Literature DB >> 28717309

Molecular characterization of antibiotic-resistant Staphylococcus aureus from livestock (bovine and swine).

Asima Zehra1, Randhir Singh1, Simranpreet Kaur1, J P S Gill1.   

Abstract

AIM: The aim of this study was to figure the prevalence, phenotypic and genotypic antibiotic resistance (AR) pattern of Staphylococcus aureus isolated from bovine and swine nares.
MATERIALS AND METHODS: Colonies with typical morphology on Baird-Parker agar supplemented with egg-yolk tellurite emulsion were selected and biochemically/genotypically identified as S. aureus. These strains were further subjected to epsilometer test for their sensitivity to various clinically important antibiotics and antibiotic susceptibility testing for amoxicillin/clavulanic acid, and double-disk diffusion testing was performed by the standard disc diffusion method following CLSI guidelines. S. aureus strains were also tested for the presence of AR genes, viz., blaZ, mecA, aacA-aphD, erm (ermA, ermB, ermC), tet (efflux genes tetK and tetL, tetM and tetO of the ribosomal protection family), and vanA.
RESULTS: The nasal cavities of 17 out of 47 randomly selected bovine and 20 out of 28 randomly selected swine were positive for S. aureus, representing the prevalence of 36.2% (95% confidence interval [CI]: 22.5-49.9) and 71.4% (95% CI: 54.7-88.1), respectively. Most of the S. aureus strains showed higher resistance to penicillin (94.6%, minimal inhibitory concentration [MIC] ≥1.5 µg/ml) followed by ciprofloxacin (56.7%, MIC ≥32 µg/ml) and tetracycline (18.9%, MIC ≥32 µg/ml). About 10-15% of the strains were resistant to gentamicin (MIC 16 µg/ml) and oxacillin (MIC 6-8 µg/ml). None of the strains were resistant to vancomycin (MIC 0.25-1.5 µg/ml). In this study, 32.4% strains were resistant to three or more than three antibiotics and prevalence of this multi-drug resistant S. aureus was 45% (95%CI: 26.6-63.4) and 17.6% (95%CI: 6.7-28.5) in swine and bovine nasal samples, respectively. Four strains from pigs were borderline oxacillin-resistant S. aureus MIC 6-8 µg/ml, but none were mecA positive. Two of these strains were β-lactamase hyperproducers. Among the resistance genes blaZ, tetK, tetL, tetM, ermB, and aacA-aphD were found.
CONCLUSION: Our results demonstrated the absence of mecA and pvl gene, but the presence of multi-drug resistant S. aureus in the nares of healthy animals which has a potential to spread in a community.

Entities:  

Keywords:  Staphylococcus aureus; antibiotic resistance genes; epsilometer test; livestock nasal swabs; multidrug resistance

Year:  2017        PMID: 28717309      PMCID: PMC5499074          DOI: 10.14202/vetworld.2017.598-604

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

In food animal production, antibiotics are used extensively and are often applied sub-therapeutically for growth promotion and disease prevention in India. This has resulted in the rise of antibiotic-resistant Staphylococcus aureus in food animals and foods of animal origin. S. aureus resistance to oxacillin carrying the mecA gene, now known as methicillin-resistant S. aureus (MRSA), was first reported in the year 1961 and since then reported in hospitals, food, animals, community and the environment [1]. Recently, MRSA strains, consistent with the main livestock-associated (LA)-MRSA type have caused outbreaks in healthcare settings thereby raising the concern. In addition, a new variant of methicillin resistance determinant (mecC) has been described in specific LA-MRSA lineages that are primarily associated with swine, cows, and sheep but again display a broad host range [2]. Sustained efforts are therefore required to analyze antibiotic resistance (AR) patterns of S. aureus strains isolated from different origins, including livestock due to their changing patterns of resistance and its potential to serve as a reservoir of AR genes and MRSA. AR of S. aureus nasal carriage isolates from bovine and swine has not been pursued aggressively, especially in Punjab. Therefore, the aim of this study was to figure the prevalence, phenotypic and genotypic AR pattern of S. aureus isolated from bovine and swine nares.

Materials and Methods

Ethical approvals

The study was conducted under the supervision of institutional ethical committee.

Sampling

Nasal swabs of 47 apparently healthy bovines and 28 apparently healthy swine were obtained from the Teaching Veterinary Hospital and the pig farm of Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana, Punjab, respectively, during February to April 2014.

