Literature DB >> 28715430

Resequencing and variation identification of whole genome of the japonica rice variety "Longdao24" with high yield.

Shukun Jiang1, Shichen Sun1, Liangming Bai1, Guohua Ding1, Tongtong Wang1, Tianshu Xia1, Hui Jiang1, Xijuan Zhang1, Fengming Zhang1.   

Abstract

Japonica rice mainly distributes in north of China, which accounts for more than half of the total japonica rice cultivated area of China. High yield, good grain quality and early heading date were the main breeding traits and commercial property in this region. We performed re-sequencing and genome wide variation analysis of one typical northern japonica rice variety Longdao24 and its parents (Longdao5 and Jigeng83) using the Illumina sequencing technology. 53.17 G clean bases were generated and more than 96.8% of the reads were mapped to the genomic reference sequence. An overall average effective depth of 43.67 × coverage was achieved. We identified 420,475 SNPs, 95,624 InDels, and 14,112 SVs in Longdao24 genome with the genomic sequence of the japonica cultivar Nipponbare as reference. We identified 361,117 SNPs and 81,488 InDels between Longdao24 genome and Longdao5 genome. We also detected 428,908 SNPs and 97,209 InDels between Longdao24 genome and Jigeng83 genome. Twenty-two yield related genes, twenty-two grain quality related genes and thirty-nine heading date genes were analyzed in Longdao24. The alleles of Gn1a, EP3, SCM2, Wx, ALK, OsLF and Hd17 came from the female parent Longdao5. The other alleles of qGW8, SSIVa, SBE3, SSIIIb, SSIIc, DTH2, Ehd3 and OsMADS56 came from the male parent Jigeng83. These results will help us to research the genetics basis of yield, grain quality and early heading date in northern rice of China.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28715430      PMCID: PMC5513431          DOI: 10.1371/journal.pone.0181037

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Given continuing population growth and increasing competition for arable land between food and energy crops, the next century may witness serious global food shortage problems. Thus, there is a need for an increase in rice yield, because rice is the world’s most important staple food crop. To substantially increase rice yield, Japan initiated a super high-yielding rice breeding program in 1981 that was targeted to raise rice yield 50% within 15 years. However, this target has not yet been realized [1, 2]. Next, the International Rice Research Institute (IRRI) launched a new plant-type breeding program to develop super rice in 1989, with the target of developing a super rice. However, this target was not reached either [1-3]. In order to meet the food demand required by the Chinese people in the 21st century, a program to breed super rice through combining morphological improvement and the utilization of inter-subspecific heterosis was set up by the Ministry of Agriculture and the Ministry of Science and Technology in 1996 and 1997, respectively [1, 2, 4]. Today, nearly 80 super rice varieties have been released and some of them show high grain yields of 12–21 t/hm2 in field experiments [4]. The core of super rice breeding is an effective use of germ plasma resources and favorable genes. For example, most of the northern japonica super rice varieties have DEP1 gene, which controlled large erect panicle [5, 6]. Although a large progress about the genetic basis for yield, grain quality and heading date of super rice had achieved [5-7], but the molecular mechanism is still poorly understood. To meet the global food demands, achievements in molecular genetics of complex traits in rice will be important for increasing yield in the post-genomics era [8]. The draft genomic sequences of two rice subspecies, japonica (Nipponbare) and indica (93–11), were released [9, 10]; and later, the final genome sequence of Nipponbare was completed by International Rice Genome Sequencing Project [11]. These achievements provided a high quality reference genome for re-sequencing rice genomes using high-throughput sequencing technologies [12]. The widely used high-throughput sequencing technologies are also known as next-generation sequencing (NGS) technology. The NGS technology has been widely used in rice genomics and molecular breeding studies [13]. These characteristics have enabled researchers to perform accurate genetic polymorphism analysis and discovered important cloned genes of rice variety [14]. Several super rice or its parents including Liangyoupei 9 [15], Shanyou 63 [16] and Shennong 265 [17] has been re-sequenced. However the Heilongjiang super rice varieties such as Longdao 5, Songgeng 9, Longgeng 31 and so on still not be researched. In this study, we re-sequenced a new bred elite japonica rice variety, Longdao24, with high quality, super high yield and early heading date in Heilongjiang province. Our results provided several candidates account for the super high yield, good quality and early heading date of rice in Heilongjaing province. The results therefore lay the groundwork for long-term efforts to uncover important genes and for future variety improvement.

Materials and methods

Plant materials

Longdao24 (Fig 1) was selected from the cross between two super japonica rice Longdao5 and Jigeng83. Longdao5 is a leading cultivar widely cultivated in the south and east part of Heilongjiang province and has high resistance to disease and super high yield. Jigeng83 is a leading cultivar widely cultivated in the middle part of Jilin province and has super high yield.
Fig 1

The field performances of Longdao24.

DNA isolation and genome sequencing

Genomic DNA was prepared from bulk harvested leaves of a single young plant of Longdao24, Longdao5 and Jigeng83 using a modified CTAB method [18]. Whole genome re-sequencing of the grape lines was performed on an Illumina HiSeq4000™ by Biomarker Technologies (Beijing, China). The procedure was performed as the standard Illumina protocol, including sample preparation and sequencing as follows: quantified DNA was extracted and DNA fragments were obtained using the ultrasonic wave technique, which was purified using the QIA quick PCR kit. End repair was performed with poly-A on the 3´ ends, then the adaptors were ligated, clusters were generated, agarose gel electrophoresis was used to select fragments, and PCR amplification was performed. Sequencing was performed by establishing a library with Illumina HiSeq4000™. The short reads were aligned using the Burrows–Wheeler transformation [19]. To ensure high quality, Low-quality reads (<20), reads with adaptor sequence and duplicated reads were filtered, and the remaining high-quality data were used in the mapping.

