Literature DB >> 28673357

Strong epistatic and additive effects of linked candidate SNPs for Drosophila pigmentation have implications for analysis of genome-wide association studies results.

Jean-Michel Gibert1, Jorge Blanco2, Marlies Dolezal2, Viola Nolte2, Frédérique Peronnet1, Christian Schlötterer3.   

Abstract

BACKGROUND: The mapping resolution of genome-wide association studies (GWAS) is limited by historic recombination events and effects are often assigned to haplotype blocks rather than individual SNPs. It is not clear how many of the SNPs in the block, and which ones, are causative. Drosophila pigmentation is a powerful model to dissect the genetic basis of intra-specific and inter-specific phenotypic variation. Three tightly linked SNPs in the t-MSE enhancer have been identified in three D. melanogaster populations as major contributors to female abdominal pigmentation. This enhancer controls the expression of the pigmentation gene tan (t) in the abdominal epidermis. Two of the three SNPs were confirmed in an independent study using the D. melanogaster Genetic Reference Panel established from a North American population.
RESULTS: We determined the functional impact of SNP1, SNP2, and SNP3 using transgenic lines to test all possible haplotypes in vivo. We show that all three candidate SNPs contribute to female Drosophila abdominal pigmentation. Interestingly, only two SNPs agree with the effect predicted by GWAS; the third one goes in the opposite direction because of linkage disequilibrium between multiple functional SNPs. Our experimental design uncovered strong additive effects for the three SNPs, but we also found significant epistatic effects explaining up to 11% of the total variation.
CONCLUSIONS: Our results suggest that linked causal variants are important for the interpretation of GWAS and functional validation is needed to understand the genetic architecture of traits.

Entities:  

Keywords:  Additivity; Drosophila; Epistasis; Genetic architecture; Genome-wide associations studies (GWAS); Pigmentation

Mesh:

Year:  2017        PMID: 28673357      PMCID: PMC5496195          DOI: 10.1186/s13059-017-1262-7

Source DB:  PubMed          Journal:  Genome Biol        ISSN: 1474-7596            Impact factor:   13.583


Background

Over the past years, genome-wide association studies (GWAS) have become the method of choice to identify functionally relevant variation for a wide set of traits [1, 2]. Despite the increased resolution of GWAS, compared with experimental crosses, the mapping resolution is frequently not sufficiently high to map the causative variants. The haplotype blocks identified by GWAS often carry multiple variants and it is not clear how many of them and which ones are causative. Many approaches have been proposed to prioritize candidate single nucleotide polymorphisms (SNPs). While rather advanced approaches are available for protein-coding variants (e.g. SIFT, PolyPhen-2, MutationAssessor [3-5]), the characterization of regulatory SNPs suffers from low sequence conservation and incomplete knowledge about functionally important motives. The large number of candidate SNPs also precludes experimental inference of epistasis since the number of possible haplotypes scales exponentially with the number of loci. Indeed, only a few studies analyzed the fitness consequences of all combinations of small sets of mutations (reviewed in [6]). Consequently, the experimental validation of GWAS results is often confined to cell culture or knockdown of candidate genes. Drosophila pigmentation has a long tradition as model to study the genetic basis of phenotypic variation within and between species [7]. Pool-GWAS in three natural D. melanogaster populations identified three closely linked SNPs as major contributors to female abdominal pigmentation [8, 9]. These three SNPs are located within a 208-bp window of the t-MSE enhancer, which controls the expression of the pigmentation gene tan (t) in the abdominal epidermis [10]: X-9121129 (SNP1), X-9121094 (SNP2), and X-9120922 (SNP3) (Additional files 1 and 2: Table S1 and Figure S1). An independent study, which does not rely on Pool-Seq [11] of extreme phenotypes but analyzed individual isofemale lines, confirmed the importance of this regulatory region for natural variation in female abdominal pigmentation [12]. Using the D. melanogaster Genetic Reference Panel, which was established from a North American population, two of the SNPs identified by Pool-GWAS (SNP1, SNP2) were also detected [12]. Building on the previously identified GWAS signal in the regulatory region of the pigmentation gene tan (t), we performed the first in vivo characterization of all GWAS candidate SNPs in a quantitative trait locus (QTL) region. It could have been expected that a single causative variant was linked to two neutral SNPs. However, we find that all three candidate SNPs have strong additive and complex epistatic effects on pigmentation. Interestingly, only two agree with the effect predicted by GWAS; the third one goes in the opposite direction.