Isolation and identification of S. aureus

Isolation of S. aureus from swab samples was performed as per the bacteriological analytical manual [3]. Colonies with typical morphology on Baird-Parker agar supplemented with egg-yolk tellurite emulsion were selected and subjected to Gram-staining and catalase test. Gram and catalase positive isolates were biochemically identified as S. aureus using the HiStaph™ Identification Kit (HiMedia Labs, Mumbai). These isolates were further subjected to coagulase test using rabbit plasma (HiMedia Lab, Mumbai) following manufacturer’s instructions. The S. aureus isolates were purified and maintained in 20% (v/v) glycerol at −20°C till further processing.

Antibiotic susceptibility testing (AST) of selected S. aureus strains

The AST of S. aureus strains was performed by the Epsilometer test. All the selected S. aureus strains were tested for their sensitivity to various antibiotics, viz., oxacillin, penicillin, tetracycline, chloramphenicol, cotrimazole, ceftriaxone, gentamicin, erythromycin, ciprofloxacin, and vancomycin using Ezy MIC™ strip (HiMedia Lab, Mumbai). AST for amoxicillin/clavulanic acid and double- disk diffusion testing (D-test) was performed by the standard disc diffusion method following CLSI guidelines [4].

Identification of antibiotic resistant genes

S. aureus strains were tested for the presence of following AR genes: blaZ, mecA, aacA-aphD, erm (ermA, ermB, ermC), tet (efflux genes tetK and tetL, tetM and tetO of the ribosomal protection family) and vanA, encoding for penicillin, oxacillin, gentamicin, erythromycin, tetracycline and vancomycin resistance, respectively, by amplification of the existing gene using multiplex polymerase chain reaction (PCR). Primers for the respective genes are listed in Table-1 [5-10].
Table-1

Primers used for detection of antibiotic resistant genes in S. aureus.

GeneOligonucleotide sequence (5`-3`)Amplicon sizeReferences
aacA-aphDTAA TCC AAG AGC AAT AAG GGC GCC ACA CTA TCA TAA CCA CTA227[5]
ermAAAG CGG TAA ACC CCT CTG A TTC GCA AAT CCC TTC TCA AC190[5]
ermBCTATCTGATTGTTGAAGAAGGATT GTTTACTCTTGGTTTAGGATGAAA142[6]
ermCAAT CGT CAA TTC CTG CAT GT TAA TCG TGG AAT ACG GGT TTG299[5]
tetKGTA GCG ACA ATA GGT AAT AGT GTA GTG ACA ATA AAC CTC CTA360[5]
tetMAGT GGA GCG ATT ACA GAA CAT ATG TCC TGG CGT GTC TA158[5]
tetLGTCGTTGCGCGCTATATTCC GTGAACGGTAGCCCACCTAA696[7]
tetOAATGAAGATTCCGACAATTT CTCATGCGTTGTAGTATTCCA781[7]
mecAAAA ATC GAT GGT AAA GGT TGG C AGT TCT GCA GTA CCG GAT TTG C532[5]
blaZACT TCA ACA CCT GCT GCT TTC TGA CCA CTT TTA TCA GCA ACC173[6]
vanAATGAATAGAATAAAAGTTGC TCACCCCTTTAACGCTAATA1032[8]
16SrDNA (Staphylococcus genus specific)CAG CTC GTG TCG TGA GAT GT AAT CAT TTG TCC CAC CTT CG420[5]
CoaATA GAG ATG CTG GTA CAG G GCT TCC GAT TGT TCG ATG C547 (550-875)[9]
Nuc (Species specific)GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC279[10]

