Pornpan Pumirat1, Muthita Vanaporn1, Usa Boonyuen2, Nitaya Indrawattana1, Amporn Rungruengkitkun1, Narisara Chantratita1,3. 1. Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand. 2. Department of Molecular Tropical Medicine and Genetics, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand. 3. Mahidol-Oxford Tropical Medicine Research Unit, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand.
Abstract
Burkholderia pseudomallei is an environmental saprophyte and the causative agent of melioidosis, a severe infectious disease prevalent in tropical areas, including southeast Asia and northern Australia. In Thailand, the highest incidence of melioidosis is in the northeast region, where saline soil and water are abundant. We hypothesized that B. pseudomallei develops an ability to thrive in saline conditions and gains a selective ecological advantage over other soil-dwelling microorganisms. However, little is known about how an elevated NaCl concentration affects survival and adaptive changes in this pathogen. In this study, we examined the adaptive changes in six isolates of B. pseudomallei after growth in Luria-Bertani medium containing different concentrations of NaCl at 37°C for 6 hr. The bacteria were then investigated for resistance to heat at 50°C and killing by hydrogen peroxide (H2 O2 ). In addition, flagellar production, biofilm formation, and the plaque formation efficiency of B. pseudomallei after culture in saline conditions were observed. In response to exposure to 150 and 300 mmol L-1 NaCl, all B. pseudomallei isolates showed significantly increased thermal tolerance, oxidative resistance, and plaque-forming efficiency. However, NaCl exposure notably decreased the number of B. pseudomallei flagella. Taken together, these results provide insight into the adaptations of B. pseudomallei that might be crucial for survival and persistence in the host and/or endemic environments with high salinity.
Burkholderia pseudomallei is an environmental saprophyte and the causative agent of melioidosis, a severe infectious disease prevalent in tropical areas, including southeast Asia and northern Australia. In Thailand, the highest incidence of melioidosis is in the northeast region, where saline soil and water are abundant. We hypothesized that B. pseudomallei develops an ability to thrive in saline conditions and gains a selective ecological advantage over other soil-dwelling microorganisms. However, little is known about how an elevated NaCl concentration affects survival and adaptive changes in this pathogen. In this study, we examined the adaptive changes in six isolates of B. pseudomallei after growth in Luria-Bertani medium containing different concentrations of NaCl at 37°C for 6 hr. The bacteria were then investigated for resistance to heat at 50°C and killing by hydrogen peroxide (H2 O2 ). In addition, flagellar production, biofilm formation, and the plaque formation efficiency of B. pseudomallei after culture in saline conditions were observed. In response to exposure to 150 and 300 mmol L-1 NaCl, all B. pseudomallei isolates showed significantly increased thermal tolerance, oxidative resistance, and plaque-forming efficiency. However, NaCl exposure notably decreased the number of B. pseudomallei flagella. Taken together, these results provide insight into the adaptations of B. pseudomallei that might be crucial for survival and persistence in the host and/or endemic environments with high salinity.
