Literature DB >> 28679374

Development of a counterselectable seamless mutagenesis system in lactic acid bacteria.

Yongping Xin1, Tingting Guo1, Yingli Mu1, Jian Kong2.   

Abstract

BACKGROUND: Lactic acid bacteria (LAB) are receiving more attention to act as cell factories for the production of high-value metabolites. However, the molecular tools for genetic modifying these strains are mainly vector-based double-crossover strategies, which are laborious and inefficient. To address this problem, several counterselectable markers have been developed, while few of them could be used in the wild-type host cells without pretreatment.
RESULTS: The pheS gene encoding phenylalanyl-tRNA synthetase alpha subunit was identified in Lactococcus lactis NZ9000 genome. When mutant pheS gene (pheS*) under the control of the Lc. lactis NZ9000 L-lactate dehydrogenase promoter (Pldh) was expressed from a plasmid, the resulted PheS* with an A312G substitution rendered cells sensitive to the phenylalanine analog p-chloro-phenylalanine (p-Cl-Phe). This result suggested pheS* was suitable to be used as a counterselectable marker in Lc. lactis. However, the expression level of pheS* from a chromosomal copy was too low to confer p-Cl-Phe sensitivity. Therefore, a strategy of cascading promoters was attempted for strengthening the expression level of pheS*. Expectedly, a cassette 5Pldh-pheS* with five tandem repetitive promoters Pldh resulted in a sensitivity to 15 mM p-Cl-Phe. Subsequently, a counterselectable seamless mutagenesis system PheS*/pG+host9 based on a temperature-sensitive plasmid pG+host9 harboring a 5Pldh-pheS* cassette was developed in Lc. lactis. We also demonstrated the possibility of applying pheS* to be a counterselectable marker in Lactobacillus casei BL23.
CONCLUSIONS: As reported in E. coli, pheS* as a counterselectable marker has been demonstrated to be functional in targeted gene(s) deletion in Lc. lactis as well as in L. casei. Moreover, the efficiency and timesaving counterselectable seamless mutagenesis system PheS*/pG+host9 could be used in the wild-type host cells without pretreatment.

Entities:  

Keywords:  Counterselectable marker; Lactic acid bacteria; Seamless mutagenesis; Temperature-sensitive plasmid; pheS

Mesh:

Substances:

Year:  2017        PMID: 28679374      PMCID: PMC5499019          DOI: 10.1186/s12934-017-0731-8

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

Lactic acid bacteria (LAB) are important microorganisms used as starter cultures in the dairy fermented processes [1, 2]. Due to their generally recognized as safe status, some LAB strains have been used as cell factories or vaccine delivery vehicles for the heterogeneous production of specific compounds [3, 4] or pharmaceutical molecules [5-8]. Also, since the wealth of genomic data being delivered by massively parallel sequencing, interests in development of high-efficiency genome engineering tools for rerouting natural metabolic pathways to produce high valuable end products were increasing [9, 10]. Considering of the importance of the recombineering system in LAB, significant efforts have been recently concentrated on the exploitation of gene targeting techniques in LAB to accelerate genome engineering or gene functional analysis, as the recently reported single-stranded DNA recombineering (SSDR) system and double-stranded DNA recombineering (DSDR) system [11-13]. The SSDR system was established in Lactobacillus reuteri and Lactococcus lactis and could generate precision genome mutations without leaving any other foreign DNA [11]. The major limitation is the ability to achieve efficiencies that would allow the modification of any sites in the genome and easily recover the mutants without selection [14]. To address this problem, enhanced SSDR has been achieved with the assistant of the type-II clustered regularly interspaced short palindromic repeats locus from Streptococcus pyogenes in L. reuteri and >99.99% of non-recombinants could be eliminated without antibiotic selection [12]. But it could not be used for gene(s) deletion or insertion in other LAB because it has not proved the functional application of type-II CRISPR–Cas system in LAB except for L. reuteri. The DSDR technique was established in L. plantarum which was involved in the efficiently generation of gene(s) deletion or insertion [13]. However, this genetic system was not functional in other LAB and still left a lox72 site, a heterologous DNA sequence after the antibiotic selection marker excised from the genome. Seamless mutagenesis refers to targeted mutagenesis without any other micro-change, such as the presence of the selectable marker used to screen mutants or a loxP site after excising the selectable marker [15]. The seamless mutagenesis strategy usually appropriate for mutating the protein coding region in which any extraneous sequence introduced could interfere with protein expression. So far, several seamless mutagenesis methods based on homologous double-crossover have been successfully achieved in LAB, but the most widely used seamless mutagenesis strategy was based on a temperature-sensitive plasmid such as pG+host9 [16] or pG+host5 [17]. The merit of these plasmids is that both the non-replicate temperature at 37 °C and the replicate temperature at 28 °C are the adaptive temperature for the growth of most LAB. With plasmid pG+host9 [16], several chromosomal deletion derivatives of Lc. lactis and Streptococcus thermophilus were obtained in our laboratory [18-20]. However, these vectors, while powerful, suffer from a relatively low rate of recombination events and require labor-intensive screening procedures to distinguish clones with the desired seamless mutants. Therefore, improving the efficiency of this seamless mutagenesis system for fast analysis the function of gene(s) in LAB is very instant. In recent years, a two-step selection/counterselection strategy has been demonstrated to be functional in improving the efficiency of method for fast generating seamless mutagenesis in the genome, which is normally consist of a positive selectable marker (usually an antibiotic resistance gene) and a counterselectable cassette. Counterselectable markers, including the genes upp [21-23] and oroP [24], have been characterized and functionally analyzed. However, the counterselectable marker upp could not be made in wild-type LAB strains without pre-treatment while oroP has not been widely used for other LAB strains [21-24]. Recently, gene pheS encoding phenylalanyl-tRNA synthetase alpha subunit has been demonstrated to function as a host strain-independent counterselectable marker in Thermus thermophilus, Bacteroides sp., Escherichia coli and Streptococcus mutans [25-28], but has yet not been used in the model strain Lc. lactis. In E. coli, only an A294G substitution in the protein PheS altered the specificity of the phenylalanyl-tRNA synthetase which resulted in the sensitivity to phenylalanine analogs such as p-chloro-phenylalanine (p-Cl-Phe) [27]. In this study, we identified a conserved alanine residue in the PheS protein, and demonstrated that the dominant-negative mutant protein PheS* with an A312G amino acid substitution rendered cells sensitive to 15 mM p-Cl-Phe in Lc. lactis NZ9000 and 10 mM p-Cl-Phe in L. casei BL23. To employ this conditional lethal gene pheS* as a negative selectable marker, a high-efficiency seamless mutagenesis system PheS*/pG+host9 based on a temperature-sensitive plasmid pG+host9 carrying a 5Pldh-pheS* cassette was constructed in Lc. lactis NZ9000. The aim of this study is to explore the potential of using pheS* as a counterselectable marker for rapidly screening mutants for targeted gene analysis or genome engineering in LAB.