S. aureus=Staphylococcus aureus

Primers used for detection of antibiotic resistant genes in S. aureus. S. aureus=Staphylococcus aureus Antibiotic resistant genes from strains were amplified, purified and sequenced (Invitrogen) for use as a control. Sequence comparisons were performed using the BLAST online program (http://www.ncbi.nlm.- nih.gov/BLAST/), and respective sequences were submitted to NCBI. S. aureus strain ATCC 33591 and ATCC 33592 were used as MRSA (mecA +ve) and MSSA (mecA −ve) positive control, respectively. KU872013, KP834338/KP834339, KP658721, KP658723, KP886833, KT454736, KT454737, S. aureus strains were used as positive control for genes blaZ, aacA-aphD, tetK, tetL, tetM, ermB, ermC, respectively. The isolation of genomic DNA from S. aureus strains was done using HiPurA™ bacterial genomic DNA purification kit (HiMedia Lab, Mumbai). Each strain was subjected to a separate multiplex PCR assays for a detection of each group (gp) of genes: gp1 (16S rDNA-genus specific, nuc-species specific, mecA), gp2 (tetK, tetL, tetM and tetO), gp3 (ermA, ermB, ermC and aacA-aphD), and gp4 (coa and blaZ). Separate PCR was run for vanA and pvl gene. The PCR amplification was carried out in a total reaction volume of 25 µl containing 0.4 mM deoxynucleotide triphosphates, 4 mM MgCl2 (Promega, USA), 10 pmol/µl of each primer set containing forward and reverse primers, 1 U Taq DNA polymerase (Promega, USA), 0.01-0.2 µg template and sterilized nuclease free water was added to make up the reaction volume of 25 µl. The cycling conditions of multiplex PCR for gp1, gp2, and gp3 and of single PCR for vanA gene were as per methodology of Strommenger et al. [5] (with little modifications) and Saha et al. [8], respectively. However, cycling condition for coa and blaZ (gp 4) included an initial denaturation of DNA at 94°C for 45 s, followed by 30 cycles of denaturation at 94°C 20 s, annealing at 55°C for 15 s and extension at 70°C for 15 s, followed by a final extension of 2 min at 72°C and hold at 4°C. The cycling condition for pvl includes 94°C for 1 min, 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min followed by a final extension at 72°C for 5 min. All the PCR amplicons were visualized using an ultraviolet light box after electrophoresis on a 1.5% agarose gel containing 0.5 µg/ml ethidium bromide.

Statistical analysis

Microsoft excel was used for statistical analysis. The variables were compared using a Chi-squared or Fisher’s exact test, as appropriate. Differences were considered significant when the p<0.05. Dendrogram based on antibiogram was composed using the unweighted paired group method with Bionumeric software V07.

Results

The nasal cavities of 17 out of 47 randomly selected bovine and 20 out of 28 randomly selected swine were positive for S. aureus, representing the prevalence of 36.2% (95% confidence interval [CI]: 22.5-49.9) and 71.4% (95% CI: 54.7-88.1), respectively. Furthermore, all the S. aureus strains were coagulase positive except one swine nasal swab (1S1). One strain from each sample was screened against antibiotics that are of clinical importance and percentage of strains classified as susceptible, intermediate or resistant were used to summarize resistance percentage overall and disaggregated by species type (Figure-1).
Figure-1

Percentage of Staphylococcus aureus strains resistant to different antibiotics.

Percentage of Staphylococcus aureus strains resistant to different antibiotics.

Phenotypic resistance profile

Most of the S. aureus strains showed higher resistance to penicillin (94.6%, MIC ≥1.5 µg/ml) followed by ciprofloxacin (56.7%, MIC ≥32 µg/ml) and tetracycline (18.9%, MIC ≥32 µg/ml). About 10-15% of the strains were resistant to gentamicin (MIC 16 µg/ml) and oxacillin (MIC 6-8 µg/ml). However, 21.6% of S. aureus strains showed intermediate resistance to chloramphenicol (MIC 16 µg/ml). Similarly, for erythromycin and ceftriaxone, most of the strains were intermediate resistant with MIC 1-3 µg/ml, 54.05% and MIC 16-32 µg/ml, 21.6%, respectively. Vancomycin MIC values for S. aureus strains were in the susceptible range (0.25-1.5 µg/ml). Around 16 unique resistance profiles (taking five antibiotics as cutoff value) were found (Figure-2).
Figure-2

Dendrogram based on minimal inhibitory concentration antibiogram of 37 Staphylococcus aureus strains. The dendrogram was obtained using the unweighted paired group method with bionumeric software V07. The color indicates the susceptibility gradient with Dark-resistant, gray-intermediate resistant and white or light gray-susceptible. The top left horizontal scale indicates the number of antibiotics 1-11.

