Literature DB >> 28693618

Simple and fast quantification of DNA damage by real-time PCR, and its application to nuclear and mitochondrial DNA from multiple tissues of aging zebrafish.

Shusen Zhu1, James A Coffman2.   

Abstract

We describe a real-time (rt) PCR-based method of quantifying DNA damage, adapted from the long-run rtPCR method of DNA damage quantification (LORD-Q) developed by Lehle et al. (Nucleic Acids Res 42(6):e41, 2014). We show that semi-long run rtPCR, which generates amplicons half the length of those generated in LORD-Q, provides equivalent sensitivity for detecting low lesion frequencies, and better sensitivity for detecting high frequencies. The smaller amplicon size greatly facilitates PCR optimization and allows greater flexibility in the use of detection dyes, and a modified data analysis method simplifies the calculation of lesion frequency. The method was used to measure DNA damage in the nuclear and mitochondrial genomes of different tissues in zebrafish of different ages. We find that nuclear DNA damage generally increases with age, and that the amount of mitochondrial DNA damage varies substantially between tissues, increasing with age in liver and brain but not in heart or skeletal muscle, the latter having the highest levels of damage irrespective of age.

Entities:  

Keywords:  Aging; DNA damage; Mitochondrial; Nuclear; Quantitative PCR; Zebrafish

Mesh:

Substances:

Year:  2017        PMID: 28693618      PMCID: PMC5504608          DOI: 10.1186/s13104-017-2593-x

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Background

The information encoded in the nucleotide sequence of genomic DNA is essential for biological function, and cells employ numerous mechanisms to repair damaged DNA and maintain genomic integrity. Nonetheless, the frequency of genotoxic insults can overcome a cell’s capacity for DNA repair, leading to the accumulation of DNA damage that can in turn lead to cell death or senescence, or transformation to non-functional or pathological cellular phenotypes. The question of how much damage is present in the DNA of a cell, tissue, or organism at different stages of a life cycle or in different environmental or physiological circumstances is central to various fields of biomedicine, including toxicology, oncology, and gerontology; hence, robust, sensitive, and user-friendly methods of quantifying DNA damage are widely called for in biomedical science. Since lesions that disrupt DNA integrity interfere with DNA replication, DNA damage can be measured by polymerase chain reaction (PCR). Quantitative PCR (qPCR) methods of measuring DNA damage make use of the fact that replication efficiency is proportional to the average frequency of lesions within a defined region, and hence the length of that region [1]. Generally these methods work by comparing the ratios of long and short amplicons obtained from different samples, the latter providing a baseline (virtually damage-free) reference. Originally this approach made use of end-point PCR [2]. More recently a real-time PCR method of using long-run real-time (rt) PCR for DNA damage quantification (LORD-Q) was described which allowed sensitive and robust detection of the number of lesions (including double-stranded breaks, abasic sites, thymine dimers, and 5-hydroxymethyl dC) within a defined sequence [3]. As originally described this method requires amplification of relatively long sequences, ~3–4 kb in length. Although PCR is straightforward in theory, in practice it often requires extensive optimization to maximize efficiency and specificity, and the ease of optimization decreases with increasing amplicon length. We therefore asked whether the LORD-Q method could be adapted to work with shorter amplicons. We find that semi-long run (SLR) amplicons of ~1.5–2 kb provide sensitivity equivalent to that provided by LORD-Q for detection of low-frequency damage, and better sensitivity for high-frequency damage. Shorter amplicons make PCR conditions less stringent and therefore easier to optimize. To demonstrate the utility of this method, we use it to quantify DNA damage in the nuclear and mitochondrial genomes from multiple tissues of zebrafish of different ages. Unlike most studies in the past that that made such measurements following differential isolation of the mtDNA and nDNA, in our analysis the mtDNA and nDNA were co-isolated, allowing their direct comparison. Our results show that DNA damage varies between tissues, is on average higher in mitochondrial DNA than in nuclear DNA, and generally increases with age.

Methods

DNA isolation and purification

Total DNA was purified from zebrafish tissues using E.Z.N.A. tissue DNA kit (OMEGA, USA). DNA quantity and purity were determined by spectrometry using a Nanodrop 1000. The purified DNA (A260/A280 ≥1.8) was stored at 4 °C.