Burkholderia pseudomallei is a Gram‐negative pathogenic bacterium responsible for melioidosis in humans and animals. This saprophytic organism is found in soil, stagnant water, and rice paddies. Regions in which melioidosis is endemic include southeast Asia, particularly Thailand, and northern Australia (Cheng & Currie, 2005; Wuthiekanun, Smith, Dance, & White, 1995). Rice farmers are considered a high‐risk group for exposure to B. pseudomallei especially during the monsoonal and rainy season when there is a lot of mud and surface water in the rice fields (Chaowagul et al., 1989; Cheng & Currie, 2005; Inglis & Sagripanti, 2006; Wiersinga, van der Poll, White, Day, & Peacock, 2006). Infection mainly occurs by inoculation through skin abrasions or inhalation. The clinical features of melioidosis vary considerably, ranging from acute fulminant septicemia to chronic localized infection. In its acute form, death can occur within days of the onset of symptoms. However, the longest reported incubation period between initial acquisition of the organism and subsequent infection is a remarkable 62 years. Furthermore, a high rate of relapse has been recognized (Ngauy, Lemeshev, Sadkowski, & Crawford, 2005). Unfortunately, there is currently no effective vaccine available for the prevention of melioidosis. The treatment of melioidosis generally involves the antibiotics ceftazidime or carbapenem as B. pseudomallei exhibits resistance to several empiric antimicrobial therapies.In Thailand, the highest prevalence of B. pseudomallei and the highest incidence of melioidosis are in the northeast region, where saline soil and water are plentiful. The electrical conductivity of soil samples from northeast Thailand ranges from 4 to 100 dS/m, which is higher than that of normal soil from other regions (approximately 2 dS/m) (Development Department of Thailand). We hypothesized that B. pseudomallei may develop an ability to adapt to saline conditions and gain cross‐protection to other stress conditions. There is evidence of a link between high NaCl concentrations and an ability to survive in saline conditions in other closely related organisms, namely, the Burkholderia cepacia complex (BCC). These organisms are opportunistic pathogens of cystic fibrosis (CF) sufferers (Mahenthiralingam, Baldwin, & Vandamme, 2002; Vandamme et al., 1997) whose lung airways have an increased concentration of NaCl in the surface liquid (Widdicombe, 2001), approximately twofold higher than that of healthy lungs (Joris, Dab, & Quinton, 1993). The potential pathogenic role of B. pseudomallei in CF lung disease has also been reported (O'Carroll et al., 2003).Several studies have shown that exposure to NaCl can influence the adaptive survival and virulence of pathogenic bacteria. The relevance of this has been shown in Salmonella enterica serovar Typhimurium (12), Staphylococcus aureus (Park et al., 2012), and Listeria monocytogenes (Garner, James, Callahan, Wiedmann, & Boor, 2006), whereby bacteria cultured in medium‐containing high NaCl show increased heat tolerance (Park et al., 2012; Yoon, Park, Oh, Choi, & Yoon, 2013), antibiotic resistance (Yoon et al., 2013), and invasion ability into host cells (Garner et al., 2006; Yoon et al., 2013). Our previous study also showed that B. pseudomallei grown under salt stress displayed significantly greater resistance to the antibiotic ceftazidime (Pumirat et al., 2009). Salt‐treated B. pseudomallei exhibited greater invasion efficiency into the lung epithelial cell line A549 (Pumirat et al., 2010). However, only one B. pseudomallei isolate was used in our previous study and adaptive responses of B. pseudomallei to high NaCl concentrations remain largely unknown.In this study, we further investigated the adaptive response of six B. pseudomallei isolates grown in Luria–Bertani (LB) medium with different concentrations of NaCl for 6 hr at 37°C. The concentrations of NaCl used were 0, 150, and 300 mmol L−1 which are equivalent to 0, 15, and 30 dS/m, respectively. The bacteria under salt stress were then tested for heat resistance, oxidative susceptibility, swarm motility, flagellar production, and biofilm and plaque formation.
METHODS
Bacterial strains, growth, and salt treatment
Experiments were performed using six clinical isolates of B. pseudomallei: strains 153, 576, 1026b, 1530, 1634, and the reference strain K96243. All strains were obtained from clinical specimens of six patients presenting with melioidosis in northeast Thailand. The bacteria were generally maintained on LBagar at 37°C. To examine the effect of NaCl, B. pseudomallei was subcultured in NaCl‐freeLB broth and incubated at 37°C with shaking at 200 rpm overnight. The bacteria were then inoculated at a dilution of 1:10 into 10 ml of LB broth containing 0, 150, and 300 mmol L−1 NaCl and incubated at 37°C for 6 hr with shaking. The salt‐treated and untreated B. pseudomallei were adjusted to an OD600 of 0.15. A serial dilution was performed to determine the number of colony‐forming units (CFU) to obtain the starting number of bacteria.
