Carolyn R Koulouris; Anne M Friel; Drucilla J Roberts; Michael V Seiden; David T Scadden; Bo R Rueda; Rosemary Foster Journal: Stem Cells Date: 2009-12 Impact factor: 6.277
Authors: Stephanie L Lomonaco; Susan Finniss; Cunli Xiang; Ana Decarvalho; Felix Umansky; Steven N Kalkanis; Tom Mikkelsen; Chaya Brodie Journal: Int J Cancer Date: 2009-08-01 Impact factor: 7.396
Authors: C Gong; C Bauvy; G Tonelli; W Yue; C Deloménie; V Nicolas; Y Zhu; V Domergue; V Marin-Esteban; H Tharinger; L Delbos; H Gary-Gouy; A-P Morel; S Ghavami; E Song; P Codogno; M Mehrpour Journal: Oncogene Date: 2012-06-25 Impact factor: 9.867
Authors: Y Zhang; Y Cheng; X Ren; L Zhang; K L Yap; H Wu; R Patel; D Liu; Z-H Qin; I-M Shih; J-M Yang Journal: Oncogene Date: 2011-07-11 Impact factor: 9.867
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016
Figure 1
Figure 2
Figure 3
Figure 4