Primers for the real-time PCR

For comparison of the sensitivity and accuracy of long run (LR) and semi-long run (SLR) PCR of nuclear DNA (nDNA) and mitochondrial DNA (mtDNA), and to examine the difference in the amount of damage in coding region and D-loop regions of mtDNA, we designed 2 pairs of long-run primers for amplicons of 3.5–4 kb, 3 pairs of semi-long-run primers for amplicons of 1.6–2 kb, and 2 pairs of short run primers for amplicons of 55 bp which served as internal undamaged references for normalization (Table 1). All three pairs of primers for nDNA are located in the zebrafish (Danio rerio) aryl hydrocarbon receptor2 (AHR2) gene, and the four pairs of primers for zebrafish mtDNA cover different regions. The primers were designed using program NCBI/primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and synthesized by Integrated DNA Technologies (IDT, USA) with standard desalting.
Table 1

Primers and targets

PrimerSequenceAmplicon (bp)Target
AHRLFGTCCTTGCAGGTTGGCAAATGG3502AHR2
AHRLRGACCTTGTCTGGTTTTCATCCC
AHRSLFTCATCCTGTTATCCACCACACTGTTG1637AHR2
AHRSLRTGGTTCTTGGCTACACTGAGATTGAG
AHRRFCCAAGGTCCGACATAACTCACTTCTG55AHR2
AHRRRGACATGATGTACTGTGCTGACAACCA
mtLFTTAAAGCCCCGAATCCAGGTGAGC3669mtDNA coding region
mtLRTTAGGGGTAGTGAGTTTTGGGTC
mtSLFGGATTCCAAGACGCAGCATCACCTG1978mtDNA coding region
mtSLRGGAGCGGCACTTCAAATGGGTCAAG
mtDLPFCCTTACACGATTCTTCGCATTCCAC1939mtDNA D-loop region
mtDLPRGGCTTGGCTAGGCGTCTTGG
mtRFCGAGGAGCAGGTATCAGGCACA55mtDNA coding region
mtRRGTGGCTTGGCTAGGCGTCTTG
Primers and targets

Enzymatic digestion of isolated DNA

For quantification of defined lesion frequencies, 5 µg of total DNA isolated from 7 month-old zebrafish brains was subjected to enzymatic digestion with the restriction endonuclease PvuII (for SLR PCR), identified as single cutter for both the targeted nDNA (1637 bp of AHR2 gene) and mtDNA (1978 bp), or NdeI (for LR PCR), identified as single cutter for both the targeted nDNA (3502 bp of AHR2 gene) and mtDNA (3669 bp), using the NEBcutter V2.0 software (http://nc2.neb.com/NEBcutter2). Digestion was carried out at 37 °C for 2 h in a 100-µl volume using 50 units PvuII and NdeI (NEB) respectively. For the analysis of DNA-lesion frequency, digested and undigested DNA was diluted and mixed at different ratios (Additional file 1: Table S1) prior to real-time PCR quantification.

DNA irradiation

1.5 µl of purified DNA from brains of 5-month-old zebrafish was loaded on a piece of parafilm and exposed to ultraviolet C radiation (UVC) at dose of 0.5, 1, 2, 5, 10, 20 and 50 mJ/cm2 in a UV crosslinker (UVP HL-2000 HybriLinker, USA). Irradiated DNA was then diluted to 16 ng/µl for nDNA and 2 ng/µl for mtDNA damage assay.