Mapping of reads to the reference

The clean sequencing reads were aligned to the temperate japonica Nipponbare reference genome—the unified-build release Os-Nipponbare-Reference-IRGSP-1.0 [20], using the BWA software under the default parameters with a small modification. The alignment results were then merged and indexed as BAM files [21]. Average sequencing depth and coverage were calculated using the alignment results. The mapped reads were then used to detect SNPs, InDels and SVs polymorphisms.

Detection of SNPs, InDels and SVs polymorphisms

Firstly, we used GATK tools software [22] to detect SNPs and InDels. Secondly, SVs were detected using BreakdancerMax.pl software [23] with its default parameters. In our result, the types of SVs include insertion (INS), deletion (DEL), inter chromosomal translocation (CTX), deletion including insertion (IDE), intra chromosomal translocation (ITX) and inversion (INV). And in our analysis, InDels were defined as the insertion or deletion the length of which was from 1 to 10 bp.

Annotation of SNPs, InDels and SVs

The annotation of SNPs and Indels were performed by SnpEff software [24]. The localization of SNPs, InDels and SVs were based on the annotation of reference genome databases. The polymorphisms in the gene region and other genome regions were annotated as genic and intergenic. The SNPs, InDels and SVs were classified according to their localization. SNPs in the CDS were further separated into synonymous and non-synonymous. The functional annotation data were achieved by blast each gene including non-synonymous SNPs or SVs to NR [25], SwissProt [25], GO [26], COG [27] and KEGG [28] database.

Results

Genome sequencing of Longdao24 and its parents

Genome sequencing of Longdao24, Longdao5 and Jigeng83 yielded 64.19, 53.93 and 70.60 million reads, most of them being 300 bp paired end reads. After cleaning, 19.17 G (Longdao24), 16.07 G (Longdao5) and 21.11 G (Jigeng83) clean bases were generated and 96.80%, 99.27% and 98.99% of the reads were mapped to the genomic reference sequence. The overall effective depth coverage of Longdao24, Longdao5 and Jigeng83 was 47 ×, 32 × and 52 ×, respectively. The 1 ×, 5 × and 10 × coverage ratio of Longdao24 to the reference genome was 97.87%, 96.11% and 95.08%, respectively. The 1 ×, 5 × and 10 × coverage ratio of Longdao5 to the reference genome was 97.21%, 95.44% and 93.19%, respectively. The 1 ×, 5 × and 10 × coverage ratio of Jigeng83 to the reference genome was 98.40%, 97.32% and 96.63%, respectively. The state information of Longdao24 and its parent were showed in Table 1.
Table 1

The re-sequencing state information of Longdao24 and its parent.

Longdao24Longdao5Jigen83
Raw_Reads641921325392814370604131
Clean_Reads639587315358205870340507
Clean_Base191783664601607000000021108274430
Mapped(%)96.8099.2798.99
Q30(%)94.8690.8294.97
Ave_depth473252
Cov_ratio_1X(%)97.8797.2198.4
Cov_ratio_5X(%)96.1195.4497.32
Cov_ratio_10X(%)95.0893.1996.63

Frequency distributions of different variation

We then examined genome-wide variations. 420,475 SNPs, 95,624 InDels, and 14,112 SVs were yielded from the Longdao24 genome. The frequency distributions of SNPs and InDels on Longdao24 genome were showed in Fig 2 and Fig 3. We detected ten abundant SNPs high region on chr 2(33–35 Mb), chr 4(6.5–12 Mb), chr 5(19-22Mb), chr 6(10-22Mb, 27-31Mb), chr 8(21.5–23 Mb), chr 10(2–6 Mb, 15-16Mb, 17–21 Mb) and chr12 (10–15 Mb). Moreover, the most abundant InDels region were identified on chr 2(33–35 Mb), chr 5(19-22Mb), chr 6(10-22Mb, 27-31Mb), chr 8(21.5–23 Mb) and chr 10(2–6 Mb, 15-16Mb, 17–21 Mb). Several chromosomal loci in the SNP high region were also found covered by the InDel high regions (Figs 2 and 3), which might suggest that those regions were the most polymorphic. 361,117 SNPs and 81,488 InDels were detected between the Longdao24 genome and Longdao5 genome. 428,908 SNPs and 97,209 InDels were identified between the Longdao24 genome and Jigeng83 genome. Frequency distributions of all different variation of Longdao24 genome was showed on Fig 4 via circos software.
Fig 2

The frequencies of SNPs for Longdao24 at a 100 kb sliding window along each chromosome.

Fig 3

The frequencies of Indels for Longdao24 at a 100 kb sliding window along each chromosome.

Fig 4

Summary of different variation between Longdao24 and reference variety Nipponbare.