Dendrogram based on minimal inhibitory concentration antibiogram of 37 Staphylococcus aureus strains. The dendrogram was obtained using the unweighted paired group method with bionumeric software V07. The color indicates the susceptibility gradient with Dark-resistant, gray-intermediate resistant and white or light gray-susceptible. The top left horizontal scale indicates the number of antibiotics 1-11. In this study, 32.4% strains were resistant to three or more than three antibiotics, and they were designated as multidrug resistance (MDR). The prevalence of MDR S. aureus was 45% (95% CI: 26.6-63.4) and 17.6% (95% CI: 6.7-28.5) in swine and bovine nasal samples, respectively.

Relationship between AR phenotype and genotype

Penicillin

One S. aureus strain (Bu35) was negative for blaZ gene, but resistant to penicillin with MIC 3 µg/ml and was intermediately resistant to chloramphenicol (Figure-2 and Table-2).
Table-2

Correlation between the phenotypic and genotypic AR to penicillin, oxacillin and gentamicin in S. aureus.

GeneNumber of strainsNumber of strains tested by E strip (MIC µg/ml)

SensitiveIntermediateResistant
blaZPenicillin MIC≤0.12Penicillin MIC 0.12-0.25Penicillin MIC≥0.25
 Positive340034
Negative321
mecAOxacillin MIC≤2Oxacillin MIC 2-4Oxacillin MIC≥4
 Positive0000
 Negative373304
aacA-aphDGentamicin MIC≤4Gentamicin MIC 8Gentamicin MIC≥16
 Positive151005
 Negative222200

S. aureus=Staphylococcus aureus, MIC=Minimal inhibitory concentration, AR=Antibiotic resistance

Correlation between the phenotypic and genotypic AR to penicillin, oxacillin and gentamicin in S. aureus. S. aureus=Staphylococcus aureus, MIC=Minimal inhibitory concentration, AR=Antibiotic resistance

Oxacillin

All S. aureus strains were mecA negative. However, four S. aureus strains that were phenotypically resistant to oxacillin but genotypically mecA negative showed borderline resistance with MIC ranges from 6 to 8 µg/ml (Table-2). Out of these four S. aureus strains, S7 and S14 were β-lactamases hyperproducers (Table-3).
Table-3

Characteristics of isolates resistant to oxacillin but negative for the mecA gene by PCR.

SourceStrainsOxacillin MIC (µg/ml)Ceftriaxone MIC (µg/ml)Amoxyclave inhibition zone* (mm)blaZ (PCR detection)β-lactamase hyper producers
Swine nasal swabS361614+-
Swine nasal swabS483215+-
Swine nasal swabS76640++
Swine nasal swabS146835++

The diameter of the inhibition zone with amoxyclave (amoxicillin-clavulanic acid: 20 and 10 µg, respectively) if exceeded 20 mm then strains were considered β-lactamases hyperproducers. Ceftriaxone MIC≤8 µg/ml - susceptible, MIC=1632 µg/ml-intermediate resistant and MIC≥64 µg/ml. MIC=Minimal inhibitory concentration, PCR=Polymerase chain reaction

Characteristics of isolates resistant to oxacillin but negative for the mecA gene by PCR. The diameter of the inhibition zone with amoxyclave (amoxicillin-clavulanic acid: 20 and 10 µg, respectively) if exceeded 20 mm then strains were considered β-lactamases hyperproducers. Ceftriaxone MIC≤8 µg/ml - susceptible, MIC=1632 µg/ml-intermediate resistant and MIC≥64 µg/ml. MIC=Minimal inhibitory concentration, PCR=Polymerase chain reaction

Tetracycline

The majority of the S. aureus strains in this study either carried tetK or tetL whereas one strain contained both tetK and tetM gene (Table-4). tetL was found only among swine nasal S. aureus strains, whereas tetK was common among bovine nasal S. aureus strains. This is agreeing with Kadlec et al. [11] and Ugwu et al. [12]. Furthermore, among S. aureus strains that were carrying the gene, 63.6% showed resistance to tetracycline with higher MIC values (32->256 µg/ml).
Table-4

Correlation between the phenotypic and genotypic AR to tetracycline in S. aureus.

tet presenceNumber of strains tested by E strip (MIC µg/ml)

tetKtetLtetMSensitive (≤4)Intermediate (8)Resistant (≥16)
Positive561*407
Negative26260

1 samples (Co31) possess both tetK and tetM. MIC=Minimal inhibitory concentration, AR=Antibiotic resistance, S. aureus=Staphylococcus aureus