Results

We used transgenic lines to evaluate the functional impact of SNP1, SNP2, and SNP3. We constructed rescue transgenes, each containing the t-MSE with one of the eight combinations of the three SNPs fused to the hsp70 minimal promoter and the t complementary DNA (cDNA). Each transgene was inserted at the same genomic position using phiC31 integrase-based transgenesis [13]. The effect of the different SNP combinations on abdominal pigmentation was assessed in females with an otherwise identical genetic background, mutant for t (allele t [14]). The different genotypes showed pronounced pigmentation differences (Fig. 1, left). For a quantitative analysis of pigmentation differences, we analyzed 15 individuals for each genotype and quantified the pigmentation in segments A5, A6, and A7 on mounted abdominal segments (Additional file 3: Raw Data; Fig. 1, right). We detected clear differences between the genotypes, covering a similar phenotypic space as wild-type (WT) flies (Fig. 1). We determined the main effects of all SNPs and their interactions using ANOVA (Additional file 4: Table S2). All SNPs had very significant main effects in all segments (p < 0.001), explaining up to 71% of the total variance in pigmentation (Table 1). SNP1 had the strongest main effect, explaining 29–53% of the variation. Epistatic effects were considerably weaker accounting for 6–11% of the total variation. For all segments, a model with epistatic effects provided a significantly better fit to the data than a model with main effects only (p ≤ 0.001). The presence of epistatic effects in a regulatory element is in line with results for transcription factor binding sites [15].
Fig. 1

Effect of the three SNPs on abdominal pigmentation. Left: abdominal cuticles of the different genotypes carrying the eight possible combinations of the three tested SNPs (1, 2, and 3). A5, A6, and A7: abdominal segments 5, 6, and 7. Right: box plots of pigmentation of A5, A6, and A7 for the eight genotypes carrying all possible combinations of the three tested SNPs. The letters D and L correspond to the prediction of the GWAS studies (Dark or Light)

Table 1

Summary of the three-way ANOVAs (full factorial model) performed independently on segments A5, A6, and A7

A5A6A7
p valueEta Squared p valueEta Squared p valueEta Squared
1<0.0010.422<0.0010.533<0.0010.295
2<0.0010.059<0.0010.097<0.0010.132
3<0.0010.130<0.0010.081<0.0010.180
1 × 20.2060.004<0.0010.0250.3940.002
1 × 30.2600.003<0.0010.0320.0740.009
2 × 3<0.0010.0580.0130.010<0.0010.047
1 × 2 × 3<0.0010.044<0.0010.0420.0250.015

1, 2, and 3 in the first column correspond to SNP1, SNP2, and SNP3. P values for the different effects are indicated as well as Eta Squared, a measure of the effect size

Effect of the three SNPs on abdominal pigmentation. Left: abdominal cuticles of the different genotypes carrying the eight possible combinations of the three tested SNPs (1, 2, and 3). A5, A6, and A7: abdominal segments 5, 6, and 7. Right: box plots of pigmentation of A5, A6, and A7 for the eight genotypes carrying all possible combinations of the three tested SNPs. The letters D and L correspond to the prediction of the GWAS studies (Dark or Light) Summary of the three-way ANOVAs (full factorial model) performed independently on segments A5, A6, and A7 1, 2, and 3 in the first column correspond to SNP1, SNP2, and SNP3. P values for the different effects are indicated as well as Eta Squared, a measure of the effect size The effects of the three SNPs on the pigmentation were largely consistent across segments. Nevertheless, some differences between segments were noticed (Fig. 1, Table 1, Additional file 4: Table S2). SNP1 had the strongest main effect in A6 and the weakest main effect in A7, whereas the opposite was observed for SNP3. SNP2 had the strongest main effect in A7 and the weakest main effect in A5. The two-way interactions involving SNP1 were only significant in A6, while all other interactions were significant across all three segments (Table 1). We attribute this heterogeneity among segments to differences in expression of genes regulating tan. The transcription factors Abdominal-B and bric-à-brac (BAB1 and BAB2), which regulate abdominal pigmentation and are expressed at an increasing level along the anteroposterior axis in pupal epidermis [16, 17], are good candidates, although the polymorphic SNPs are not located in characterized binding sites. Importantly, not all Dark alleles predicted by GWAS increased pigmentation in our functional assays. While the Dark alleles of SNP1 and SNP3 increase pigmentation, the Dark allele of SNP2 has the opposite effect. Indeed, the darkest genotype corresponds to the combination D.L.D, whereas the lightest genotype corresponds to the opposite combination L.D.L. Thus, opposite to the predictions of three GWAS studies, SNP2 does not affect pigmentation in the same direction as the linked SNPs. A closer inspection of the underlying haplotype structure shows that despite the high recombination rate and large population size of D. melanogaster, the absence of the haplotypes with extreme pigmentation prevented the correct inference of the effects of the three causative SNPs [9].