From the outside to the inside in turn is chromosome location, distribution of SNP density, distribution of InDel density, Copy number variation (CNV), Structure Variation (Insertion (INS), Deletion (DEL), Inversion (INV), Intra-chromosomal Translocation (ITX, red line) and Inter-chromosomal Translocation (CTX, green line)).

Summary of different variation between Longdao24 and reference variety Nipponbare.

From the outside to the inside in turn is chromosome location, distribution of SNP density, distribution of InDel density, Copy number variation (CNV), Structure Variation (Insertion (INS), Deletion (DEL), Inversion (INV), Intra-chromosomal Translocation (ITX, red line) and Inter-chromosomal Translocation (CTX, green line)).

Characteristics of SNPs, InDels and SVs

22,250, 65,858, 137,848 and 107,288 SNPs were found in intergenic region, intron region, upstream region and downstream region respectively. 9,054 SNPs were located in the 5’UTR and 3’UTR region. 1,958 SNPs were detected near the splice site. A total of 76,214 SNPs were located in the CDS regions, among which 31,308 were synonymous coding sequences (Syn CDS) and 42,115 were non-synonymous coding sequences (Nonsyn CDS) (Fig 5A).
Fig 5

Summary of SNPs and Small Indels detected in Longdao24.

5,623, 17,609, 34,717 and 27,132 InDels were found in intergenic region, intron region, upstream region and downstream region respectively. 4,465 InDels were located in the 5’UTR and 3’UTR region. 426 InDels were detected near the splice site. A total of 5,602 InDels were located in the CDS regions, among which 3,401 caused frame shift and 2,092 caused codon change (Fig 5B). A total of 14,112 Structure Variation (SVs) were detected in Longdao24 including 7,795 Insertion (INS), 3,273 Deletion (DEL), 217 Inversion (INV), 317 Intra-chromosomal Translocation (ITX) and 2396 Inter-chromosomal Translocation (CTX). A total of 11,285 SVs were located in the CDS regions, among which 2,969 were detected in exon, 1,697 were located in intron and 6,619 were located in intergenic region. And 2,677 Copy number variation (CNVs) were also detected in Longdao24.

Variation annotation and gene categories

16,831 variations including 10,615 non-synonymous SNP mutations, 3,727 frame shifts and 2,489 SVs caused by indels, transversions, and transitions in 12,772 genes might influence the expression of the relevant protein. All tested and functional annotated genes were classified into gene ontology (GO) categories (Fig 6), which mainly divided the genes into three categories: cellular components (20 groups), molecular function (17 groups), and biological process (17 groups). Classification of gene variations compared with COG database by blast showed that most variations (1,935) were identified in replication, recombination and repair progress. Compared with the reference genome, most variations was screened in genetic information processing and metabolism.
Fig 6

GO classify for differential UniGenes in Longdao24.

Variation analysis on high yield genes

We investigated 22 cloned yield related genes [7] which might explain the high yield of Longdao24. A large number of SNPs and Indels (Table 2) were only detected in the CDS sequence of 4 genes related to high yield among Longdao24, Longdao5 and Jigeng83, such as Gn1a (related to spikelet number), EP3 (related to erect panicle and spikelet number), SCM2 (related to lodging resistance and spikelet number) and qGW8 (related to grain size and grain quality). Four non-synonymous SNPs and a codon insertion InDel were identified in Gn1a locus. Two non-synonymous SNPs and a codon change + deletion InDel were identified in SCM2 locus. Three non-synonymous SNPs and a codon deletion InDel were identified in qGW8 locus. One frame shift InDel were identified in EP3 locus. The allele of Gn1a, DEP3 and SCM2 were come from the female parent Longdao5. The allele of qGW8 were come from the male parent Jigeng83.
Table 2

Variations of 22 high yield related genes in Longdao 24.

GenesRAP NO.MSU NO.Variation typeVariation regionchromosomelocationNipponbareLongdao24Longdao5Jigeng83
Gn1aOs01g0197700LOC_Os01g10110SNP: Non SynonymousExonChr15270928ACCA
SNP: Non SynonymousExonChr15275176TCCT
SNP: Non SynonymousExonChr15275210CAAC
INDEL: Codon InsertionExonChr15275281AACGGCGGACGGCGGA
SNP: Non SynonymousExonChr15275362CGGC
Sd1Os01g0883800LOC_Os01g66100--------
qGY2-1Os02g0154200LOC_Os02g05980--------
GW2Os02g0244100LOC_Os02g14720--------
EP3/LPOs02g0260200LOC_Os02g15950INDEL: Frame ShiftExonChr29042161CCTCTCTCTCCTCTCTCCTCTCTCCTCTCTCT
OsGRF4/GS2/GL2Os02g0701300LOC_Os02g47280--------
GL3.1/qGL3-1/ qGL3/OsPPKL1Os03g0646900LOC_Os03g44500--------
SCM3/OsTB1/FC1Os03g0706500LOC_Os03g49880--------
GIF1/OsCIN2Os04g0413500LOC_Os04g33740--------
SPIKE/LSCHL4/NAL1/GPSOs04g0615000LOC_Os04g52479--------
GS5Os05g0158500LOC_Os05g06660--------
qSW5Os05g0187500LOC_Os05g09520--------
HGWOs06g0160400LOC_Os06g06530--------
TGW6Os06g0623700LOC_Os06g41850--------
GW6a/OsglHAT1Os06g0650300LOC_Os06g44100--------
SCM2/APO1Os06g0665400LOC_Os06g45460INDEL: Codon change + Codon deletionExonChr627480424ACCGCCGCCGAAACCGCCGCCG
SNP: Non SynonymousExonChr627480778GCCG
SNP: Non SynonymousExonChr627481339TCCT
GL7/GW7Os07g0603300LOC_Os07g41200--------
DEP2/EP2/SRS1Os07g0616000LOC_Os07g42410--------
OsSPL14/IPA1/WFPOs08g0509600LOC_Os08g39890--------
qGW8/OsSPL16Os08g0531600LOC_Os08g41940INDEL:critical polymorphism5'UTRChr826501191AAAGCTGAGCTGAAAGCTGAGCTG
SNP: Non SynonymousExonChr826501458CTCT
INDEL: Codon deletionExonChr826501540TGCGTTGCGT
SNP: Non SynonymousExonChr826505387CACA
SNP: Non SynonymousExonChr826505658GTGT
DEP1/EP1/DN1/qPE9-1/qNGR9Os09g0441900LOC_Os09g26999-------
TAWAWA1Os10g0478000LOC_Os10g33780-------