Real-time PCR

Real-time PCR (rtPCR) for DNA damage quantification was carried out in a LightCycler 480 II system (Roche) in 96-well plates. The PCR conditions were optimized for the different primers and different targets to get specific products which were confirmed by melting curve analysis and agarose gels (Fig. 1). The PCR amplification was monitored by real-time measurement of the intercalation of the saturating fluorescent dye into dsDNA. 4 ng of nDNA sample or 1 ng of mtDNA sample was applied in 10 µl of total reaction volume. Standard curves were created by serial dilution of the undamaged control with concentration of 16, 4, 1, 0.25 ng of nDNA and 4, 1, 0.25, 0.0625 ng of mtDNA for quantification of all targets of different sizes. Total DNA from brains of 5-month-old zebrafish (found to have the lowest amount of DNA damage; see Fig. 4) served as undamaged reference. Each sample was assayed in triplicate. For LR and SLR real-time PCR, Platinum Pfx DNA polymerase (ThermoFisher Scientific, USA) was employed and the reactions containing 1X fluorescent dye were performed in 96-well clear plates. Resolight dye was used for all experiments except that which compared the effect of different dyes on the specificity and efficiency of the PCR, which used 1X Resolight (Roche), 1.5 µM SYTO-9 (ThermoFisher Scientific, USA) or 1X EvaGreen (Biotium, USA). For reference quantification (short run), PerfeCTa SYBR Green FastMix (Quanta BioSciences) was used, and the reactions were performed in 96-well white plates. In initial trials comparing Pfx DNA polymerase with hot start Taq polymerase, Pfx was found to be more efficient and more specific than hot start Taq.
Fig. 1

Test of different fluorescent dyes on sensitivity and specificity of LR and SLR PCR. a LR and SLR amplicons generated from different quantities of nuclear DNA (nDNA). b LR and SLR amplicons generated from different quantities of mitochondrial DNA (mtDNA). Arrows indicate non-specific products

Fig. 4

DNA damage measured within a nuclear and b mitochondrial DNA from different tissues of zebrafish of different ages. Error bars indicate standard deviation of three replicate measurements from the same DNA, for each of which there were three replicates of the PCR. Significance (in comparison to 5 months using a two-tailed t test): *p < 0.05; **p < 0.01; ***p < 0.001

Test of different fluorescent dyes on sensitivity and specificity of LR and SLR PCR. a LR and SLR amplicons generated from different quantities of nuclear DNA (nDNA). b LR and SLR amplicons generated from different quantities of mitochondrial DNA (mtDNA). Arrows indicate non-specific products

Data analysis

Absolute quantification and second derivative maximum analysis methods were applied for all PCRs (LightCycler 480 Instrument Operator’s Manual, v1.5, 2012). Sample and reference DNA were analyzed side-by-side. DNA damage is quantified by normalizing the concentration values of samples to the concentration values of the internal reference. The resulting values are converted to relative lesion frequencies per 10 kb DNA by application of the Poisson distribution (lesions/amplicon = −ln(At/A0)), where At represents the amplification (normalized concentration) of treated samples and A0 is the amplification of untreated or undamaged controls [1]. long fragment represents the LR or SLR amplicon. Statistical analysis of intergroup differences was performed using one-way or two-way ANOVA and Student’s t test.

Results

Semi long-run PCR is more efficient than long-run PCR and the products are more specific

We first used standard PCR to compare the specificity of the LR PCR (3–4 kb) used in LORD-Q to that of SLR PCR (1.6–2 kb), as assessed by the appearance of non-specific amplification products on a gel. This was done both without dye added to the reaction, and in the presence of a fluorescent intercalating dye such as is used in real-time PCR. The commonly used fluorescent dye SYBR Green inhibits synthesis of long PCR products, so LORD-Q instead uses the non-inhibitory dye Resolight [3]. We also tested two additional dyes reported to have low inhibitory effects, Syto-9 and Evagreen, which are considerably less expensive than Resolight (340- and 11-fold, respectively). With both nDNA and mtDNA primer sets, SLR PCR yielded a single product in the presence of all three dyes (Fig. 1). In contrast, the LR PCRs generated non-specific products visible as smears or non-specific bands following agarose gel electrophoresis (Fig. 1, arrows), indicating that all three dyes reduce the specificity of LR PCR, with Evagreen having the biggest negative effect. These results indicate that in the presence of intercalating dye SLR PCR is more specific than LR PCR.