Discussion

The functional impact of natural variants on a given trait is one of the most pressing questions in genetics. GWAS and QTL mapping studies substantially advanced our understanding of the contribution of genes at different, well-separated locations in the genome. Nevertheless, the analysis of linked variants has been severely limited by linkage disequilibrium. In this report, we use, to our knowledge for the first time, transgenesis to break up linkage disequilibrium among closely linked sites to determine their contribution to the trait of interest (pigmentation) and to study the underlying genetic architecture. Our result of all candidate SNPs of the tan locus contributing to the pigmentation demonstrates that multiple SNPs could be contributing to a single QTL. The current literature already indicates that this phenomenon may be not uncommon: several multiparent advanced intercrosses noted that a given QTL explained a significant fraction of the variation, but variants segregating in the corresponding region did not [18-21]. The authors interpreted this discrepancy as evidence for multiple functional alleles contributing to the trait [18-20]. Similarly, multiple alleles have been suggested to contribute to a given eQTL [22, 23]. The strongest independent support for multiple functional variants comes from a study on the Alcohol dehydrogenase (Adh) in D. melanogaster, where the authors divided the gene into three parts with multiple SNPs and showed that each part contributed to Adh expression [24]. Analyzing all eight possible combinations of the three adjacent functional intra-specific variants provided the first in vivo analysis of the genetic architecture of a regulatory module in a higher eukaryote. Although additive effects explain most of the trait variation, up to 11% of the variation arises from epistatic interactions between the three sites. The regulatory architecture of pigmentation is similar in the three abdominal segments, but some noticeable differences are present. The about tenfold difference in the variance, explained by epistatistic two-way interactions involving SNP1, results in a significant effect only in A6. In addition to cuticle pigmentation, tan is also involved in vision [14]. The expression of tan in photoreceptors is responsible for the hydrolysis of carcinine, a different substrate than Beta-alanyl-dopamine which is responsible for cuticle pigmentation [25, 26]. We anticipate that such other roles of tan could have their own regulatory architecture, which differs from the one of abdominal pigmentation. Our observations have direct implications for other GWAS studies: (1) consistent with a previous report concluding that complex traits are mainly governed by additive effects [27], we find that the main effects are much stronger than epistasis; (2) linkage disequilibrium between causal SNPs could result in predicting effects in the wrong direction. Very importantly, this is not an artifact limited to this specific case in Drosophila, it will apply to all GWAS studies [28]. The confounding effect of multiple causative alleles at the same locus has also been described for several other systems (e.g. [28, 29]).

Conclusion

We propose that the possibility of linked causal variation needs to receive more attention and emphasize the importance of experimental systems, such as fruit flies, which allow functional testing of candidate SNPs in vivo as well as the inference of the underlying genetic architecture.

Methods

Determination of the ancestral state

In order to determine the ancestral state of the SNPs, the t_MSE of D. melanogaster was aligned with those of D. simulans, D. sechellia, and D. yakuba using clustalw (http://www.genome.jp/tools/clustalw/). These sequences were obtained by blasting the t_MSE of D. melanogaster against the genomes of these species (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Drosophila strains and culture

Flies were reared on standard medium at 25 °C. y w flies were used as a source of genomic DNA. Targeted transgenesis was carried out using the line ZH-attP-86Fb (BL-24749), which harbors the attP landing site at the cytological location 86 F8. The tan mutant allele t was obtained from the Bloomington Drosophila Stock center (BL-19282).

Reporter constructs and targeted transgenesis

The MSE element was amplified by PCR using genomic DNA from y w flies (with primers MSE0-F and MSE0-R listed below) and cloned into the pGEMT-Easy vector (Promega). The resulting plasmid, pGEMT-MSE, was used as a template to generate MSE elements containing the different SNPs combinations following the site-directed plasmid mutagenesis technique (QuickChange™, [30]). The MSE element from the y w flies carries the nucleotides predicted to give a dark pigmentation for each of the three SNPs [8]. The primer pairs MSE1-F and MSE1R, MSE2-F and MSE2-R, and MSE3-F and MSE3-R (listed below) were used to mutate them into the nucleotides predicted to give a light pigmentation. A reporter construct, generated using restriction-enzyme-based strategies, was used to analyze MSE enhancer activity. This vector derives from the site-specific transformation vector pattB (kindly provided by Johannes Bischof) and carries the tan cDNA (RH41996, DGRC# 17763) as reporter gene. The different MSE elements were cloned upstream of the Hsp-70 minimal promoter and the tan cDNA. The resulting constructs were inserted at the same genomic location on the third chromosome via site-specific integration [13]. Such mini-genes where an enhancer is cloned just upstream the cDNA of the gene it drives have been previously fruitfully used as sensitive and quantitative read-out of enhancer function [31, 32].