Correlation between the phenotypic and genotypic AR to tetracycline in S. aureus. 1 samples (Co31) possess both tetK and tetM. MIC=Minimal inhibitory concentration, AR=Antibiotic resistance, S. aureus=Staphylococcus aureus

Erythromycin

Most of S. aureus strains were genotypically negative but phenotypically intermediate resistant with MIC 1-3 µg/ml (Table-5). In this study, all strains considered resistant or intermediate to erythromycin in vitro tested for inducible clindamycin resistance (D-test). None of the strains showed inducible macrolide, lincosamides, and streptogramins Type B (MLSB) phenotype (Ery+/Cli−, D+), but one strain (7S) showed a constitutive MLSB phenotype (Erm+/Cli+, D−) and positive for ermB gene.
Table-5

Relationship between the phenotypic and genotypic AR to erythromycin S. aureus.

erm presenceNumber of strains tested by E strip (MIC µg/ml)

ermBermA/ermCSensitive (≤0.5)Intermediate (1-4)Resistant (≥8)
Positive50041
Negative3216160

MIC=Minimal inhibitory concentration, AR=Antibiotic resistance, S. aureus=Staphylococcus aureus

Relationship between the phenotypic and genotypic AR to erythromycin S. aureus. MIC=Minimal inhibitory concentration, AR=Antibiotic resistance, S. aureus=Staphylococcus aureus

Gentamicin

All S. aureus strains resistant to gentamicin with MIC ≥16 µg/ml showed the presence of aacA-aphD gene, and that constitutes only 33.3% of total strains positive for this gene (Table-2).

Discussion

Penicillin, ciprofloxacin, and tetracycline are highly used in veterinary medicine and as feed additive in India [13]. This may be a reason for the increase in resistance to these antibiotics. Though low, but intermediate resistance to ceftriaxone is also a concern because ceftriaxone (third generation of cephalosporin) used to treat animals and humans especially children [14]. These results corroborate similar studies in pig, cattle and clinical isolates [15,16] and obtain in other countries [17,18] which reflects the predominant use of these drugs in pig and dairy cattle husbandry worldwide. There was no significant difference between the percentage of AR among the bovine and swine nasal S. aureus strains (Fisher’s exact test; p=0.478), but higher prevalence of MDR S. aureus was observed in swine as compared to bovine. Thereby, our data show that bovine and swine nares are often contaminated with MDR S. aureus, which is the public health concern because direct contact with livestock colonized with resistant bacteria is the most documented routes of resistance transmission from the animals into human populations [19]. There was a statistically significant relationship (p<0.05) between phenotypes and genotype resistance pattern in S. aureus strains subjected to the antibiotic penicillin, tetracycline, gentamicin, and erythromycin. However, not all the penicillin-resistant S. aureus strains exhibited genotypic resistance to penicillin (Table-2), corresponding well with the findings of the previous studies [20,21]. This may be because the phenotypic resistance has been caused by point mutations, biofilm formation or antibiotic tolerance [22]. Thereby, our results suggest that blaZ may play a major role but cannot be used alone as an indicator for penicillin resistance. Borderline oxacillin-resistant S. aureus (BORSA) has been another relatively frequently observed phenotype among S. aureus strains. These strains are cefoxitin/ceftriaxone susceptible and do not carry the mecA or mecC genes, but are shown oxacillin resistance MIC between 1 and 8 µg/ml [23]. In this study, All S. aureus strains were negative for mecA gene and four of those strains were BORSA. Such pattern may be because of hyperproduction of β-lactamases, production of normal penicillin-binding protein 2 with altered binding capacity or variant of mecA gene (mecC) [24]. To exclude the possibility of hyperproduction of β-lactamase, amoxyclave antibiotic disk diffusion test was performed [6]. Two of those strains were found β-lactamases hyperproducers and other two were not (Table-3). Martineau et al. [6] also reported exist of isolates that were phenotypically oxacillin resistant but negative for mecA gene. Likewise Pereira et al. [25] reported 38% of S. aureus strains phenotypically resistant to oxacillin but only 0.68% of those strains showed the presence of mecA gene. In conclusion, our result showed the prevalence of BORSA that is of public health concern because the incidences of BORSA has been reported among human clinical strains [26] and have also been detected in food of animal origin, cattle and pigs [27]. Farmers and veterinarians harbored tetracycline resistant strains more frequently than people without contact with livestock especially pigs [28]. Our result reported the presence of tetK, tetL and tetM genes in bovine and swine nares and is of public health concern because the tetK and tetM genes are on mobile genetic element, such as small plasmids and conjugative transposons of S. aureus [7] that can spread and cause treatment failure both in veterinary and human medicine. A form of acquired simultaneous resistance to MLSB in clinical isolates is due to evolutionary variants of erm genes [11]. The strains in the current study only had ermB gene. This is in accordance with the study that too reported ermB gene in animal strains [6]. Most of the strains were intermediate resistant to erythromycin but erm gene negative. This intermediate resistance to erythromycin can be possibly associated with mechanism not yet characterized in staphylococcus or may be due to another gene such as msrA and mphC––corroborating with past research [6,12]. In this study, most of the strains were aacA-aphD positive but phenotypically sensitive to gentamicin (Table-2). This is the issue of concern from a clinical prospective as the susceptible strains harboring but not expressing an AR gene is considered as potentially resistant to that antibiotic because there are the experiments that strongly suggest that susceptible strains harboring a resistance gene have the potential to develop resistance on in vivo selection of the appropriate antimicrobial agent [6]. None of the strain was pvl positive.