Variation analysis on starch quality genes

We investigated 22 cloned grain quality related genes [29] in Longdao24 (Table 3). A total of fourteen SNPs and one Indels were detected in the CDS sequence of seven grain quality genes among Longdao24, Longdao5 and Jigeng83. Eleven SNPs and one Indels were detected in GBSSII (granule-bound starch synthase II), SSIIIb (Soluble starch synthase IIIb) and SSIIc (Soluble starch synthase IIc) locus between Longdao24 and Nipponbare. The GBSSII in Longdao24 had only one SNP. The SSIIIb and SSIIc of Longdao24 had six SNPs plus one Indel and four SNPs, respectively. The other three SNPs were detected in SSIVa and SBE3 locus among Longdao24, Longdao5 and Jigeng83. The allele of GBSSII locus was same among Longdao24, Longdao5 and Jigeng83, but different from Nipponbare. The other four allele of SSIVa, SBE3, SSIIIb and SSIIc were come from the male parent Jigeng83.
Table 3

Variations of 22 grain quality related genes in Longdao 24.

GenesRAP NO.MSU NO.Variation typeVariation regionVariation chromosomeVariation locationNipponbareLongdao24Longdao5Jigeng83
AGPL2Os01g0633100LOC_Os01g44220--------
SSIVaOs01g0720600LOC_Os01g52250SNP: Non SynonymousExonChr130038156AAGA
SBE3Os02g0528200LOC_Os02g32660SNP: Non SynonymousExonChr219360942GGAG
SNP: Non SynonymousExonChr219361347TTCT
SSIIbOs02g0744700LOC_Os02g51070--------
AGPL1Os03g0735000LOC_Os03g52460--------
SBE4Os04g0409200LOC_Os04g33460--------
SSIIIbOs04g0624600LOC_Os04g53310SNP: Non SynonymousExonChr431752654GCGC
SNP: Non SynonymousExonChr431755480CTCT
SNP: Non SynonymousExonChr431755497CACA
SNP: Non SynonymousExonChr431757436CTCT
SNP: Non SynonymousExonChr431757746GAGA
SNP: Non SynonymousExonChr431758185TGTG
INDEL: Splice SiteSplice SiteChr431758814GGAGGA
ISA2Os05g0393700LOC_Os05g32710--------
SSIVbOs05g0533600LOC_Os05g45720--------
AGPL3Os05g0580000LOC_Os05g50380--------
GBSSI/WxOs06g0133000LOC_Os06g04200--------
SSIOs06g0160700LOC_Os06g06560--------
SSIIa/ALKOs06g0229800LOC_Os06g12450--------
SBE1Os06g0726400LOC_Os06g51084--------
AGPL4Os07g0243200LOC_Os07g13980--------
GBSSIIOs07g0412100LOC_Os07g22930SNP: Non SynonymousExonChr712917914AGGG
SSIIIaOs08g0191433LOC_Os08g09230--------
AGPS2Os08g0345800LOC_Os08g25734--------
ISA1Os08g0520900LOC_Os08g40930--------
AGPS1Os09g0298200LOC_Os09g12660--------
ISA3Os09g0469400LOC_Os09g29404--------
SSIIcOs10g0437600LOC_Os10g30156SNP: Non SynonymousExonChr1015673341CTCT
SNP: Non SynonymousExonChr1015675357GAGA
SNP: Non SynonymousExonChr1015675473GTGT
SNP: Non SynonymousExonChr1015680316CACA

Variation analysis on heading date genes

Eight (DTH2, OsLF, Hd17, Hd3a, Hd1, Hd2, Ehd3 and OsMADS56) from 39 heading date genes had 24 variations (19 SNPs and 5 Indels) among Longdao24, Longdao5 and Jigeng83 (Table 4). The only one non-synonymous SNP in DTH2 allele from Longdao24 was same as Nipponbare and Jigeng83, but different from Longdao5. Hd1 allele in Longdao24 had 6 non-synonymous SNPs, one frame shift Indel and three long base pare insertion (36 bp, 69 bp and 51 bp). Hd2, Ehd3 and OsMADS56 in Longdao24 all be identified with 3 non-synonymous SNPs. OsLF in Longdao24 all had one non-synonymous SNP and one Indel. Only one non-synonymous SNP was detected in Hd3a and Hd17. The SNPs and Indels in Hd3a, Hd2 and Hd1 locus were detected between Nipponbare with the other three varieties. The allele of OsLF were come from the female parent Longdao5. The other fourth allele of DTH2, Hd17, Ehd3 and OsMADS56 were come from the male parent Jigeng83.
Table 4

Variations of 39 heading date related genes in Longdao 24.