Methods

Plasmids, bacterial strains, and growth conditions

The plasmids and bacterial strains used in this study are shown in Table 1. E. coli DH5α was used as the host for cloning procedures and grown aerobically in Luria–Bertani (LB) medium at 37 °C. Unless otherwise specified, Lc. lactis and L. casei were grown statically at 30 °C in M17 (Oxoid) broth supplemented with 0.5% glucose (GM17) and at 37 °C in MRS (Oxiod) broth, respectively. For counterselection, semi-defined M9 plates [29] supplemented with 0.4% glucose, namely GM9 plates, were added with 15 mM p-Cl-Phe (Sigma) for Lc. lactis and 10 mM p-Cl-Phe (Sigma) for L. casei. If required, antibiotics were added as follows: 10 µg/ml erythromycin or 5 µg/ml chloramphenicol for Lc. lactis, 5 µg/ml erythromycin for L. casei, 10 µg/ml chloramphenicol, 100 µg/ml ampicillin and 300 µg/ml erythromycin for E. coli DH5α.
Table 1

Plasmids and bacterial strains used in this study

Strain or plasmidCharacteristic(s)Source
Strains
 Escherichia coli DH5αF supE44 ∆lacU169 Ф80lacZ ∆M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Novagen
 Lactococcus lactis strains
  NZ9000Derivative of MG1363, pepN::nisRK [33]
  IGnDerivative of NZ9000, galK::pG+UD-nP-pheS*This work
  dADerivative of NZ9000, ∆aldB This work
 Lactobacillus casei BL23Derivative of L. casei ATCC 393 (pLZ15)[36]
 Plasmids
  pG+host9Ermr; temperature-sensitive vector[16]
  pG+UDpG+host9 derivative with up and down homology arms of the part of galactose operonThis work
  pG+UD-nP-pheS*pG+UD derivative with pheS* driven by n Pldh This work
  pG+-nP-pheS*pG+host9 derivative with pheS* driven by n Pldh This work
  pG+UD2-5P-pheS*pG+-5P-pheS* derivative with upstream and downstream sequences of the aldB geneThis work
  pUC19Ampr; cloing vectorThis work
  pSec:Leiss:NucpWV01 replicon; expresses Nuc under PnisA control; Cmr [34]
  pleiss-P-pheS*pSec:Leiss:Nuc derivative with pheS* driven by a Pldh This work
  pTRKH2Ermr; expressing vector[37]
  pOgfpSource of gfp gene[18]
Plasmids and bacterial strains used in this study

Reagents and enzymes

All enzymes used in this study were purchased from TaKaRa. Restriction enzymes and T4 DNA ligases were used according to standard procedures. PCR amplicons for cloning purposes were generated by 2× PrimeSTAR max premix, and PCR reactions for screening purposes were performed with rTaq DNA polymerase. All oligonucleotides used in this study are listed in Table 2.
Table 2

Oligonucleotide primers used in this study

PrimerSequence (5′–3′)a Restriction site
aldB-uFAGGGTACCGGCGAAAGTCATGTAACAATCC KpnI
aldB-uRCTGACATGATATTTCTCTTTTCTAT
aldB-dRCCGCTCGAGTGCTGACAGATGGCTGGCTGTG XhoI
aldB-dFGAAAAGAGAAATATCATGTCAGTAATTGCTTAAATTTCTTTAGC
aldB-testFATATTTCTGCCACAATTTTCATGCC
aldB-testRCCAATCCTGTACCAATAACAGCAAT
pheSFATAAAAAATCGAAAAGGAGATAAAAATGAACTTACAAGAAAAAATTGAAG
pheSRAAAGATCTTCAGTCGAATTGTTCTAAGAATC BglII
pheSR2AAGAATTCTCAGTCGAATTGTTCTAAGAATC EcoRI
siteRACCAAAACCAGAATAAACAGAAG
siteFCTGTTTATTCTGGTTTTGGTTTTGGACTCGGTCAAGAACG
ldhF1CCGAATTCATTCATTTTACACATTGTA EcoRI
ldhF2GACAGATCTATTCATTTTACACATTGTA BglII
ldhF3AGACGTCGACATTCATTTTACACATTGTA SalI
ldhR1TTTTATCTCCTTTTCGATTTTTTAT
ldhR2CGGGATCCTTTTATCTCCTTTTCGATTTTTTAT BamHI
ldhR3CCGCTCGAGTTTTATCTCCTTTTCGATTTTTTAT XhoI
upFAGGGTACCATGTCAATAGTTGTCGAAAA KpnI
upRCAGTTTCTGCTAAGGTATCA
downFTGATACCTTAGCAGAAACTGATGAATTAGCACAGCAAGTG
downRCCGCTCGAGCTCTAGTAAAATGTTCCTCA XhoI
testFTTAAGGAAATGAATTTAGAGGAGAG
testRAAACCTTCATGTCCTTCTTGAGT
BL-pheSFAAAGATCTATGGATCTTCAAACCAAACTTG BglII
BL-siteRACCAAAACCGCCGTAAACGTC
BL-siteFGACGTTTACGGCGGTTTTGGTTTTGGCCTTGGTCCTGATCG
BL-pheSRGATCTGCAGTTAACCCTCCTGGCTGAATTGC PstI
gfpFATAAAAAATCGAAAAGGAGATAAAAAGATATGAGCAAAGGAG
gfpRCGCGAATTCTTAGTAGAGCTCATC EcoRI

aThe restriction sites in the primer sequences are underlined

Oligonucleotide primers used in this study aThe restriction sites in the primer sequences are underlined