The sensitivity of the SLR real-time PCR based DNA damage assay is comparable to the LORD-Q method

To compare the use of SLR versus LR PCR in a real-time PCR-based DNA damage assay, we digested DNA with restriction endonucleases predicted to make a single cut within the amplified mtDNA and nDNA fragments. The digested DNA was then mixed with undigested DNA at different ratios to generate a standard curve, and both SLR and LR real-time PCR were performed to measure the premade DNA damage. The expected lesion rates were calculated and plotted against the experimentally measured damage (Fig. 2; Additional file 1: Table S1). With both LR and SLR PCR, the measured lesion frequencies tracked the expected frequencies for both the mtDNA and nDNA, albeit more closely with SLR PCR with increasing levels of damage (Fig. 2), suggesting that the latter provides somewhat greater accuracy at higher levels of damage.
Fig. 2

Correlation of calculated and measured DNA lesion frequencies in a nDNA and b mtDNA. Error bars indicate standard deviation of three technical replicates of the PCR

Correlation of calculated and measured DNA lesion frequencies in a nDNA and b mtDNA. Error bars indicate standard deviation of three technical replicates of the PCR To further compare the sensitivity of SLR and LR for measuring a range of DNA damage, we subjected naked nDNA and mtDNA (extracted DNA in a small volume of TrisEDTA buffer) to UVC. DNA damage generated by 5 J/m2 (0.5 mJ/cm2) UVC should be in the range of 1.5–2 lesions/10 kb [4], and this is what we measured by both methods (Fig. 3; Additional file 1: Table S2). The results also showed that DNA damage increases in a UV dose-dependent manner. At low dose of UVC, the amount of damage in both nDNA and mtDNA detected by SLR PCR is very close to that detected by LR PCR, indicating similar sensitivities. With increasing UVC dose, the signal produced by LR PCR saturated sooner than that produced by SLR PCR (Fig. 3), again indicating that SLR PCR is more sensitive than LR PCR at detecting higher levels of DNA damage.
Fig. 3

Measurement of DNA damage induced by UVC exposure in a nDNA and b mtDNA. Error bars indicate standard deviation of three experimental replicates, for each of which there were three replicates of the PCR

Measurement of DNA damage induced by UVC exposure in a nDNA and b mtDNA. Error bars indicate standard deviation of three experimental replicates, for each of which there were three replicates of the PCR

Use of SLR rtPCR to measure damage in nuclear and mitochondrial DNA from tissues of zebrafish of different ages

As an application we asked whether SLR rtPCR could detect differences in the amount of DNA damage in the nuclear and/or mitochondrial genomes of different tissues of adult zebrafish of different ages, from young adulthood (5 months) through middle age (20 months). Nuclear DNA damage in all the four tissues of zebrafishes was found to increase with age, becoming statistically significant after 12-months (except in 20-month old heart sample) (Fig. 4a). Mitochondrial DNA damage increases with age in brain and liver, with the increase becoming statistically significant at 20-months in brain and after 8-months in liver. No significant change with age was observed in muscle and heart, except in the 12-month old heart sample which had less damage (Fig. 4b). Previous studies have shown that D-loop region of mtDNA, which exhibits a triple-stranded, semi-stable DNA structure during replication, is more vulnerable to oxidative damage and radiation [5, 6]. We therefore asked whether the coding region and the control region containing the D-Loop structure had different amounts of DNA damage. Two-way ANOVA of the results did not show any significant difference in the cumulative in vivo damage displayed by the two regions of mtDNA in brain, muscle and liver, whereas the coding region had slightly higher levels of damage than D-Loop region (p < 0.05) in heart. DNA damage measured within a nuclear and b mitochondrial DNA from different tissues of zebrafish of different ages. Error bars indicate standard deviation of three replicate measurements from the same DNA, for each of which there were three replicates of the PCR. Significance (in comparison to 5 months using a two-tailed t test): *p < 0.05; **p < 0.01; ***p < 0.001