GenesRAP NO.MSU NO.Variation typeVariation regionVariation chromosomeVariation locationNipponbareLongdao24Longdao5Jigeng83
OsGIOs01g0182600LOC_Os01g08700--------
OsEF3Os01g0566100LOC_Os01g38530--------
OsLFL1Os01g0713600LOC_Os01g51610--------
OsCCT01Os01g0835700LOC_Os01g61900--------
OsMADS65Os01g0922800LOC_Os01g69850--------
Se13Os01g0949400LOC_Os01g72090--------
OsCOL4Os02g0610500LOC_Os02g39710--------
DTH2Os02g0724000LOC_Os02g49230SNP: Non SynonymousExonChr230098026TTGT
PPSOs02g0771100LOC_Os02g53140--------
rhd1Os02g0776900LOC_Os02g53690--------
HDR1Os02g0793900LOC_Os02g55080--------
Ehd4Os03g0112700LOC_Os03g02160--------
DTH3Os03g0122600LOC_Os03g03070--------
Se14Os03g0151300LOC_Os03g05680--------
OsHAP5COs03g0251350LOC_Os03g14669--------
OsPRR73Os03g0284100LOC_Os03g17570--------
Hd6Os03g0762000LOC_Os03g55389--------
Hd16Os03g0793500LOC_Os03g57940--------
SPIN1Os03g0815700LOC_Os03g60110--------
OsRR1Os04g0442300LOC_Os04g36070--------
HAF1Os04g0648800LOC_Os04g55510--------
OsLFOs05g0541400LOC_Os05g46370SNP: Non SynonymousExonChr526880725CGGC
INDEL: Frame ShiftExonChr526880755CCGGCGGC
Hd17Os06g0142600LOC_Os06g05060SNP: Non SynonymousExonChr62235191AGAG
RFT1Os06g0157500LOC_Os06g06300--------
Hd3aOs06g0157700LOC_Os06g06320SNP: Non SynonymousExonChr62942192CGGG
Hd1Os06g0275000LOC_Os06g16370INDEL: Codon InsertionExonChr69336861C37 bp37 bp37 bp
SNP: Non SynonymousExonChr69336938AGGG
SNP: Non SynonymousExonChr69336985GAAA
INDEL: Codon change + Codon InsertionExonChr69337012A70 bp70 bp70 bp
SNP: Non SynonymousExonChr69337021GAAA
INDEL: Codon InsertionExonChr69337032C52 bp52 bp52 bp
SNP: Non SynonymousExonChr69337148GAAA
INDEL: Frame ShiftExonChr69338004CTTCCC
SNP: Non SynonymousExonChr69338068ACCC
SNP: Non SynonymousExonChr69338330GAAA
Se5Os06g0603000LOC_Os06g40080--------
Ghd7Os07g0261200LOC_Os07g15770--------
Hd2/Ghd7.1Os07g0695100LOC_Os07g49460SNP: Non SynonymousExonChr729617569GCCC
SNP: Non SynonymousExonChr729623803GAAA
SNP: Non SynonymousExonChr729628500TCCC
Ehd3Os08g0105000LOC_Os08g01420SNP: Non SynonymousExonChr8274460GCGC
SNP: Non SynonymousExonChr8276145GAGA
SNP: Non SynonymousExonChr8276669GAGA
DTH8Os08g0174500LOC_Os08g07740--------
OsK4Os08g0484600LOC_Os08g37800--------
OsCO3Os09g0240200LOC_Os09g06464--------
Ehd2Os10g0419200LOC_Os10g28330--------
Ehd1Os10g0463400LOC_Os10g32600--------
OsMADS56Os10g0536100LOC_Os10g39130SNP: Non SynonymousExonChr1020872414TGTG
SNP: Non SynonymousExonChr1020872469GCGC
SNP: Non SynonymousExonChr1020872638AGAG
OsFKF1Os11g0547000LOC_Os11g34460--------
OsVIL2Os12g0533500LOC_Os12g34850--------

Development DNA markers for providing evidence of polymorphisms

Although the accuracy of deep sequencing has now been greatly improved, it still needs to be confirmed by other methods for the variations of interest. Therefore, we selected one InDel and one SNP polymorphisms to developed DNA markers (Table 5). We designed the InDel marker according the 9 bp deletion in SCM2 locus. A complete matching genotypes was observed in Longdao24 and its parents. Longdao24 and Longdao5 was found having this 9-bp deletion compared to Jigeng83 (Fig 7A). We also developed a CAPS marker to provide the SNP (2235191) in Hd17 locus. A complete matching genotypes was also observed in Longdao24 and its parents (Fig 7B).
Table 5

The primers used for detection the polymorphisms in SCM2 and Hd17.