Conclusion

Hitherto there is no direct evidence that the food can contribute to the community-associated-MRSA but the direct contact with colonized animals, especially swine contact now appears to be a significant risk factor for colonization with MDR S. aureus and MRSA (LA-MRSA), thereby explains the relevance of this type of studies. To our knowledge, this is the first short study in the Punjab examines the prevalence and characteristics of MDR S. aureus and screening for MRSA in bovine and swine nares. Of particular concern in this study was the small sample size, but clearly, shows the requirement of further study at the farm and retail levels involving large sample size over time at different location to better assess the presence of MDR S. aureus and MRSA in livestock and the risk to livestock handlers and consumers. Although all strains were susceptible to vancomycin and negative for mecA and pvl gene, the S. aureus strains have demonstrated resistance to more than two antibiotics. Our result showed the prevalence of BORSA that is of public health concern because the incidences of BORSA have been reported in hospitals. We also observed that most strains presented the genes of resistance, although these were not being expressed, yet demonstrating the future potential for these strains to become resistant to the evaluated antimicrobial agents.

Authors’ Contributions

The study was designed by RS and JPSG. Laboratory work was done by AS. SK and AS prepared manuscript while as RS and AS analyzed data. All authors read and approved the final manuscript.
  23 in total

Review 1.  Staphylococcal cassette chromosome mec: recent advances and new insights.

Authors:  Anna C Shore; David C Coleman
Journal:  Int J Med Microbiol       Date:  2013-03-14       Impact factor: 3.473

2.  An outbreak of borderline oxacillin-resistant Staphylococcus aureus (BORSA) in a dermatological unit.

Authors:  Ulla Balslev; Annie Bremmelgaard; Else Svejgaard; Jeannette Havstreym; Henrik Westh
Journal:  Microb Drug Resist       Date:  2005       Impact factor: 3.431

3.  Genetic characterization of antimicrobial resistance in coagulase-negative staphylococci from bovine mastitis milk.

Authors:  Yvonne Frey; Joan Peña Rodriguez; Andreas Thomann; Sybille Schwendener; Vincent Perreten
Journal:  J Dairy Sci       Date:  2013-02-15       Impact factor: 4.034

Review 4.  Novel and uncommon antimicrobial resistance genes in livestock-associated methicillin-resistant Staphylococcus aureus.

Authors:  K Kadlec; A T Fessler; T Hauschild; S Schwarz
Journal:  Clin Microbiol Infect       Date:  2012-04-17       Impact factor: 8.067

5.  Molecular typing of Staphylococcus aureus based on PCR restriction fragment length polymorphism and DNA sequence analysis of the coagulase gene.

Authors:  J V Hookey; J F Richardson; B D Cookson
Journal:  J Clin Microbiol       Date:  1998-04       Impact factor: 5.948

6.  Identification and characterization of a vancomycin-resistant Staphylococcus aureus isolated from Kolkata (South Asia).