Bioinformatic analysis

A multiple-sequence alignment was performed using Clustal X, version 2.0 [30] and ESPript 3.0 [31]. The amino acid sequences of PheS proteins from six LAB strains were aligned with the amino acid sequences of PheS proteins from E. coli [27] and E. faecalis [32].

Construction of the counterselectable system PheS*/pG+host9 in Lc. lactis

The counterselectable Pldh-pheS* cassette was constructed using an overlap extension PCR strategy. The constitutive promoter region of the l-lactate dehydrogenase gene (ldh) (accession number: NC_017949) in Lc. lactis NZ9000 [33] was amplified by PCR using primer pair ldhF1 and ldhR1. The pheS* gene was generated as two fragments by PCR using the Lc. lactis NZ9000 chromosomal DNA as a template with the primer pairs pheSF and siteR, siteF and pheSR, respectively. The point mutation responsible for p-Cl-Phe sensitivity was introduced by the primers siteF and siteR annealing internal to the wild-type pheS gene. There are overlapping regions among the three amplicons, which allowed an overlap extension PCR step using primers ldhF1 and pheSR to create Pldh-pheS* cassette. The generated 1270 bp Pldh-pheS* cassette was digested with EcoRI and BglII and ligated to the compatible sites of Lc. lactis/E. coli shuttle vector pSec:Leiss:Nuc [34], creating pleiss-P-pheS*. To investigate the feasibility of the counterselectable Pldh-pheS* cassette, the plasmid pleiss-P-pheS* was introduced into the competent cells of Lc. lactis NZ9000 by electroporation [35]. The recombinant strain Lc. lactis NZ9000/pleiss-P-pheS* was incubated in GM17 with 5 µg/ml chloramphenicol. Overnight cultures were tenfold serially diluted, and 5 µl of diluted solution were pipetted onto air dried GM9 plates containing 0, 5, 10, 15 mM p-Cl-Phe, the cell survival was measured.

Construction of plasmids pleiss-nP-gfp

To demonstrate whether cascading promoters could increase the gfp gene expression, a series of plasmids pleiss-nP-gfp carrying promoter clusters nPldh-gfp were constructed as follows: the gfp gene was PCR amplified using primers gfpF and gfpR from plasmid pOgfp [18]. the promoter Pldh and gfp gene were fused by an overlap extension PCR using primers ldhF2 and gfpR. The resulting product Pldh-gfp was digested with BglII and EcoRI and ligated into the corresponding sites of pSec:Leiss:Nuc [34] to create plasmid pleiss-P-gfp. The promoter Pldh was generated by PCR with primers ldhF2 and ldhR2, and the PCR product was digested with BglII and BamHI and inserted into the BglII site of pleiss-P-gfp to generate pleiss-2P-gfp. The same procedure was carried out to construct the plasmid pleiss-nP-gfp (n: the copy number of Pldh in the promoter clusters nPldh-gfp). Then, the above plasmids pleiss-nP-gfp were introduced into Lc. lactis NZ9000.

Fluorescence assay

Recombinant strains harboring the pleiss-nP-gfp were grown aerobically in 5 ml GM17 broth containing 5 µg/ml chloramphenicol at 30 °C. Samples for measurement were taken out after 12 h and harvested by centrifugation at 10,000×g for 3 min. After being resuspended twice with PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH7.4), 200 μl of bacterial suspension was transferred into a 96-well plate in which OD600 and fluorescence were read with excitation at 485 nm and emission at 528 nm using a Multi-Detection Microplate Reader, Synergy HT (BioTek). For each sample, three repetitions were performed with PBS buffer as a blank.

Construction of counterselectable cassettes nPldh-pheS* and plasmids pG+-nP-pheS*

To increase the expression of PheS* protein, a series of counterselectable cassettes, namely nPldh-pheS* were constructed as follows: the Pldh-pheS* cassette was PCR amplified using primer pair ldhF3 and pheSR2 from plasmid pleiss-P-pheS*. The resulting DNA fragment was digested with SalI and EcoRI and ligated into the corresponding sites of pUC19 to create plasmid pUC-P-pheS*. The promoter Pldh was generated by PCR with primers ldhF3 and ldhR3, and the PCR product was digested with XhoI and SalI and inserted into the SalI site of pUC-P-pheS* to generate pUC-2P-pheS. The same procedure was carried out to construct the plasmid pUC-nP-pheS (n: the copy number of Pldh in the nPldh-pheS* cassettes). To develop a counterselectable system in Lc. lactis, the above plasmids pUC-nP-pheS* were digested with SalI and EcoRI, and the generating nPldh-pheS* cassettes (Fig. 4a) were ligated to the SalI and EcoRI sites of pG+host9 to yield plasmid pG+-nP-pheS*.
Fig. 4

Assessment of the counterselection with nPldh-pheS* cassettes in Lc. lactis NZ9000. a Determination of the transcription strength of the nPldh-gfp promoter clusters by fluorescence analysis. b Structure of nPldh-pheS* cassettes used in this study. c Detection of the sensitivity of various integrants to 15 mM p-Cl-Phe. Lc. lactis IGn indicates a derivative of Lc. lactis NZ9000 in which the nPldh-pheS* cassette was inserted into the genomic DNA by a single-crossover process. A GM9 plates; B GM9 plates with 15 mM p-Cl-Phe. The letter of “n” means the copy number of Pldh