GeneMarker typeForward PrimeReverse PrimerEnzyme
SCM2InDelCGACGGCGATGATGGAGGCGGCCTGCTCGCGTTCCT
Hd17CAPSCTACTCTTTGCCACCTGCAAACAATATCGGATATTATAGCHpy166II
Fig 7

Development DNA markers for providing evidence of polymorphisms.

Discussion

Breeding value of the re-sequencing data of super high yield rice variety

Marker-assisted selection (MAS) is expected to provide higher efficiency, reduced cost and shorter duration of the breeding scheme, compared with conventional methods. But most important complex traits in rice, including yield, quality and stress tolerance, are controlled by quantitative trait loci (QTLs). Isolating and characterizing genes involved in QTLs has been the key step for MAS. Whole genome re-sequencing technology has provided the possibility of genome wide variation analysis in rice breeding varieties. Longdao24 had been used widely as breeding parent, because of its high yield, good quality, early heading date and strong stress tolerance. Genome sequencing of Longdao24 with 47 × coverage effective depth and 95.08% 10 × coverage ratio was achieved. A total of 420,475 SNPs, 95,624 InDels, and 14,112 SVs were yielded from the Longdao24 genome. We identified 361,117 SNPs and 81,488 InDels between Longdao24 genome and Longdao5 genome. We also detected 428,908 SNPs and 97,209 InDels between Longdao24 genome and Jigeng83 genome. These different variations will be used for developing new molecular markers for genetics research and MAS.

The genetic basic of high yield in Longdao24

Developments of whole genome re-sequencing technology have provided new tools for discovering and tagging novel useful alleles for improving target traits and for manipulating those genes in rice breeding program through MAS. We identified four yield related genes (Gn1a, EP3, SCM2 and qGW8) having genetic variations in Longdao24. The first one is Gn1a, which controlled cytokinin accumulation in inflorescence meristems and increases the number of reproductive organs, resulting in enhanced grain yield [30]. Comparison of the DNA sequences between the cultivars revealed several nucleotide changes, including a 6-bp insertion in the first exon, and four nucleotide changes resulting in amino acid variation in the first and fourth exons of the Longdao24 and Longdao5 allele (Fig 8A). The Gn1a allele from Longdao24 and Longdao5 was similar to Habataki, which has been reported having the increasing Gn1a allele. The second one is EP3, which controlled panicle architecture and enhance the grain yield in rice [31]. Comparison of the DNA sequences between the cultivars revealed a 2-bp deletion in the first exon of the Longdao24 and Longdao5 allele (Fig 8B). The EP3 allele from Longdao24 and Longdao5 was a novel allele. The third one is SCM2, which showed enhanced culm strength and increased spikelet number [32]. Comparison of the DNA sequences between the cultivars revealed several nucleotide changes, including a 9-bp deletion in the second exon, and two nucleotide changes resulting in amino acid variation in the first exons of the Longdao24 and Longdao5 allele (Fig 8C). The SCM2 allele from Longdao24 and Longdao5 was same as Habataki, which has been reported having the increasing SCM2 allele. The last one is qGW8, which showed enhanced culm strength and increased spikelet number [33]. Comparison of the DNA sequences between the cultivars revealed several nucleotide changes, including a 10-bp insertion in the first exon, a 3-bp deletion in the first exon, and three nucleotide changes resulting in amino acid variation in the first and third exons of the Longdao24 and Jigeng83 allele (Fig 8D). The qGW8 allele from Longdao24 and Longdao5 was same as HJX74, which has been reported having the increasing yield haplotype. So, the super high yield formed by the large half erect panicle and lodging resistance of Longdao24 would be caused by these four increasing alleles of high yield genes including Gn1a, EP3, SCM2 and qGW8.
Fig 8

The yield related genes (Gn1a, EP3, SCM2 and qGW8) having genetic variations in Longdao24.

The genetic basic of early heading in Longdao24

Heading date is a major determinant of rice adaptability to regional and environmental conditions. It has been a major selecting target in rice breeding programs. To elucidate the key heading date gene in Longdao24 for adaptation to the northern limit of rice cultivation Heilongjiang Province (43°26’-53°33’), we analyzed 39 cloned heading date related genes. DTH2, OsLF, Hd17, Hd3a, Hd1, Hd2, Ehd3 and OsMADS56 had variations among Nipponbare, Longdao24, Longdao5 and Jigeng83. The alleles of Hd3a, Hd1 and Hd2 in Longdao24, Longdao5 and Jigeng83 were different from that in Nipponbare. The might be the major reason for these three varieties adaptation to the northern limit of rice cultivation. Hd1 and Hd3a are the two key genes controlled heading date in rice [34]. Comparison of the DNA sequences of Hd3a between the cultivars revealed only one nucleotide changes resulting in amino acid variation in the fourth exon of Longdao24, Longdao5 and Jigeng83 allele (Fig 9A). This Hd3a allele was a novel allele, which was not be reported before. The only one SNP caused an amino acid change at the carboxyl end of the predicted protein: the Asn (AAG) in Nipponbare was changed to Lys (AAC). The Hd1 allele in Longdao24, Longdao5 and Jigeng83 was also a novel allele. Four InDels and six SNPs was identified by comparison of the DNA sequences of Hd1 between the cultivars. Three long insertion and four nucleotide changes resulting in amino acid variation were identified in the first exon; and a 2-bp insertion and two nucleotide changes resulting in amino acid variation were identified in the second exon (Fig 9B). The Hd2 allele in Longdao24, Longdao5 and Jigeng83 all had the three nucleotide changes resulting in amino acid variation in the first, fourth and eighth exons (Fig 9C). These variations were found in many European and Asian rice cultivars, which flower extremely early under natural long-day conditions [35]. The DTH2 allele in Longdao24 was same as Jigeng83 (Fig 9D). This SNP in the third exon was reported as a key functional differences in the rice landraces from northern limit of rice cultivation in the world [36]. We also identified the allele of Hd17, Ehd3 and OsMADS56 in Longdao24 was came from Jigeng83 (Table 4). But only allele of OsLF was detected from Longdao5 (Table 4). All these information showed that the Hd3a, Hd1 and Hd2 might be the major reason for the varieties adaptation to the northern rice cultivation region. The DTH2, OsLF, Hd17, Ehd3 and OsMADS56 might formed different varieties adaptation to different region in northern rice cultivation location.
Fig 9

