| Literature DB >> 28693130 |
Luigia Cinque1, Angelo Sparaneo2, Filomena Cetani3, Michelina Coco2, Celeste Clemente4, Massimiliano Chetta5, Teresa Balsamo2, Claudia Battista6, Eliana Sanpaolo1, Elena Pardi3, Leonardo D'Agruma1, Claudio Marcocci3, Evaristo Maiello7, Geoffrey N Hendy8,9, David E C Cole10, Alfredo Scillitani6, Vito Guarnieri1.
Abstract
Inactivating mutations of the multiple endocrine neoplasia 1 (MEN1) gene cause MEN1 syndrome, characterized by primary hyperparathyroidism (pHPT), and parathyroid and gastro-entero-pancreatic pituitary tumors. At present, only 14 cases of malignant parathyroid tumor have been associated with the syndrome, with 6 cases carrying an inactivating mutation of the MEN1 gene. The present study presents the case of a 48-year-old female who presented with multigland pHPT and multiple pancreatic lesions. The patient underwent surgery several times for the excision of parathyroid hyperplasia, carcinoma and adenoma. The MEN1 gene was screened, revealing three variants (in cis) at the intron/exon 3 boundary (IVS2-3G>C, c.497A>T and c.499G>T) detected on the DNA of the proband, not shared by her relatives. RNA sequencing revealed that the IVS2-3C>G variant caused the skipping of the exon 3. Therefore, the present study reports on a novel rare association of MEN1 syndrome and parathyroid carcinoma. The reported splicing mutation was previously identified in subjects who always developed malignant lesions; thus, a possible genotype-phenotype association may be considered.Entities:
Keywords: MEN1; multiple endocrine neoplasia; parathyroid carcinoma
Year: 2017 PMID: 28693130 PMCID: PMC5494910 DOI: 10.3892/ol.2017.6162
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Figure 1.(A) Pedigree of the family under study. Clinical status is indicated by open symbols (unaffected or unknown) and filled symbols (affected). Filled quadrants indicate a diagnosis as explained in the inset legend. Histological diagnosis of carcinoma is indicated by #. A diagonal slash mark through a symbol indicates deceased. Proband is indicated by the arrow. The presence (+) or absence (−) of a mutation in tested family members is presented. (B) Detection of a mutation in the multiple endocrine neoplasia 1 gene. Direct sequence analysis of the exon 3 genomic amplicon of proband I-4 (middle) revealed heterozygous IVS2-3C>G, Q166L and A167S mutations compared with an unrelated healthy individual (top). All mutations are in cis, as confirmed by sequence analysis of the cloned mutant allele (bottom). The mutant nucleotides are boxed.
Biochemistry and histology parameters at the time of each surgery.
| Date | Caalb adj[ | PTH[ | 25-OH Vit D[ | Calciuria 24 h[ | Parathyroid histology |
|---|---|---|---|---|---|
| Oct 2004 | 11.04 | 190 | 18.3 | 11.10 | n/a |
| Oct 2005 (1st PTX) | 11.72 | 210 | 2 hyperplasias | ||
| Sep 2006 (2nd PTX) | 11.84 | 160 | Carcinoma | ||
| June 2007 (3rd PTX) | 12.83 | 107 | Adenoma |
Normal range, 8.1–10.4 mg/dl
normal range, 10–65 pg/ml
normal range, 20–40 ng/ml
normal value, 4.00 mg/kg/day. Glucose, insulin, gastrin, glucagon, prolactin, growth hormone and insulin-like growth factors were normal. Caalb adj, calcium albumin adjustment; PTH, parathyroid hormone; PTX, parathyroidectomy; 25-OH Vit D, 25-hydroxy vitamin D; n/a, not applicable.