Functional analysis of the pG+-nP-pheS* in Lc. lactis

To knockout the 709 bp fragment of the galactose operon in Lc. lactis NZ9000, pG+UD-nP-pheS* was constructed as follows. Upstream with 1000 bp in size (amplified with primers upF and upR) and downstream with 1011 bp (amplified with primers downF and downR) homology arms were PCR amplified from the genomic DNA of Lc. lactis NZ9000 and spliced by an overlap extension PCR using primers upF and downR; Subsequently, the fused fragment was digested by KpnI and XhoI and inserted into the corresponding sites of the temperature-sensitive vectors pG+host9 [16] and pG+-nP-pheS*, resulting the plasmids pG+UD and pG+UD-nP-pheS*, respectively. The plasmid pG+UD and pG+UD-nP-pheS* were introduced into Lc. lactis NZ9000 to perform double-crossover homologous recombination as described previously [16]. Briefly, the recombinants were grown at 28 °C until OD600 0.8–1.0, then transferred to 37 °C for 2 h to allow the single-crossover integrants growth. Appropriate cultures were plated onto GM17 medium with 5 µg/ml erythromycin at 37 °C. Subsequently, the single-crossover integrants were cultured in GM17 medium without erythromycin at 28 °C for excision of the vector by a second crossover process. The cultures were then plated onto GM9 plates containing 15 mM p-Cl-Phe at 37 °C. The single-crossover integrants and double-crossover mutants were both verified utilizing primer pair testF and testR. To further confirm the function of pG+-5P-pheS*, the aldB gene encoding α-acetolactate decarboxylase was knocked out from the Lc. lactis NZ9000 genome using the above protocols. Primer pairs of aldB-uF/aldB-uR and aldB-dF/aldB-dR were utilized for amplifying the upstream and downstream homology arms, and fused by an overlap extension PCR. The resultant ~2.0 kb fragment was digested and inserted into the KpnI and XhoI sites of the vector pG+-5P-pheS*. Subsequently, the yielding pG+UD2-5P-pheS* was transferred into Lc. lactis NZ9000 to perform the double-crossover homologous recombination as described above. The mutant Lc. lactis dA was verified by PCR with the primer pair aldB-testF and aldB-testR, and the mutant genotype was also confirmed by sequence analysis (Biosune Company, Shanghai, China).

Extending this counterselectable marker pheS* to other LAB

To extend this counterselectable marker pheS* to other LAB, L. casei was selected as a host. The mutant gene pheS* was generated as two fragments by an overlap extension PCR using the L. casei BL23 [36] genomic DNA as a template with the primers BL-pheSF and BL-siteR, BL-pheSR and BL-siteF, respectively. The point mutation responsible for p-Cl-Phe sensitivity was PCR amplified by the primer pair BL-siteF and BL-siteR annealing internal to pheS gene. The generated pheS* was digested with PstI and BglII and ligated to the compatible sites of pTRKH2 [37], creating pTRKH2-pheS*. To investigate the feasibility of the counterselectable marker p heS*, the plasmid pTRKH2-pheS* was introduced into L. casei BL23 by electroporation [13]. The recombinant L. casei BL23/pTRKH2-pheS* was incubated into MRS with 5 µg/ml erythromycin. Overnight cultures were streaked onto a GM9 plate containing 10 mM p-Cl-Phe, the cell survival was measured.

Results

Bioinformatic analysis of PheS protein in selected LAB species

Previously, it was reported that only a point mutant pheS* gene encoding an A294G substitution in E. coli PheS [27] or an A312G substitution in Enterococcus faecalis PheS [32] resulted in the obviously sensitivity to the phenylalanine analog p-Cl-Phe. Hence, to identify the amino acid residue for site-directed mutagenesis, the amino acid sequences of PheS from Lc. lactis, L. casei, L. plantarum, L. brevis, L. rhamnosus and S. thermophilus were aligned with the amino acid sequences from E. coli and E. faecalis by Clustal X version 2.0 [30] and ESPript 3.0 [31]. As shown in Fig. 1, the amino acid residues A312 in Lc. lactis NZ9000, A312 in L. casei, A312 in L. plantarum, A312 in L. brevis, A312 in L. rhamnosus and A314 in S. thermophilus are strictly conserved compared to the residue A294 in E. coli [27] and A312 in E. faecalis [32], indicating that this alanine residue of PheS protein was highly conserved in LAB.
Fig. 1

A multiple-sequence alignment of PheS from a variety of distantly related species. Full length sequences of PheS were determined using Clustal X. The secondary structure of PheS in E. coli (PDB code: 3PCO) is shown at the top of each set of sequence. The conserved alanine residues mutated to generate p-Cl-Phe sensitivity were boxed with a thick line and indicated with a pentagram. α α-helix, β β-sheet, π π-helix, η 310-helix, TT β-turn

A multiple-sequence alignment of PheS from a variety of distantly related species. Full length sequences of PheS were determined using Clustal X. The secondary structure of PheS in E. coli (PDB code: 3PCO) is shown at the top of each set of sequence. The conserved alanine residues mutated to generate p-Cl-Phe sensitivity were boxed with a thick line and indicated with a pentagram. α α-helix, β β-sheet, π π-helix, η 310-helix, TT β-turn To verify the above putative result, we chose the amino acid residues A312 in Lc. lactis NZ9000 PheS for site-directed mutagenesis. The pheS gene (accession number: NC_009004) encoding phenylalanyl-tRNA synthetase alpha subunit was identified from the genome of Lc. lactis NZ9000. It was 1038 bp in size and composed of 345 amino acid residues. After precision mutation GCT to GGT by an overlap extension PCR strategy in codon 312 of the pheS gene, an A312G point mutation was introduced into the PheS protein, resulting a dominant-negative mutant protein PheS*. Moreover, we also tested the potential of A312G point mutation of PheS for counterselection in L. casei BL23.

