| Literature DB >> 28717309 |
Asima Zehra1, Randhir Singh1, Simranpreet Kaur1, J P S Gill1.
Abstract
AIM: The aim of this study was to figure the prevalence, phenotypic and genotypic antibiotic resistance (AR) pattern of Staphylococcus aureus isolated from bovine and swine nares.Entities:
Keywords: Staphylococcus aureus; antibiotic resistance genes; epsilometer test; livestock nasal swabs; multidrug resistance
Year: 2017 PMID: 28717309 PMCID: PMC5499074 DOI: 10.14202/vetworld.2017.598-604
Source DB: PubMed Journal: Vet World ISSN: 0972-8988
Primers used for detection of antibiotic resistant genes in S. aureus.
| Gene | Oligonucleotide sequence (5`-3`) | Amplicon size | References |
|---|---|---|---|
| TAA TCC AAG AGC AAT AAG GGC | 227 | [ | |
| AAG CGG TAA ACC CCT CTG A | 190 | [ | |
| CTATCTGATTGTTGAAGAAGGATT | 142 | [ | |
| AAT CGT CAA TTC CTG CAT GT | 299 | [ | |
| GTA GCG ACA ATA GGT AAT AGT | 360 | [ | |
| AGT GGA GCG ATT ACA GAA | 158 | [ | |
| GTCGTTGCGCGCTATATTCC | 696 | [ | |
| AATGAAGATTCCGACAATTT | 781 | [ | |
| AAA ATC GAT GGT AAA GGT TGG C | 532 | [ | |
| ACT TCA ACA CCT GCT GCT TTC | 173 | [ | |
| ATGAATAGAATAAAAGTTGC | 1032 | [ | |
| CAG CTC GTG TCG TGA GAT GT | 420 | [ | |
| ATA GAG ATG CTG GTA CAG G | 547 (550-875) | [ | |
| GCGATTGATGGTGATACGGTT | 279 | [ |
S. aureus=Staphylococcus aureus
Figure-1Percentage of Staphylococcus aureus strains resistant to different antibiotics.
Figure-2Dendrogram based on minimal inhibitory concentration antibiogram of 37 Staphylococcus aureus strains. The dendrogram was obtained using the unweighted paired group method with bionumeric software V07. The color indicates the susceptibility gradient with Dark-resistant, gray-intermediate resistant and white or light gray-susceptible. The top left horizontal scale indicates the number of antibiotics 1-11.
Correlation between the phenotypic and genotypic AR to penicillin, oxacillin and gentamicin in S. aureus.
| Gene | Number of strains | Number of strains tested by E strip (MIC µg/ml) | ||
|---|---|---|---|---|
| Sensitive | Intermediate | Resistant | ||
| Penicillin MIC≤0.12 | Penicillin MIC 0.12-0.25 | Penicillin MIC≥0.25 | ||
| Positive | 34 | 0 | 0 | 34 |
| Negative | 3 | 2 | 1 | |
| Oxacillin MIC≤2 | Oxacillin MIC 2-4 | Oxacillin MIC≥4 | ||
| Positive | 0 | 0 | 0 | 0 |
| Negative | 37 | 33 | 0 | 4 |
| Gentamicin MIC≤4 | Gentamicin MIC 8 | Gentamicin MIC≥16 | ||
| Positive | 15 | 10 | 0 | 5 |
| Negative | 22 | 22 | 0 | 0 |
S. aureus=Staphylococcus aureus, MIC=Minimal inhibitory concentration, AR=Antibiotic resistance
Characteristics of isolates resistant to oxacillin but negative for the mecA gene by PCR.
| Source | Strains | Oxacillin MIC (µg/ml) | Ceftriaxone MIC (µg/ml) | Amoxyclave inhibition zone* (mm) | β-lactamase hyper producers | |
|---|---|---|---|---|---|---|
| Swine nasal swab | S3 | 6 | 16 | 14 | + | - |
| Swine nasal swab | S4 | 8 | 32 | 15 | + | - |
| Swine nasal swab | S7 | 6 | 6 | 40 | + | + |
| Swine nasal swab | S14 | 6 | 8 | 35 | + | + |
The diameter of the inhibition zone with amoxyclave (amoxicillin-clavulanic acid: 20 and 10 µg, respectively) if exceeded 20 mm then strains were considered β-lactamases hyperproducers. Ceftriaxone MIC≤8 µg/ml - susceptible, MIC=1632 µg/ml-intermediate resistant and MIC≥64 µg/ml. MIC=Minimal inhibitory concentration, PCR=Polymerase chain reaction
Correlation between the phenotypic and genotypic AR to tetracycline in S. aureus.
| Number of strains tested by E strip (MIC µg/ml) | ||||||
|---|---|---|---|---|---|---|
| Sensitive (≤4) | Intermediate (8) | Resistant (≥16) | ||||
| Positive | 5 | 6 | 1 | 4 | 0 | 7 |
| Negative | 26 | 26 | 0 | |||
1 samples (Co31) possess both tetK and tetM. MIC=Minimal inhibitory concentration, AR=Antibiotic resistance, S. aureus=Staphylococcus aureus
Relationship between the phenotypic and genotypic AR to erythromycin S. aureus.
| Number of strains tested by E strip (MIC µg/ml) | |||||
|---|---|---|---|---|---|
| Sensitive (≤0.5) | Intermediate (1-4) | Resistant (≥8) | |||
| Positive | 5 | 0 | 0 | 4 | 1 |
| Negative | 32 | 16 | 16 | 0 | |
MIC=Minimal inhibitory concentration, AR=Antibiotic resistance, S. aureus=Staphylococcus aureus