Development of a Method to Extract and Amplify the Complete Mitogenome of Some Sparidae Species.

Previous studies showed that fish mitochondrial DNA (mtDNA) is set up by a closed circular molecule of 16-17 kilobases (kb), comprising 2 ribosomal RNA genes (rRNA), 22 transfer RNA genes (tRNA), 13 protein-coding genes and 2 non-coding regions. The analysis of single mtDNA genes, such as Cytb, COI, 16S and 12S, or short segment of them, has been widely used against species substitution in both fresh and processed fish products. The analysis of the complete mitochondrial genome of fishery products allows to better study and characterise fish species. The aim of this research was to extract and amplify the complete mtDNA of some fish species of commercial interest belonging to the Sparidae family. The studied species were Dentex dentex, Dentex gibbosus, Dentex nufar, Pagellus acarne and Pagellus erythrinus. The entire mitogenome was obtained by gene amplification using long polymerase chain reactions. The analysis of the complete mitochondrial sequences will allow to gain further insights on these species and to find polymorphic sites that assess the degree of genetic variability of the species belonging to the family Sparidae.

Competing interest statement

Conflict of interest: the authors declare no potential conflict of interest.

Introduction

The molecular characterisation of the entire mitochondrial genome provides complete genetic information for phylogenetic analysis of organisms. The complete nucleotide sequence of fish mitochondrial genomes was determined from a growing number of species (Miya et al., 2003). Fish mitochondrial DNA (mtDNA) is a circular molecule of 16-17 kilobases (kb)kb in length, normally consisting of 2 ribosomal RNA genes (rRNA), 22 transfer RNA genes (tRNA), 13 protein-coding genes and and 2 non-coding regions (Shi et al., 2012). The study of mtDNA has become a very useful approach in population genetics and evolutionary studies (Manchado et al., 2004) and is used as marker to detect fraudulent substitutions in prepared and transformed fish products (Pepe et al., 2005, 2007); the nucleotide sequences that are fragments belonging to the genes cytochrome b (cyt b) genes, ribosomal 16S and 12S subunits, and cytochrome c oxidase subunit 1 (COI) (Espiñeira et al., 2008; Hubalkova et al., 2008; Zhang and Hanner, 2012; Chin et al., 2016). However, the use of short segments of the mtDNA (~100-700 base pairs) may give ambiguous results, because the fragments are too short to contain sufficient genetic information, and the variations among species are represented by few polymorphisms expressed by point mutations (Bottero et al., 2007). It appears that more mitochondrial genomic information is needed to highlight the presence of more variable regions within the species.

The Sparidae family is one of the most valuable and popular fish resources in the world and comprises about 41 species of different commercial value (D.M. MIPAAF, 31 January 2008; Italian Republic, 2008). Species substitution is very common in prepared and processed fish products, due to the profits resulting from the placing on the market of less expensive species. At the present time, nine Sparidae complete mitochondrial genome sequences are available in GenBank (Acanthopagrus latus, Acanthopagrus schlegelii, Dentex tumifrons, Pagellus bogaraveo, Pagrus auriga, Pagrus major, Parargyrops edita, Rhabdosargus sarba, Sparus aurata). Increase the mitochondrial genomic data on the others Sparidae species appear of great interest.

The extraction and the amplification of the mitochondrial genome is a primary key to correctly continue the study of mitochondrial DNA through the comparison and analysis of properly obtained sequences. The aim of this research was to find a useful method for the extraction and amplification of the complete mtDNA of five fish species of commercial interest belonging to the Sparidae family, with the future aim to analyze and compare them, increasing our knowledge with regard to Sparidae mitogenomics. The mtDNA was isolated using long-polymerase chain reaction (PCR). The long PCR method was selected because represents a major advance for the high-yield purification of mtDNA (Yamauchi et al., 2004) and is one of the most efficient ways to isolate and successfully sequence the entire mitogenome of fishes (Miya and Nishida, 1999).

Materials and methods

A total of five different Sparidae species were tested. Here, the species Dentex dentex, Dentex gibbosus, Dentex nufar, Pagellus acarne and Pagellus erythrinus were analyzed. The whole specimens were identified, according to their anatomical and morphological features, as belonging to D. dentex, D. gibbosus, D. nufar, P. acarne and P. erythrinus species at the Department of Veterinary Medicine and Animal Production, University Federico II, Naples. D. dentex specimen was fished in Adriatic sea (near Vieste). D. nufar, P. acarne and P. erythrinus specimens were supplied at Salerno fish market. D. gibbosus specimen was collected at Pozzuoli fish market. Fish were frozen on board at -20°C and shipped in insulated boxes to the laboratory. The tissues sampled from each specimen were: tongue muscle, dorsal fin, skeletal muscle, caudal fin and liver. Total DNA was extracted from each sampled tissue, using the following methods: DNeasy tissue kit (Qiagen, Hilden, Germany) and NucleoSpin tissue kit (Macherey-Nagel, Düren, Germany), both according to the manufacturer’s instructions, CTAB based method (Doyle and Doyle, 1987), salting-out method (Martínez et al., 1998). Extracted DNA was quantified using NanoDrop ND-2000C (Thermo Scientific, Waltham, MA, USA). DNA concentration was expected to be between ~35 and 200 ng/mL and the purity of DNA in the range of 1.8-2.0 ratio of absorbance wavelength A260/A280. Electrophoretic analysis was also done using 1% agarose gel to examine the degree of degradation or the extracted DNA. For the long PCR (Miya et al., 2001), the primers that were used are shown in Table 1.