Functional analysis of the counterselectable marker Pldh-pheS* in Lc. lactis

To test the feasibility of the gene pheS* as a counterselectable marker in Lc. lactis, it was driven constitutively by a strong promoter of l-lactate dehydrogenase gene (ldh) in Lc. lactis NZ9000. Subsequently, this resultant Pldh-pheS* cassette was inserted into the Lc. lactis/E. coli shuttle vector pSec:Leiss:Nuc, yielding the recombinant plasmid pleiss-P-pheS*. The schedule of construction of pleiss-P-pheS* was shown in Fig. 2.
Fig. 2

Construction of a vector for detecting the PheS*/pG+host9 counterselectable system. The wild-type pheS was changed to pheS* using an overlap extension PCR to introduce a point mutation of GCT to GGT. Pldh: the promoter region of the l-lactate dehydrogenase gene (ldh) (accession number: NC_017949) from Lc. lactis NZ9000

Construction of a vector for detecting the PheS*/pG+host9 counterselectable system. The wild-type pheS was changed to pheS* using an overlap extension PCR to introduce a point mutation of GCT to GGT. Pldh: the promoter region of the l-lactate dehydrogenase gene (ldh) (accession number: NC_017949) from Lc. lactis NZ9000 After introduction of the plasmid pleiss-P-pheS* into Lc. lactis NZ9000, the sensitivity of the recombinant Lc. lactis NZ9000/pleiss-P-pheS* was measured on the GM9 plates containing 0, 5, 10, 15 mM phenylalanine analog p-Cl-Phe, respectively. As shown in Fig. 3, Lc. lactis NZ9000/pleiss-P-pheS* grew well on the GM9 plate without p-Cl-Phe, while the growth was completely inhibited in the presence of 15 mM of p-Cl-Phe. But, unlike the Lc. lactis NZ9000/pleiss-P-pheS*, the growth of Lc. lactis NZ9000 equipped with the plasmid pSec:Leiss:Nuc as a control was not inhibited under the equivalent concentrations of p-Cl-Phe, indicating that the dominant-negative mutant protein PheS* is functional as a stringent counterselectable marker in the presence of 15 mM p-Cl-Phe.
Fig. 3

Detection of the sensitivity of Lc. lactis NZ9000/pleiss-P-pheS* to p-Cl-Phe. Wild-type Lc. lactis NZ900 carrying either an empty vector (pSec:Leiss:Nuc) or a Lc. lactis derivative carrying the Pldh-pheS* cassette (pleiss-P-pheS*) were cultivated overnight in GM9 plates containing the indicated concentration of p-Cl-Phe. This experiment was performed in triplicate with the similar results

Detection of the sensitivity of Lc. lactis NZ9000/pleiss-P-pheS* to p-Cl-Phe. Wild-type Lc. lactis NZ900 carrying either an empty vector (pSec:Leiss:Nuc) or a Lc. lactis derivative carrying the Pldh-pheS* cassette (pleiss-P-pheS*) were cultivated overnight in GM9 plates containing the indicated concentration of p-Cl-Phe. This experiment was performed in triplicate with the similar results

Creation of a counterselectable cassette 5Pldh-pheS* in Lc. lactis

The temperature sensitive plasmid pG+host9 was widely used for gene(s) deletion and insertion in LAB. Here, a counterselectable system PheS*/pG+host9 was constructed based on a pG+host9 carrying the fragment Pldh-pheS* from the plasmid pleiss-P-pheS*, and yielding pG+-P-pheS*. To investigate the feasibility of this vector for gene deletion, upstream and downstream homology arms of the 709 bp fragment of galactose operon were spliced and inserted into pG+host9 and pG+-P-pheS*, resulting pG+UD and pG+UD-P-pheS*. The single-crossover integrants Lc. lactis IG0 and Lc. lactis IG1 were both pipetted onto GM9 plates containing 15 mM p-Cl-Phe, respectively. Unfortunately, Lc. lactis IG1 was not completely inhibited by p-Cl-Phe. We supposed that this unexpected phenomenon might resulted from the low expression of PheS* protein from a chromosomal copy. To increase the expression level of pheS*, we firstly tested whether cascading promoters could be functional in Lc. lactis. A series of plasmids pleiss-nP-gfp carrying promoter clusters nPldh-gfp were constructed and introduced into the Lc. lactis NZ9000. To optimize the constructed nPldh-gfp promoter clusters, fluorescence intensity of each construct radiated from the green fluorescence protein after 12 h of aerobic incubation was determined. By analyzing the cell growth and relevant fluorescence of each recombinant strain, we found that the more copies of the Pldh promoter were present in the expression cassette, the higher the specific fluorescence was (Fig. 4a). This result indicated that cascading promoters could improve the expression level of gfp gene. Assessment of the counterselection with nPldh-pheS* cassettes in Lc. lactis NZ9000. a Determination of the transcription strength of the nPldh-gfp promoter clusters by fluorescence analysis. b Structure of nPldh-pheS* cassettes used in this study. c Detection of the sensitivity of various integrants to 15 mM p-Cl-Phe. Lc. lactis IGn indicates a derivative of Lc. lactis NZ9000 in which the nPldh-pheS* cassette was inserted into the genomic DNA by a single-crossover process. A GM9 plates; B GM9 plates with 15 mM p-Cl-Phe. The letter of “n” means the copy number of Pldh Subsequently, various copies of the Pldh were driven the expression of dominant-negative mutant protein PheS* (Fig. 4b). As shown in Fig. 4c, the increase of the Pldh copies in the nPldh-pheS* cassettes inserted into the chromosomal locus of the integrants resulted in the enhanced sensitivity to 15 mM p-Cl-Phe. When the pheS* gene expressed from five copies of the Pldh, the growth of Lc. lactis IG5 was substantially inhibited. Thus, we chose the 5Pldh-pheS* cassette as a negative selectable marker for development of a counterselectable seamless mutagenesis system PheS*/pG+host9 in Lc. lactis.