Establishment of the stocks for the phenotyping

We established homozygous transgenic stocks by crossing the transgenic flies with balancer stocks. In order to homogenize the genetic background, the transgenic flies were backcrossed for ten generations to the stock ZH-attP-86Fb (BL-24749), which had been used for injections. The transgenes were followed by the red eye color from the functional w locus of the vector. The X-chromosome carrying a transgene with the phiC31 integrase was later replaced with an X-chromosome carrying the tan mutant allele (w t [14]), whereas the autosomes were maintained using balancer chromosomes. We checked by Sanger sequencing that the lines carried the right transgenes. We observed that flies mutant for tan and homozygous for the rescue transgenes had a very pronounced pigmentation, much darker than WT at 25 °C. We therefore phenotyped flies heterozygous for the transgene and homozygous for the t allele. These flies were obtained by crossing transgenic flies homozygous for the transgenes and for the t allele with the t stock.

Abdominal cuticle preparations

Four-day-old flies were stored for eight days in 75% ethanol. Abdomens were cut next to the dorsal midline and the abdominal cuticles were cleaned, dehydrated in 100% ethanol, and mounted in Euparal (Roth). Fifteen female flies were processed for each genotype condition.

Imaging of fly abdomens

Cuticle preparations were imaged with a binocular equipped with Leica DC480 digital camera using the Leica IM50 Image Manager software. An annular lamp was used to ensure homogeneous lighting. All pictures were taken in the same session and identical settings were used throughout the session. Pigmentation was quantified in A5, A6, and A7 hemisegments as the mean intensity using ImageJ software as previously reported [33]. For this, the hemisegments were delimited by hand and the function “measure” of ImageJ used. The obtained values were subtracted from 255 to get values comprised between 0 (white) and 255 (black).

Statistical analyses

All statistical analyses were performed with R 3.2.3 [34, 35]. A full factorial three-way ANOVA was performed with sum zero constraints (option contr.sum) and estimation of Type III SS with package “car.” Effect sizes were estimated as Eta Squared values, calculated as SSeffect/SSTotal.

List of primers used in the study

MSE0-F 5′ GCGTTCCAACACCCCGTCTAATCTA 3′ MSE0-R 5′ CACGATTTCCGTATTTGAAATAATA 3′ MSE1-F 5′ ATAATATATTTATATTCTGATTATT 3′ MSE1-R 5′ AATAATCAGAATATAAATATATTAT 3′ MSE2-F 5′ AATTATCCTAAGCCTTGATTCTATC 3′ MSE2-R 5′ GATAGAATCAAGGCTTAGGATAATT 3′ MSE3-F 5′ TCTAATTAGTATACATATTATGATC 3′ MSE3-R 5′ GATCATAATATGTATACTAATTAGA 3′ Information related to the three most significant SNPs involved in female abdominal pigmentation variation in segment A7 identified previously [8]. (DOCX 50 kb) Alignment of t_MSE from D. melanogaster, D. simulans, D. sechellia, and D. yakuba. (DOCX 108 kb) Pigmentation measures in segments A5, A6, and A7 for the eight genotypes analyzed in this study. 1 and 2 in the SNP columns correspond to D or L alleles, respectively. (XLSX 43 kb) ANOVAs performed independently on segments A5, A6, and A7 to test the effect of the three SNPs on pigmentation. (DOCX 101 kb)
  33 in total

1.  Alternative tasks of Drosophila tan in neurotransmitter recycling versus cuticle sclerotization disclosed by kinetic properties.

Authors:  Silvia Aust; Florian Brüsselbach; Stefanie Pütz; Bernhard T Hovemann
Journal:  J Biol Chem       Date:  2010-05-03       Impact factor: 5.157

Review 2.  Empirical fitness landscapes and the predictability of evolution.

Authors:  J Arjan G M de Visser; Joachim Krug
Journal:  Nat Rev Genet       Date:  2014-06-10       Impact factor: 53.242

3.  Molecular dissection of a major gene effect on a quantitative trait: the level of alcohol dehydrogenase expression in Drosophila melanogaster.

Authors:  L F Stam; C C Laurie
Journal:  Genetics       Date:  1996-12       Impact factor: 4.562

4.  Drosophila photoreceptors express cysteine peptidase tan.

Authors:  Stefanie Wagner; Christiane Heseding; Kamila Szlachta; John R True; Heino Prinz; Bernhard T Hovemann
Journal:  J Comp Neurol       Date:  2007-02-01       Impact factor: 3.215

5.  Reconciling Differences in Pool-GWAS Between Populations: A Case Study of Female Abdominal Pigmentation in Drosophila melanogaster.