Exonic primers for RT, Tm and size of the polymerase chain reaction product.
| Amplicon | 5′ to 3′ sequence | Tm, °C | Size, bp |
|---|---|---|---|
| RT-EX3 forward | ATGGGGCTGAAGGCCGCCCA | 55 | 782 |
| RT-EX3 reverse | TGCTGCAGCTGCAGAAGCTC |
Tm, annealing temperature; RT-EX3, reverse transcription exon 3.
Mutagenesis primers.
| Amplicon | 5′ to 3′ sequence[ |
|---|---|
| Q166L forward | TGTGGTTGGGGCCTGCCTGGCCCTGGGTCTCCGGG |
| Q166L reverse | CCCGGAGACCCAGGGCCAGGCAGGCCCCAACCACA |
| A167S forward | TGGTTGGGGCCTGCCAGTCCCTGGGTCTCCGGGAT |
| A167S reverse | ATCCCGGAGACCCAGGGACTGGCAGGCCCCAACCA |
| Q166-A167 forward | TGTGGTTGGGGCCTGCCTGTCCCTGGGTCTCCGGGAT |
| Q166-A167 reverse | ATCCCGGAGACCCAGGGACAGGCAGGCCCCAACCACA |
Mutated bases are underlined.
Figure 2.Characteristic neoplastic invasion of parathyroid carcinoma cells into adjacent vessels and gross invasion of the surrounding thyroid tissue. Staining, hematoxylin and eosin; magnification, ×20.
Figure 3.Effect of the MEN1 IVS2-3C>G mutation at the mRNA level. (A) Schematic of the MEN1 gene and menin mRNA. The 10 gene exons with introns (not drawn to scale) are shown with the initiation codon (ATG) in exon 2, the acceptor splice-site mutation at the intron 2/exon 3 boundary (black arrow), the two NLSs, and the stop codon (TGA) in exon 10. The menin mRNA includes exons 1–10 and the positions of primers used in exons 2 and 4 (RT-PCR product, 782 bp) are presented. (B) Gel electrophoresis of RT-PCR products following amplification of menin complementary DNA from blood RNA of individual II-4 of family 2 (Mut) or an unrelated normal individual (WT). DNA marker sizes are shown on the left. To the right, direct sequence analysis of the 782-bp WT and the 573-bp Mut products are presented. (C) The WT species corresponds to a product in which exon 2 is correctly spliced to exon 3, whereas the Mut species corresponds to an exon 2/exon 4 product in which exon 3 (209 bp) has been spliced out. MEN1, multiple endocrine neoplasia 1; mRNA, messenger RNA; NLS, nuclear localization signal; RT-PCR, reverse transcription-polymerase chain reaction; mut, mutated; WT, wild-type; M, marker.
Figure 4.(A) Menin Q166L and Q166L/A167S missense mutants are poorly expressed relative to WT menin. FLAG-tagged menin constructs (including the R415X poorly expressed control) were transfected into HEK293 cells, and after 48 h, cell lysates were subjected to western blot analysis with anti-FLAG, anti-Menin and anti-β-tubulin antibodies. In contrast to the aforementioned mutants, the A167S single mutant was as well expressed as WT menin. (B) Predicted three-dimensional structures of menin, wild-type (a) and mutant proteins (b-d). Panel a represents the wild-type form with the pocket domain (Asp136, Asp153, Leu177, Asp180, Pro245, Leu257, Tyr276, Met278, Asp285, Leu286, Glu288, Tyr319, Met322, Tyr323, Phe328, Glu363 and Glu366) highlighted in orange, the JunD binding domain (amino acids 1–40 and 139–242) in green and the suppressor of variegation 3–9 homolog 1 interaction domain (amino acids 360–445) in light blue. The point mutations Q166L and A167S are colored red. Panels b, c and d represent the protein structure inferred by inserting one or the other variant, or the two, respectively. In all cases, a decrease of the pocket domain surface involved in binding to the mixed-lineage leukemia 1 and JunD proteins was predicted. V, vector; WT, wild-type; JunD, transcription factor jun-D.