Table 1.

Sequences of selected long polymerase chain reaction primers.

N°	Primer	5’ ⇒ 3’	Temperature (°C)
FW 6	S-LA-16SH R	GATGTTGGATCAGGACATCCYAATGGTGCA	70.2
FW 5	L12321-LEU	GGTCTTAGGAACCAAAAACTCTTGGTGCAA	72.8
REV 2	S-LA-16SH	TGCACCATTRGGATGTCCTGATCCAACATC	70.2
REV 8	L12321-LEU R	TTGCACCAAGAGTTTTTGGTTCCTAAGACC	72.8

These primers were chosen after multiple alignment (Figure 1) using BioEdit Sequence Alignment Editor (Hall, 1999) of Sparidae complete mitochondrial genome sequences available in GenBank: Acanthopagrus latus (NC_010977.1, Xia et al., 2008), Acanthopagrus schlegelii (JQ746035.1, Shi et al., 2012), Dentex tumifrons (NC_029479.1, Zeng et al., unpublished), Pagellus bogaraveo (NC_009502.1, Ponce et al., 2008), Pagrus major (NC003196.1, Miya et al., 2001), Pagrus auriga (NC005146.1, Ponce et al., unpublished), Parargyrops edita (EF107158.1, Xia et al., 2007), Rhabdosargus sarba (KM272585.1, Li et al., 2016), Sparus aurata (LK022698.1, Dray et al., 2014). The primers were used to amplify the complete mitochondrial genomes in two long PCRs (two-step strategy) (Figure 2).

Figure 1.

Alignment of forward primer sequences with their respective annealing sites on the mitochondrial genome of 9 Sparidae species. The primer order was 5-3 . Dots indicate identical sites, dashes indicate gaps and divergent sites are indicated by the corresponding nucleotide. Reverse primers (S-LA-16SH, annealing site at 3790 bp; L12321- LEU R, annealing site at 13282 bp) were obtained from the reversed and complement sequences of forward primers.

Figure 2.

Schematic model of the structural organisation of the Sparidae (e.g. Pagrus major NC003196.1) mitochondrial genome. Primer annealing sites are indicated by green arrows ( ~ 9.5 kb amplicon) and pink arrows ( ~ 8 kb amplicon).

Long PCRs (final volume=50 μL) were performed in a PTC-100 thermal cycler (MJ Research) and standardized as follows: 29.75 μL sterile distilled H2O, 10 μL Q5 PCR buffer (NEB), 5 μL dNTP (2 mM), 0.75 μL forward primer (50 pmol/μL), 0,5 μL reverse primer, 1 μL of 2000 U/mL Q5 High-Fidelity Taq polymerase (NEB), and 3 μL (100 ng) of DNA template. The thermal cycle profile is that of shuttle PCR: denaturation at 98°C for 10 seconds, with annealing and extension combined at the same temperature (72°C) for 9 minutes and 20 seconds. Double-stranded PCR products were purified using High Pure PCR Product Purification Kit (Roche, Basilea, Switzerland).

Results

DNA was correctly extracted from all examined samples. The best quality and quantity of DNA was obtained from the dorsal fin using DNeasy tissue kit (Qiagen). The long PCR approach allowed to obtain the complete mitochondrial genome of D. dentex, D. gibbosus, D. nufar, P. acarne and P. erythrinus in two well-resolved amplicons ranging of ~8 and ~9.5 kb (amplicon A: L12321-Leu/ S-LA-16SH, and amplicon B: S-LA-16SH R/ L12321-LeuR, respectively). These two fragments were complementary to each other. High yields of specific long-PCR amplicons were obtained for the tested species D. gibbosus and P. erythrinus, without any further optimization of the long PCR conditions (Figure 3). Weakness in the reproducibility of amplification was found in the other three species, in particular for the longer (~ 9.5 kb) amplicon.

Figure 3.

Long polymerase chain reaction products. Lane 1 - ~ 8 kb amplicon of Dentex gibbosus; lane 2 - ~ 8 kb amplicon of Pagellus erythrinus; lane 3 - ~ 9.5 kb amplicon of Dentex gibbosus; lane 4 - ~ 9.5 kb amplicon of Pagellus erythrinus; lane 5 - GeneRuler 1 kb DNA Ladder (ThermoFisher Scientific, Waltham, MA, USA); lane 6 - Lambda DNA/HindIII marker (ThermoFisher Scientific).

Discussion

Preliminary results of this study allowed suggesting a useful method for the extraction and amplification of the complete mitogenome of five species belonging to the Sparidae family. The best results were obtained for Dentex gibbosus and Pagellus erythrinus. The amplification was also possible for the other three species Dentex dentex, Dentex nufar and Pagellus acarne, with a still lower degree of reproducibility. For these three species, we are testing different primer set amplifying for smaller fragments designed to facilitate the amplification and the sequencing steps and sets in order to increase the level of reproducibility. The mitogenome amplification is a primary key to correctly continue the study of mitochondrial DNA. The next step of this study will include the sequencing and analysis of the genetic variability of the sequenced mitogenomes. The complete mtDNA is able to provide important information that may highlight the presence of any variable regions within the species, with the aim to design primer sets that are able to amplify species-specific fragments.

Conclusions

This technique will allow a rapid species identification using a single PCR reaction, providing the basis for the molecular traceability of the fish products, in agreement with the provisions of Regulation (EU) 1379/2013 (European Commission, 2013).