Heat resistance assay
A heat stress resistance assay was performed as described previously (Vanaporn, Vattanaviboon, Thongboonkerd, & Korbsrisate, 2008) with some modifications. Briefly, B. pseudomallei cultured in LB medium containing different salt concentrations (0, 150, and 300 mmol L−1 NaCl) at 37°C for 6 hr were washed with phosphate‐buffered saline (PBS) and resuspended in PBS to an OD600 of 0.15. One milliliter of the bacterial suspension was then added into a prewarmed tube and incubated at 50°C for 15 min. Before and after heat challenge, bacterial survival was enumerated on LBagar plates after incubating at 37°C for 24 hr. The number of surviving bacteria was expressed as a percentage of the viable cells.% Survival = CFU (heat exposure) × 100/CFU (without heat exposure)
Oxidative stress assay
The survival of B. pseudomallei under oxidative conditions was determined by observing the number of viable bacteria after exposure to an oxidative agent. After 6 hr of culturing in LB medium containing different salt concentrations (0, 150, and 300 mmol L−1 NaCl), B. pseudomallei cells were harvested, washed, and resuspended in PBS. The bacterial concentration was adjusted to an OD600 of 0.15. Then, 100 μl of bacterial suspension was treated with H2O2 (at a final concentration of 1 μmol L−1) or left untreated at room temperature for 15 min. A 10‐fold dilution of treated and untreated bacteria was performed and plated on LBagar. After incubation at 37°C for 24 hr, colonies were counted. The number of colonies of treated bacteria was compared with that of untreated bacteria (without oxidant) and presented as the % bacterial survival.% Survival = CFU (with oxidant) × 100/ CFU (without oxidant)
Motility assay
A motility assay was undertaken using the swarm plate method as previously described (Deziel, Comeau, & Villemur, 2001). Briefly, B. pseudomallei were grown in LB broth with 0, 150, or 300 mmol L−1 NaCl for 6 hr at 37°C. Bacterial pellets were collected, washed, and adjusted in PBS to approximately 108 CFU/ml. Swarm plates were inoculated by placing 2 μl of the prepared inoculum onto the agar surface at the center of the plate. The diameter of the swarming motility zone was measured from the point of inoculation after incubation at 37°C for 24 hr.
Electron microscopic examination
The presence of B. pseudomallei flagella was examined using a transmission electron microscope. Fifty microliters of B. pseudomallei grown in LB broth with different salt concentrations was harvested and dropped onto parafilm. Formvar‐coated carbon grids were placed on top of the parafilm for 10 min to transfer the bacterial cells. The liquid was then carefully removed with filter paper. The samples were stained with 1% uranyl acetate for 10 min, then the liquid was removed again. The grid was dried at room temperature overnight. Bacteria were observed under a Hitachi Electron Microscope H‐7000 (Japan). The presence of bacterial flagella was recorded for 100 bacteria per condition.
RNA preparation and real‐time RT‐PCR
RNA was isolated from 6 hr culture of B. pseudomallei grown at 37°C by adding 10 ml of RNAprotect bacterial reagent (QIAGEN) to 5 ml of bacteria culture and incubating for 5 min at room temperature. Subsequently, total RNA was extracted from bacterial pellets using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions and treated with DNase (NEB, MA, USA) for 10 min at 37°C before use. Conventional PCR for 23S RNA gene was used to verify that there was no gDNA contamination in the DNase‐treated RNA samples. Real‐time RT‐PCR was performed for six genes (rpoE, groEL, htpG bopA, bopE, and bipD) using Brilliant II SYBR® Green QPCR Master Mix, one step (Agilent Technologies, Santa Clara, CA, USA) with following conditions: reverse transcription at 50°C for 30 min, enzyme activation at 95°C for 10 min, then 40 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 1 min, and melting curve analysis at 72°C for 1 min in a CFX96 Touch™ Real‐Time PCR Detection System (CA, USA). Real‐time RT‐PCR primers are listed in Table 1. Relative mRNA levels were determined by fold change in expression, calculated by 2−ΔΔCT using the relative mRNA level of 23S RNA, representing a house‐keeping gene expression, as a baseline for comparison.