Functional analysis of the counterselectable system PheS*/pG+host9 in Lc. lactis

To verify the potential of the counterselectable system PheS*/pG+host9 in Lc. lactis NZ9000, a 709 bp fragment of the galactose operon was selected as a targeting region for deletion through the vector pG+UD-5P-pheS*. After p-Cl-Phe counterselection, 24 resistance colonies picked randomly on a GM9 plate containing 15 mM p-Cl-Phe were all double-crossover occurred and 10 out of them (approximately 42%) were shown to possess the expected mutant genotype by PCR determination and sequencing. The result was closed to the theoretical value (50%) since the target region of the galactose operon was not essential for the growth of Lc. lactis NZ9000 (Fig. 5a, b). Hence, we supposed that the 5Pldh-pheS* cassette based counterselectable system was functional in Lc. lactis NZ9000 to perform seamless gene deletion.
Fig. 5

Construction of the PheS*/pG+host9 counterselectable system in Lc. lactis NZ9000. a An effcient counterselectable system PheS*/pG+host9 used to create gene deletions in Lc. lactis NZ9000. The “pheS* cassette” indicates the pheS* gene under the control of five cascading Pldh. “up” and “down” indicate the upstream and downstream homology arms of the targeted region. “Erm” indicates the erythromycin resistant gene. “OriT” indicates the temperature sensitive origin of replication. b Twenty-four p-Cl-Phe-resistant colonies were amplified by PCR to screen for the deletion of 709 bp fragment of the galactose operon. The expected PCR fragment from the mutant type (∆) is approximately 2.0 kb, while the band from the wild-type (WT) is about 2.7 kb

Construction of the PheS*/pG+host9 counterselectable system in Lc. lactis NZ9000. a An effcient counterselectable system PheS*/pG+host9 used to create gene deletions in Lc. lactis NZ9000. The “pheS* cassette” indicates the pheS* gene under the control of five cascading Pldh. “up” and “down” indicate the upstream and downstream homology arms of the targeted region. “Erm” indicates the erythromycin resistant gene. “OriT” indicates the temperature sensitive origin of replication. b Twenty-four p-Cl-Phe-resistant colonies were amplified by PCR to screen for the deletion of 709 bp fragment of the galactose operon. The expected PCR fragment from the mutant type (∆) is approximately 2.0 kb, while the band from the wild-type (WT) is about 2.7 kb To further determine whether the counterselectable system PheS*/pG+host9 would be feasible for genome engineering, aldB gene which encodes for α-acetolactate decarboxylase catalyzing α-acetolactate to acetoin in the diacetyl biosynthesis in Lc. lactis was deleted by this system (Fig. 5a). Twenty-one colonies were selected randomly and detected by PCR amplification. The double-crossover events also occurred in 100%, and six out of them were the expected mutants (Fig. 6). This result indicated that the efficiency of screening double-crossover mutants was significantly improved compared with using pG+host9 alone in our laboratory previously [18].
Fig. 6

Generation of a seamless in-frame aldB deletion mutant. Twenty-one p-Cl-Phe-resistant colonies were amplified by PCR to screen for the deletion of the aldB gene (711 bp). The expected PCR fragment from the mutant type (∆) is approximately 2.0 kb, while the band from the wild-type (WT) is about 2.7 kb

Generation of a seamless in-frame aldB deletion mutant. Twenty-one p-Cl-Phe-resistant colonies were amplified by PCR to screen for the deletion of the aldB gene (711 bp). The expected PCR fragment from the mutant type (∆) is approximately 2.0 kb, while the band from the wild-type (WT) is about 2.7 kb

Potential of the counterselectable marker pheS* in other LAB

To test the feasibility of the gene pheS* as a counterselection marker in other LAB, the strain L. casei BL23 was selected as a host. After insertion of pheS* into pTRKH2 [37], the obtained plasmid pTRKH2-pheS* was introduced into L. casei BL23. Subsequently the sensitivity of the recombinant L. casei BL23/pTRKH2-pheS* to p-Cl-Phe was measured on the GM9 plates containing 10 mM p-Cl-Phe. As shown in Fig. 7, the recombinant L. casei BL23/pTRKH2 grew well on the GM9 plate containing 10 mM p-Cl-Phe, while the growth of L. casei BL23/pTRKH2-pheS* was obviously inhibited, indicating that the conditional-lethal mutant gene pheS* has the potential as a counterselectable marker in L. casei and other LAB.
Fig. 7

p-Cl-Phe sensitivity of L. casei strains. Wild-type L. casei BL23 carrying an empty shuttle vector (a) or a derivative carrying the pheS* (b) were cultivated overnight in GM9 plates containing 10 mM p-Cl-Phe at 37 °C

p-Cl-Phe sensitivity of L. casei strains. Wild-type L. casei BL23 carrying an empty shuttle vector (a) or a derivative carrying the pheS* (b) were cultivated overnight in GM9 plates containing 10 mM p-Cl-Phe at 37 °C