Discussion

Our results indicate that SLR rtPCR provides several advantages to LORD-Q for quantifying DNA damage. With low levels of DNA damage, the sensitivity of SLR rtPCR is comparable to that of the LR rtPCR employed in LORD-Q, whereas with high levels of DNA damage the sensitivity and hence accuracy of SLR rtPCR exceeds that of LORD-Q (Figs. 2, 3). This may be because the LR PCR generates more non-specific product (Fig. 1). In addition, the long amplicons utilized by LORD-Q are inherently less sensitive to high levels of DNA damage than are shorter amplicons: since a single lesion within the amplified region is likely sufficient to block amplification, multiple lesions within a single stretch of DNA are invisible to this method, leading to earlier signal saturation. While shorter amplicons are inherently more sensitive to higher levels of damage, they are less sensitive to low levels. Nevertheless, our results (Figs. 2, 3) demonstrate that SLR provides sensitivity equivalent to LORD-Q for detecting low levels of DNA damage. Since results from previous studies indicate that even shorter amplicons are less sensitive [5], we believe that the ~2 kb employed by our SLR rtPCR method may be optimal for this type of analysis. Importantly, SLR rtPCR makes PCR optimization easier and hence faster, and offers greater flexibility in selection of fluorescent dyes for real time detection (Fig. 1). Finally, whereas the LORD-Q data analysis method requires the use of the Fit Point method to generate the amplification efficiency for the calculation of lesion frequency, our calculation of DNA lesion frequency using normalized concentration values enables the use of the 2nd derivative maximum analysis method (see “Methods”; Additional file 1: Table S3), which offers the advantages of higher accuracy, speed and simplicity. Applying our method to both the nuclear and mitochondrial genomes of various somatic tissues in aging zebrafish we find that DNA damage accumulates with age, consistent with the widely held view that aging in senescing animals entails loss of genomic stability in somatic tissues. It should be noted that the average levels of DNA damage detected do not reflect per-cell levels of damage, but rather the average level of DNA damage throughout the tissue. Thus the increase in DNA damage seen in several of the tissues probably reflects increasing numbers of senescent or dying cells, rather than increasing loads of DNA damage within healthy cells. Although previous studies have examined the levels of DNA damage and repair capacities in specific tissues at different life cycle stages [7-11], none so far have reported direct comparisons of the amount of DNA damage in different tissues in an adult animal and its change with age. Our measurements showed that both brain and heart have lower nuclear and mitochondrial DNA damage than muscle and liver, consistent with the higher repair capacity that might be expected in the former tissues. The results from muscle and liver are consistent with studies showing that in most tissues levels of DNA damage are higher in mitochondria than in nuclei [11, 12]. Finally, whereas damage in nuclear DNA was found to increase with age in each of the somatic tissues examined, damage in mitochondrial DNA increased in brain and liver, but not in heart or skeletal muscle, wherein the highest levels of DNA damage were found irrespective of age. These results suggest that aging entails increasing levels of nuclear DNA damage in somatic tissues, consistent with what has been found in previous studies [13, 14].
  14 in total

1.  A reliable assessment of 8-oxo-2-deoxyguanosine levels in nuclear and mitochondrial DNA using the sodium iodide method to isolate DNA.

Authors:  M L Hamilton; Z Guo; C D Fuller; H Van Remmen; W F Ward; S N Austad; D A Troyer; I Thompson; A Richardson
Journal:  Nucleic Acids Res       Date:  2001-05-15       Impact factor: 16.971

2.  Does oxidative damage to DNA increase with age?

Authors:  M L Hamilton; H Van Remmen; J A Drake; H Yang; Z M Guo; K Kewitt; C A Walter; A Richardson
Journal:  Proc Natl Acad Sci U S A       Date:  2001-08-21       Impact factor: 11.205

Review 3.  The regulation of DNA repair during development.

Authors:  D L Mitchell; P S Hartman
Journal:  Bioessays       Date:  1990-02       Impact factor: 4.345

Review 4.  Nuclear DNA damage as a direct cause of aging.

Authors:  Benjamin P Best
Journal:  Rejuvenation Res       Date:  2009-06       Impact factor: 4.663

Review 5.  The QPCR assay for analysis of mitochondrial DNA damage, repair, and relative copy number.

Authors:  Senyene E Hunter; Dawoon Jung; Richard T Di Giulio; Joel N Meyer
Journal:  Methods       Date:  2010-02-01       Impact factor: 3.608

6.  Endogenous deoxyribonucleic Acid (DNA) damage in human tissues: a comparison of ethenobases with aldehydic DNA lesions.