Authors:  Biswajit Saha; Anil K Singh; Abhrajyoti Ghosh; Manjusri Bal
Journal:  J Med Microbiol       Date:  2008-01       Impact factor: 2.472

7.  Characterization for enterotoxin production, virulence factors, and antibiotic susceptibility of Staphylococcus aureus isolates from various foods in Portugal.

Authors:  V Pereira; C Lopes; A Castro; J Silva; P Gibbs; P Teixeira
Journal:  Food Microbiol       Date:  2009-01-07       Impact factor: 5.516

8.  High prevalence of methicillin resistant Staphylococcus aureus in pigs.

Authors:  A J de Neeling; M J M van den Broek; E C Spalburg; M G van Santen-Verheuvel; W D C Dam-Deisz; H C Boshuizen; A W van de Giessen; E van Duijkeren; X W Huijsdens
Journal:  Vet Microbiol       Date:  2007-02-06       Impact factor: 3.293

9.  Descriptive analysis of antibiotic-resistant patterns of methicillin-resistant Staphylococcus aureus (MRSA) st398 isolated from healthy swine.

Authors:  Ana Morcillo; Beatriz Castro; Cristobalina Rodríguez-Alvarez; Rossana Abreu; Armando Aguirre-Jaime; Angeles Arias
Journal:  Int J Environ Res Public Health       Date:  2015-01-12       Impact factor: 3.390

10.  Antibiotic resistance genes & susceptibility patterns in staphylococci.

Authors:  Nizami Duran; Burcin Ozer; Gulay Gulbol Duran; Yusuf Onlen; Cemil Demir
Journal:  Indian J Med Res       Date:  2012-03       Impact factor: 2.375

View more
  7 in total

1.  Detection, molecular characterization, and antibiogram of multi-drug resistant and methicillin-resistant Staphylococcus aureus (MRSA) isolated from pets and pet owners in Malaysia.

Authors:  M H Chai; M Z Sukiman; Y W Liew; M S Shapawi; F S Roslan; S N Hashim; N M Mohamad; S M Z Ariffin; M F Ghazali
Journal:  Iran J Vet Res       Date:  2021       Impact factor: 1.376

2.  Recognition of (Sesc) for Easy Identification of Staphylococcus Epidermidis and Molecular and Phenotypic Study of Β-Lactam Resistance in Staphylococcus Epidermidis Isolates in Isfahan.

Authors:  Parisa Behshood; Elahe Tajbakhsh; Hassan Momtaz
Journal:  Rep Biochem Mol Biol       Date:  2020-10

3.  Genotypic and Phenotypic Evaluation of Biofilm Production and Antimicrobial Resistance in Staphylococcus aureus Isolated from Milk, North West Province, South Africa.

Authors:  Marie Ebob Agbortabot Bissong; Collins Njie Ateba
Journal:  Antibiotics (Basel)       Date:  2020-04-02

4.  Phenotypic and molecular characteristics of methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolated from pigs: implication for livestock-association markers and vaccine strategies.

Authors:  Dan Guo; Yangqun Liu; Changlin Han; Zhiyao Chen; Xiaohua Ye
Journal:  Infect Drug Resist       Date:  2018-08-23       Impact factor: 4.003

Review 5.  Understanding policy dilemmas around antibiotic use in food animals & offering potential solutions.

Authors:  Kamini Walia; Monica Sharma; Sonam Vijay; Bibek R Shome
Journal:  Indian J Med Res       Date:  2019-02       Impact factor: 2.375

6.  Nocturnal Birds of Prey as Carriers of Staphylococcus aureus and Other Staphylococci: Diversity, Antimicrobial Resistance and Clonal Lineages.

Authors:  Vanessa Silva; Ana Filipa Lopes; Vanessa Soeiro; Manuela Caniça; Vera Manageiro; José Eduardo Pereira; Luís Maltez; José Luis Capelo; Gilberto Igrejas; Patrícia Poeta
Journal:  Antibiotics (Basel)       Date:  2022-02-12

7.  Staphylococcus aureus in Intensive Pig Production in South Africa: Antibiotic Resistance, Virulence Determinants, and Clonality.

Authors:  Ncomeka Sineke; Jonathan Asante; Daniel Gyamfi Amoako; Akebe Luther King Abia; Keith Perrett; Linda A Bester; Sabiha Y Essack
Journal:  Pathogens       Date:  2021-03-08
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.