Discussion

In consideration of the increasing use in industrial and medical area, LAB are intensively studied on their genetics and metabolism [9, 10]. Therefore, efficient genome engineering tools are necessary for target gene(s) deletion or insertion for functional analysis or rerouting the metabolic flux [38]. In this study, a seamless negative selectable mutagenesis system PheS*/pG+host9 was developed. We also demonstrated its feasibility by constructing strains bearing the targeting seamless deletion of a 709 bp fragment in lactococcal galactose operon and aldB gene. Expectedly, the ratio of the double-crossover event was 100% after counterselection by p-Cl-Phe. To our knowledge, this is the first report that the mutated pheS allele can be used as a counterselection marker for efficient and rapid genomic engineering in Lc. lactis. Previously, the development of a pheS based counterselection system in Streptococcus mutans, which is a close relative to Lc. lactis, has been reported [28]. However, S. mutans is a pathogenic bacterium distributed in the dental caries and could not be applied in the food field and used as a cell factory [39]. We expected that combining the counterselectable marker pheS* with the traditional genetic tool pG+host9 [16] would overcome the bottleneck of laboriously screening of the double-crossover recombinants, and this system has greatly potential in genome engineering in LAB. Protein sequence analysis suggested that the alanine residue of PheS protein is highly conserved in LAB (Fig. 1). Here we have demonstrated the feasibility of pheS* as a counterselectable marker in Lc. lactic and L. casei, these results were consistent with the previously results in S. mutans and Enterococcus faecalis [28, 32]. Therefore, we speculated that the dominant-negative mutant gene pheS* might be widely used as a counterselectable marker in a variety of lactic acid bacterial species. However, the sensitivity of the cells to p-Cl-Phe was depended on strain specific manner, such as 15 mM p-Cl-Phe for Lc. lactis NZ9000, 20 mM p-Cl-Phe for S. mutans [28]. Hence, optimization of the PheS* expression is needed when employing pheS* as a counterselectable marker in other LAB strains [25, 28]. In this study, the PheS* protein under the control of a promoter Pldh has the ability of completely inhibiting the growth of Lc. lactis NZ9000 at 15 mM p-Cl-Phe, suggesting it is possible to use Pldh-pheS*cassette as a counterselectable marker in Lc. lactis. However, the growth of the recombinants with Pldh-pheS* inserted into the chromosomal locus was not completely inhibited by even higher concentration of p-Cl-Phe. This unexpected result means that the ratio of screening double-crossover recombinants would not be 100% after p-Cl-Phe counterselection. We speculated that this phenomenon was caused by low expression level of PheS* [28], because the copy number of Pldh-pheS* from the chromosomal locus was lower than that in the plasmid pleiss-P-pheS*. Lower yield of PheS* was insufficient to compete with the background expression of wild-type PheS to form complexes with phenylalanyl-tRNA synthetase beta subunit (PheT) [40]. In these cases, a strategy of cascading promoters [41] was employed to improve the expression level of protein PheS*. Surprisingly, when protein PheS* was driven simultaneously by five copies of the Pldh, the generating integrant Lc. lactis IG5 was substantially inhibited in the presence of 15 mM p-Cl-Phe and the ratio of screening double-crossover recombinants was 100%, suggesting recombination among the promoters was not occurred and the use of repeated Pldh promoters could not confer genetic instability [41]. This strategy provides a new idea to address the issue of the low expression of the exogenous protein(s) in LAB. Several strategies have been employed to fulfill the genome engineering in LAB by homologous double-crossover using a solely conditional replication plasmid [38] or combining with other counterselectable system, such as upp [22] or oroP [24] based cassettes. Compared with those methods, the negative selectable system PheS*/pG+host9 has several advantages. (1) It greatly simplifies the procedure for screening double-crossover recombinants. For example, taking only 2 days to screen double-crossover variants after the single-crossover integrants were subcultured at 28 °C. The ratio of the double-crossover recombinants was 100% after p-Cl-Phe counterselection. However, the ratio between the deletion and wild-type strains may not be the theoretical value (1:1), it can vary considerably depending on the function of gene(s) to be deleted. (2) To our knowledge, among all the reported counterselectable markers, only pheS* has the greatly potential to be widely utilized in wild-type LAB without pretreatment. In contrast to other counterselectable system, the variants required the counterselectable marker deficient strains, as in the case of upp [21-23] and oroP [24]. Recently, a new counterselection method for wild-type Lc. lactis genome engineering based on class IIa bacteriocin sensitivity was reported [42]. However, the li006Dlitation of this method to be widely used in LAB was the sensitivity to bacteriocins which would depend on the interaction between the listerial MpnC and the native PtnD [42]. (3) Strains without pheS* can naturally grow on GM9 medium with 15 mM p-Cl-Phe. This means 15 mM p-Cl-Phe has no side-effect on the growth of the expected mutants. Moreover, this mutagenesis system PheS*/pG+host9 allowed gene deletion without any genomic scarring [15] in Lc. lactis, as the case of the aldB gene. The generating genetically modified microorganisms (GMOs) [14] were seamless mutagenesis which means only leaving self-DNA in its native genome location [15]. Therefore, this system is useful in seamless gene deletions in industrial strains. However, this seamless mutagenesis system PheS*/pG+host9 remains challenging in large DNA fragment deletions or insertions. In this study, the limited length of the targeted DNA fragment was mostly from the low efficient homologous recombination mediated by RecA [17]. In consideration of the ratio of the double-crossover recombinants was 100% after p-Cl-Phe counterselection, the ideal goal for deletion or insertion of large DNA fragment is the new genome engineering tools responsible for targeted fragments replacement by selection and the 5Pldh-pheS* cassette responsible for selectable marker excision by counterselection [15].

Conclusions

A seamless mutagenesis system PheS*/pG+host9 based on a counterselectable marker pheS* and a temperature sensitive plasmid pG+host9 was developed in Lc. lactis. Moreover, this system can be used for rapidly constructing a seamless mutagenesis (deleted or inserted) strain. We also extended the counterselectable marker pheS* to L. casei. Although the feasibility of pheS* as a counterselectable marker used in other LAB remains to be demonstrated, we speculated that this conterselectable marker will accelerate the analysis of genes with unknown function and metabolic engineering research in LAB.
  39 in total

1.  Counterselection employing mutated pheS for markerless genetic deletion in Bacteroides species.

Authors:  Yasuhiro Kino; Haruyuki Nakayama-Imaohji; Masashi Fujita; Ayano Tada; Saori Yoneda; Kazuya Murakami; Masahito Hashimoto; Tetsuya Hayashi; Katsuichiro Okazaki; Tomomi Kuwahara
Journal:  Anaerobe       Date:  2016-09-14       Impact factor: 3.331

2.  Cloning-independent and counterselectable markerless mutagenesis system in Streptococcus mutans.

Authors:  Zhoujie Xie; Toshinori Okinaga; Fengxia Qi; Zhijun Zhang; Justin Merritt
Journal:  Appl Environ Microbiol       Date:  2011-09-23       Impact factor: 4.792

Review 3.  From field to fermentation: the origins of Lactococcus lactis and its domestication to the dairy environment.