Authors:  Alain Barbin; Hiroko Ohgaki; Jun Nakamura; Michael Kurrer; Paul Kleihues; James A Swenberg
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2003-11       Impact factor: 4.254

7.  Base excision repair capacity in mitochondria and nuclei: tissue-specific variations.

Authors:  Bensu Karahalil; Barbara A Hogue; Nadja C de Souza-Pinto; Vilhelm A Bohr
Journal:  FASEB J       Date:  2002-12       Impact factor: 5.191

8.  Analysis of differential DNA damage in the mitochondrial genome employing a semi-long run real-time PCR approach.

Authors:  Oliver Rothfuss; Thomas Gasser; Nadja Patenge
Journal:  Nucleic Acids Res       Date:  2009-12-04       Impact factor: 16.971

9.  Non-randomized mtDNA damage after ionizing radiation via charge transport.

Authors:  Xin Zhou; Xinguo Liu; Xin Zhang; Rong Zhou; Yang He; Qiang Li; Zhenhua Wang; Hong Zhang
Journal:  Sci Rep       Date:  2012-10-29       Impact factor: 4.379

10.  LORD-Q: a long-run real-time PCR-based DNA-damage quantification method for nuclear and mitochondrial genome analysis.

Authors:  Simon Lehle; Dominic G Hildebrand; Britta Merz; Peter N Malak; Michael S Becker; Peter Schmezer; Frank Essmann; Klaus Schulze-Osthoff; Oliver Rothfuss
Journal:  Nucleic Acids Res       Date:  2013-12-26       Impact factor: 16.971

View more
  7 in total

1.  Crucial role and mechanism of transcription-coupled DNA repair in bacteria.

Authors:  Binod K Bharati; Manjunath Gowder; Fangfang Zheng; Khaled Alzoubi; Vladimir Svetlov; Venu Kamarthapu; Jacob W Weaver; Vitaly Epshtein; Nikita Vasilyev; Liqiang Shen; Yu Zhang; Evgeny Nudler
Journal:  Nature       Date:  2022-03-30       Impact factor: 69.504

2.  ATAD3B is a mitophagy receptor mediating clearance of oxidative stress-induced damaged mitochondrial DNA.

Authors:  Li Shu; Chao Hu; Meng Xu; Jianglong Yu; He He; Jie Lin; Hongying Sha; Bin Lu; Simone Engelender; Minxin Guan; Zhiyin Song
Journal:  EMBO J       Date:  2021-03-05       Impact factor: 11.598

3.  Distribution of DNA damage in the human sperm nucleus: implications of the architecture of the sperm head.

Authors:  Silvia González-Rojo; Cristina Fernández-Díez; Marta Lombó; María Paz Herráez
Journal:  Asian J Androl       Date:  2020 Jul-Aug       Impact factor: 3.285

Review 4.  Modeling Neuroregeneration and Neurorepair in an Aging Context: The Power of a Teleost Model.

Authors:  Jolien Van Houcke; Valerie Mariën; Caroline Zandecki; Eve Seuntjens; Rajagopal Ayana; Lutgarde Arckens
Journal:  Front Cell Dev Biol       Date:  2021-03-18

5.  Relationships between male secondary sexual traits, physiological state and offspring viability in the three-spined stickleback.

Authors:  Violette Chiara; Alberto Velando; Sin-Yeon Kim
Journal:  BMC Ecol Evol       Date:  2022-01-07

6.  Changes of DNA Damage Effect of T-2 or Deoxynivalenol Toxins during Three Weeks Exposure in Common Carp (Cyprinus carpio L.) Revealed by LORD-Q PCR.

Authors:  Rubina Tünde Szabó; Mária Kovács-Weber; Krisztián Milán Balogh; Miklós Mézes; Balázs Kovács
Journal:  Toxins (Basel)       Date:  2021-08-19       Impact factor: 4.546

Review 7.  Lycium Barbarum: A Traditional Chinese Herb and A Promising Anti-Aging Agent.

Authors:  Yanjie Gao; Yifo Wei; Yuqing Wang; Fang Gao; Zhigang Chen
Journal:  Aging Dis       Date:  2017-12-01       Impact factor: 6.745

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.