The heading related genes (Hd3a, Hd1, Hd2 and DTH2) having genetic variations in Longdao24.

The genetic basic of grain quality in Longdao24

Starch is the major component of rice grain, which is mainly composed of amylose and amylopectin. The starch synthesis pathway is an ideal system for examining the evolution of biochemical pathways. Over 20 genes involved in the rice starch synthesis pathway have been identified so far [37]. We investigated 22 cloned starch synthesis related genes in Longdao24 (Table 3). We only identified variations in SSIVa, SBE3, SSIIIb and SSIIc between the parents of Longdao24. All four allele of SSIVa, SBE3, SSIIIb and SSIIc were come from the male parent Jigeng83. These genes represented starch synthases (SSIVa, SSIIIb and SSIIc) and branching enzymes (SBE3). These enzymes are involved in amylopectin biosynthesis in rice endosperm. They had low to medium effects on variation in starch trait [38]. So we need do more works to get enough data, for example polymorphisms or expression levels of these genes, to explore the quality genetic basis of Longdao24.
  32 in total

1.  The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.

Authors:  Aaron McKenna; Matthew Hanna; Eric Banks; Andrey Sivachenko; Kristian Cibulskis; Andrew Kernytsky; Kiran Garimella; David Altshuler; Stacey Gabriel; Mark Daly; Mark A DePristo
Journal:  Genome Res       Date:  2010-07-19       Impact factor: 9.043

2.  Cytokinin oxidase regulates rice grain production.

Authors:  Motoyuki Ashikari; Hitoshi Sakakibara; Shaoyang Lin; Toshio Yamamoto; Tomonori Takashi; Asuka Nishimura; Enrique R Angeles; Qian Qian; Hidemi Kitano; Makoto Matsuoka
Journal:  Science       Date:  2005-06-23       Impact factor: 47.728

3.  Natural variation at the DEP1 locus enhances grain yield in rice.

Authors:  Xianzhong Huang; Qian Qian; Zhengbin Liu; Hongying Sun; Shuyuan He; Da Luo; Guangmin Xia; Chengcai Chu; Jiayang Li; Xiangdong Fu
Journal:  Nat Genet       Date:  2009-03-22       Impact factor: 38.330

4.  Mutations in the F-box gene LARGER PANICLE improve the panicle architecture and enhance the grain yield in rice.

Authors:  Ming Li; Ding Tang; Kejian Wang; Xinru Wu; Lili Lu; Hengxiu Yu; Minghong Gu; Changjie Yan; Zhukuan Cheng
Journal:  Plant Biotechnol J       Date:  2011-03-29       Impact factor: 9.803

5.  A draft sequence of the rice genome (Oryza sativa L. ssp. indica).

Authors:  Jun Yu; Songnian Hu; Jun Wang; Gane Ka-Shu Wong; Songgang Li; Bin Liu; Yajun Deng; Li Dai; Yan Zhou; Xiuqing Zhang; Mengliang Cao; Jing Liu; Jiandong Sun; Jiabin Tang; Yanjiong Chen; Xiaobing Huang; Wei Lin; Chen Ye; Wei Tong; Lijuan Cong; Jianing Geng; Yujun Han; Lin Li; Wei Li; Guangqiang Hu; Xiangang Huang; Wenjie Li; Jian Li; Zhanwei Liu; Long Li; Jianping Liu; Qiuhui Qi; Jinsong Liu; Li Li; Tao Li; Xuegang Wang; Hong Lu; Tingting Wu; Miao Zhu; Peixiang Ni; Hua Han; Wei Dong; Xiaoyu Ren; Xiaoli Feng; Peng Cui; Xianran Li; Hao Wang; Xin Xu; Wenxue Zhai; Zhao Xu; Jinsong Zhang; Sijie He; Jianguo Zhang; Jichen Xu; Kunlin Zhang; Xianwu Zheng; Jianhai Dong; Wanyong Zeng; Lin Tao; Jia Ye; Jun Tan; Xide Ren; Xuewei Chen; Jun He; Daofeng Liu; Wei Tian; Chaoguang Tian; Hongai Xia; Qiyu Bao; Gang Li; Hui Gao; Ting Cao; Juan Wang; Wenming Zhao; Ping Li; Wei Chen; Xudong Wang; Yong Zhang; Jianfei Hu; Jing Wang; Song Liu; Jian Yang; Guangyu Zhang; Yuqing Xiong; Zhijie Li; Long Mao; Chengshu Zhou; Zhen Zhu; Runsheng Chen; Bailin Hao; Weimou Zheng; Shouyi Chen; Wei Guo; Guojie Li; Siqi Liu; Ming Tao; Jian Wang; Lihuang Zhu; Longping Yuan; Huanming Yang
Journal:  Science       Date:  2002-04-05       Impact factor: 47.728