Authors:  Lukas Endler; Andrea J Betancourt; Viola Nolte; Christian Schlötterer
Journal:  Genetics       Date:  2015-12-29       Impact factor: 4.562

6.  Constraints on eQTL Fine Mapping in the Presence of Multisite Local Regulation of Gene Expression.

Authors:  Biao Zeng; Luke R Lloyd-Jones; Alexander Holloway; Urko M Marigorta; Andres Metspalu; Grant W Montgomery; Tonu Esko; Kenneth L Brigham; Arshed A Quyyumi; Youssef Idaghdour; Jian Yang; Peter M Visscher; Joseph E Powell; Greg Gibson
Journal:  G3 (Bethesda)       Date:  2017-08-07       Impact factor: 3.154

Review 7.  Sequencing pools of individuals - mining genome-wide polymorphism data without big funding.

Authors:  Christian Schlötterer; Raymond Tobler; Robert Kofler; Viola Nolte
Journal:  Nat Rev Genet       Date:  2014-09-23       Impact factor: 53.242

8.  Biophysical fitness landscapes for transcription factor binding sites.

Authors:  Allan Haldane; Michael Manhart; Alexandre V Morozov
Journal:  PLoS Comput Biol       Date:  2014-07-10       Impact factor: 4.475

9.  Identifying Loci Contributing to Natural Variation in Xenobiotic Resistance in Drosophila.

Authors:  Michael A Najarro; Jennifer L Hackett; Brittny R Smith; Chad A Highfill; Elizabeth G King; Anthony D Long; Stuart J Macdonald
Journal:  PLoS Genet       Date:  2015-11-30       Impact factor: 5.917

10.  Phenotypic Plasticity through Transcriptional Regulation of the Evolutionary Hotspot Gene tan in Drosophila melanogaster.

Authors:  Jean-Michel Gibert; Emmanuèle Mouchel-Vielh; Sandra De Castro; Frédérique Peronnet
Journal:  PLoS Genet       Date:  2016-08-10       Impact factor: 5.917

View more
  8 in total

Review 1.  Polygenic Risk Scores in Clinical Psychology: Bridging Genomic Risk to Individual Differences.

Authors:  Ryan Bogdan; David A A Baranger; Arpana Agrawal
Journal:  Annu Rev Clin Psychol       Date:  2018-05-07       Impact factor: 18.561

2.  Natural variation in Drosophila shows weak pleiotropic effects.

Authors:  Eirini Christodoulaki; Viola Nolte; Wei-Yun Lai; Christian Schlötterer
Journal:  Genome Biol       Date:  2022-05-16       Impact factor: 17.906

3.  Pleiotropic effects of regulatory variation in tan result in correlation of two pigmentation traits in Drosophila melanogaster.

Authors:  Lukas Endler; Jean-Michel Gibert; Viola Nolte; Christian Schlötterer
Journal:  Mol Ecol       Date:  2018-06-29       Impact factor: 6.185

4.  bric à brac (bab), a central player in the gene regulatory network that mediates thermal plasticity of pigmentation in Drosophila melanogaster.

Authors:  Sandra De Castro; Frédérique Peronnet; Jean-François Gilles; Emmanuèle Mouchel-Vielh; Jean-Michel Gibert
Journal:  PLoS Genet       Date:  2018-08-01       Impact factor: 5.917

Review 5.  Genomics of Developmental Plasticity in Animals.

Authors:  Elvira Lafuente; Patrícia Beldade
Journal:  Front Genet       Date:  2019-08-07       Impact factor: 4.599

6.  Combinatorial and statistical prediction of gene expression from haplotype sequence.

Authors:  Berk A Alpay; Pinar Demetci; Sorin Istrail; Derek Aguiar
Journal:  Bioinformatics       Date:  2020-07-01       Impact factor: 6.937

7.  How to Reveal Magnitude of Gene Signals: Hierarchical Hypergeometric Complementary Cumulative Distribution Function.

Authors:  Bongsong Kim
Journal:  Evol Bioinform Online       Date:  2018-10-18       Impact factor: 1.625

8.  The genetic architecture of temperature adaptation is shaped by population ancestry and not by selection regime.

Authors:  Kathrin A Otte; Viola Nolte; François Mallard; Christian Schlötterer
Journal:  Genome Biol       Date:  2021-07-16       Impact factor: 13.583

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.