Authors:  Daniel Cavanagh; Gerald F Fitzgerald; Olivia McAuliffe
Journal:  Food Microbiol       Date:  2014-11-11       Impact factor: 5.516

4.  Idiosyncrasy and identity in the prokaryotic Phe-system: crystal structure of E. coli phenylalanyl-tRNA synthetase complexed with phenylalanine and AMP.

Authors:  Inbal Mermershtain; Igal Finarov; Liron Klipcan; Naama Kessler; Haim Rozenberg; Mark G Safro
Journal:  Protein Sci       Date:  2011-01       Impact factor: 6.725

Review 5.  Metabolic pathway engineering in lactic acid bacteria.

Authors:  Michiel Kleerebezem; Jeroen Hugenholtz
Journal:  Curr Opin Biotechnol       Date:  2003-04       Impact factor: 9.740

Review 6.  Genetic tools for investigating the biology of commensal lactobacilli.

Authors:  Fang Fang; Paul W O'Toole
Journal:  Front Biosci (Landmark Ed)       Date:  2009-01-01

7.  A novel cell factory for efficient production of ethanol from dairy waste.

Authors:  Jianming Liu; Shruti Harnal Dantoft; Anders Würtz; Peter Ruhdal Jensen; Christian Solem
Journal:  Biotechnol Biofuels       Date:  2016-02-26       Impact factor: 6.040

Review 8.  Lactic acid bacteria as a cell factory for riboflavin production.

Authors:  Kiran Thakur; Sudhir Kumar Tomar; Sachinandan De
Journal:  Microb Biotechnol       Date:  2015-12-21       Impact factor: 5.813

9.  Efficient production and secretion of bovine beta-lactoglobulin by Lactobacillus casei.

Authors:  Stéphane Hazebrouck; Laetitia Pothelune; Vasco Azevedo; Gérard Corthier; Jean-Michel Wal; Philippe Langella
Journal:  Microb Cell Fact       Date:  2007-04-06       Impact factor: 5.328

10.  Improved seamless mutagenesis by recombineering using ccdB for counterselection.

Authors:  Hailong Wang; Xiaoying Bian; Liqiu Xia; Xuezhi Ding; Rolf Müller; Youming Zhang; Jun Fu; A Francis Stewart
Journal:  Nucleic Acids Res       Date:  2013-12-24       Impact factor: 16.971

View more
  10 in total

1.  CRISPR/Cas9-Assisted Seamless Genome Editing in Lactobacillus plantarum and Its Application in N-Acetylglucosamine Production.

Authors:  Ding Zhou; Zhennan Jiang; Qingxiao Pang; Yuan Zhu; Qian Wang; Qingsheng Qi
Journal:  Appl Environ Microbiol       Date:  2019-10-16       Impact factor: 4.792

2.  Targeted and Repetitive Chromosomal Integration Enables High-Level Heterologous Gene Expression in Lactobacillus casei.

Authors:  Yongping Xin; Yingli Mu; Jian Kong; Tingting Guo
Journal:  Appl Environ Microbiol       Date:  2019-04-18       Impact factor: 4.792

3.  d-Alanyl-d-Alanine Ligase as a Broad-Host-Range Counterselection Marker in Vancomycin-Resistant Lactic Acid Bacteria.

Authors:  Shenwei Zhang; Jee-Hwan Oh; Laura M Alexander; Mustafa Özçam; Jan-Peter van Pijkeren
Journal:  J Bacteriol       Date:  2018-06-11       Impact factor: 3.490

4.  Coupling the recombineering to Cre-lox system enables simplified large-scale genome deletion in Lactobacillus casei.

Authors:  Yongping Xin; Tingting Guo; Yingli Mu; Jian Kong
Journal:  Microb Cell Fact       Date:  2018-02-12       Impact factor: 5.328

5.  Identification and characterization of a moonlighting protein-enolase for surface display in Streptococcus thermophilus.

Authors:  Yingli Mu; Yongping Xin; Tingting Guo; Jian Kong
Journal:  Microb Cell Fact       Date:  2020-06-17       Impact factor: 5.328

6.  Advancing Genetic Tools in Streptococcus pneumoniae.

Authors:  Haley Echlin; Jason W Rosch
Journal:  Genes (Basel)       Date:  2020-08-20       Impact factor: 4.096

Review 7.  Genetic tools for the development of recombinant lactic acid bacteria.

Authors:  Jiapeng Wu; Yongping Xin; Jian Kong; Tingting Guo
Journal:  Microb Cell Fact       Date:  2021-06-19       Impact factor: 5.328

8.  A rapid and versatile tool for genomic engineering in Lactococcus lactis.

Authors:  Tingting Guo; Yongping Xin; Yi Zhang; Xinyi Gu; Jian Kong
Journal:  Microb Cell Fact       Date:  2019-01-31       Impact factor: 5.328

9.  pheS AG Based Rapid and Efficient Markerless Mutagenesis in Methylotuvimicrobium.

Authors:  Yongchuang Liu; Xiangrong He; Pingping Zhu; Minggen Cheng; Qing Hong; Xin Yan
Journal:  Front Microbiol       Date:  2020-03-31       Impact factor: 5.640

Review 10.  The Microbiome as a Therapeutic Target for Multiple Sclerosis: Can Genetically Engineered Probiotics Treat the Disease?

Authors:  Hannah M Kohl; Andrea R Castillo; Javier Ochoa-Repáraz
Journal:  Diseases       Date:  2020-08-30
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.