6.  A draft sequence of the rice genome (Oryza sativa L. ssp. japonica).

Authors:  Stephen A Goff; Darrell Ricke; Tien-Hung Lan; Gernot Presting; Ronglin Wang; Molly Dunn; Jane Glazebrook; Allen Sessions; Paul Oeller; Hemant Varma; David Hadley; Don Hutchison; Chris Martin; Fumiaki Katagiri; B Markus Lange; Todd Moughamer; Yu Xia; Paul Budworth; Jingping Zhong; Trini Miguel; Uta Paszkowski; Shiping Zhang; Michelle Colbert; Wei-lin Sun; Lili Chen; Bret Cooper; Sylvia Park; Todd Charles Wood; Long Mao; Peter Quail; Rod Wing; Ralph Dean; Yeisoo Yu; Andrey Zharkikh; Richard Shen; Sudhir Sahasrabudhe; Alun Thomas; Rob Cannings; Alexander Gutin; Dmitry Pruss; Julia Reid; Sean Tavtigian; Jeff Mitchell; Glenn Eldredge; Terri Scholl; Rose Mary Miller; Satish Bhatnagar; Nils Adey; Todd Rubano; Nadeem Tusneem; Rosann Robinson; Jane Feldhaus; Teresita Macalma; Arnold Oliphant; Steven Briggs
Journal:  Science       Date:  2002-04-05       Impact factor: 47.728

7.  Identification and characterization of the erect-pose panicle gene EP conferring high grain yield in rice (Oryza sativa L.).

Authors:  Jiayu Wang; Tetsuya Nakazaki; Shuqian Chen; Wenfu Chen; Hiroki Saito; Takuji Tsukiyama; Yutaka Okumoto; Zhenjin Xu; Takatoshi Tanisaka
Journal:  Theor Appl Genet       Date:  2009-04-29       Impact factor: 5.699

8.  Gains in QTL detection using an ultra-high density SNP map based on population sequencing relative to traditional RFLP/SSR markers.

Authors:  Huihui Yu; Weibo Xie; Jia Wang; Yongzhong Xing; Caiguo Xu; Xianghua Li; Jinghua Xiao; Qifa Zhang
Journal:  PLoS One       Date:  2011-03-03       Impact factor: 3.240

9.  New approach for rice improvement using a pleiotropic QTL gene for lodging resistance and yield.

Authors:  Taiichiro Ookawa; Tokunori Hobo; Masahiro Yano; Kazumasa Murata; Tsuyu Ando; Hiroko Miura; Kenji Asano; Yusuke Ochiai; Mayuko Ikeda; Ryoichi Nishitani; Takeshi Ebitani; Hidenobu Ozaki; Enrique R Angeles; Tadashi Hirasawa; Makoto Matsuoka
Journal:  Nat Commun       Date:  2010-11-30       Impact factor: 14.919

10.  Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data.

Authors:  Yoshihiro Kawahara; Melissa de la Bastide; John P Hamilton; Hiroyuki Kanamori; W Richard McCombie; Shu Ouyang; David C Schwartz; Tsuyoshi Tanaka; Jianzhong Wu; Shiguo Zhou; Kevin L Childs; Rebecca M Davidson; Haining Lin; Lina Quesada-Ocampo; Brieanne Vaillancourt; Hiroaki Sakai; Sung Shin Lee; Jungsok Kim; Hisataka Numa; Takeshi Itoh; C Robin Buell; Takashi Matsumoto
Journal:  Rice (N Y)       Date:  2013-02-06       Impact factor: 4.783

View more
  3 in total

1.  In Silico Identification of QTL-Based Polymorphic Genes as Salt-Responsive Potential Candidates through Mapping with Two Reference Genomes in Rice.

Authors:  Buddini Abhayawickrama; Dikkumburage Gimhani; Nisha Kottearachchi; Venura Herath; Dileepa Liyanage; Prasad Senadheera
Journal:  Plants (Basel)       Date:  2020-02-11

Review 2.  Genomic resources in plant breeding for sustainable agriculture.

Authors:  Mahendar Thudi; Ramesh Palakurthi; James C Schnable; Annapurna Chitikineni; Susanne Dreisigacker; Emma Mace; Rakesh K Srivastava; C Tara Satyavathi; Damaris Odeny; Vijay K Tiwari; Hon-Ming Lam; Yan Bin Hong; Vikas K Singh; Guowei Li; Yunbi Xu; Xiaoping Chen; Sanjay Kaila; Henry Nguyen; Sobhana Sivasankar; Scott A Jackson; Timothy J Close; Wan Shubo; Rajeev K Varshney
Journal:  J Plant Physiol       Date:  2020-12-17       Impact factor: 3.549

Review 3.  Translational genomics and multi-omics integrated approaches as a useful strategy for crop breeding.

Authors:  Hong-Kyu Choi
Journal:  Genes Genomics       Date:  2018-10-23       Impact factor: 1.839

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.