Table 1
Oligonucleotide primers used in this study
Primers
Sequences (5′–3′)
Sources
RpoE 36
CTCCAAATACCACCGCAAGAT
(Korbsrisate et al., 2005)
RpoE 37
TATCCCTTAGTTGGTCCG
Gro1
AGGACGGCGACTTGCTTGT
(Vanaporn et al., 2008)
Gro2
TTCCAAGACCAGTCGACAAC
Htp1
TACAGCAACAAGGAAATCT
Htp2
CACTCCTCCTTCTTCATCA
BopA F
GTATTTCGGTCGTGGGAATG
(Pumirat et al., 2010)
BopA R
GCGATCGAAATGCTCCTTAC
BopE F
CGGCAAGTCTACGAAGCGA
BopE R
GCGGCGGTATGTGGCTTC G
BipD F
GGACTACATCTCGGCCAAAG
BipD R
ATCAGCTTGTCCGGATTGAT
23s F
TTTCCCGCTTAGATGCTTT
23s R
AAAGGTACTCTGGGGATAA
Oligonucleotide primers used in this study
Biofilm formation assay
Quantification of biofilm formation was performed using a microtiter plate assay as previously described (Leriche & Carpentier, 2000; Stepanovic, Vukovic, Dakic, Savic, & Svabic‐Vlahovic, 2000). Briefly, biofilm formation of B. pseudomallei was induced in trypticase soy broth at 37°C for 24 hr. After incubation, the adherent bacteria were washed using deionized water three times and fixed with 99% methanol for 15 min at room temperature. The bacteria were stained for 15 min with 1% crystal violet and solubilized with 33% (v/v) glacial acetic acid. The quantity of biofilm was measured at 630 nm using a microplate reader (Bio‐Rad). Each B. pseudomallei isolate was assayed in duplicate, using eight wells per experiment.
Plaque formation assay
Plaque‐forming efficiency was assessed as previously described (Pumirat et al., 2014). HeLa cells were infected with B. pseudomallei at a multiplicity of infection of 20 and incubated at 37°C with 5% CO2 for 2 hr. Thereafter, the infected cell monolayers were washed and replaced with medium‐containing kanamycin (250 μg/ml). The plates were incubated at 37°C in a humidified 5% CO2 atmosphere for 20 hr. Plaques were stained with 1% (w/v) crystal violet in 20% (v/v) methanol and counted by microscopy. Plaque‐forming efficiency was calculated by determining the number of plaques per CFU of bacteria added per well.
Statistical analysis
All assays were conducted in triplicate, and an unpaired t‐test of independent experiments was performed using the GraphPad Prism 6 program (STATCON). Results were considered significant at a p ≤ .05.
RESULTS
NaCl stress induces cross‐protection against heat and oxidative agents
Different growth rates may affect the number of viable bacteria under NaCl stress conditions. Therefore, prior to observing the effect of NaCl stress on cross‐protection against heat and oxidative agents, the individual growth of six clinical B. pseudomallei isolates (K96243, 153, 576, 1026b, 1530, and 1634) from six patients in northeast Thailand was compared in LB broth containing different NaCl concentrations. Strains K96243, 153, 576, and 1026b were selected as these have been used extensively as reference isolates, and sequence type data are available (K96253, ST10; 153, ST15, 576; ST 501 and 1026b; ST102). Strains 1530 and 1634 were isolated from blood samples of two cases in northeast Thailand and used for comparison. In our previous study, B. pseudomallei K96243 demonstrated growth impairment during culture in LB containing 470 mmol L−1 NaCl (Pumirat et al., 2010). In this study, we investigated the growth kinetics of six B. pseudomallei isolates in LB media containing 0, 150, or 300 mmol L−1 NaCl for 6 hr after incubation at 37°C. Similar growth curves were observed for the six isolates under conditions of 0, 150, and 300 mmol L−1 NaCl (Figure S1). Therefore, salt concentrations ranging from 0 to 300 mmol L−1 and a culture time of 6 hr were chosen for further investigations.To evaluate the effect of NaCl on heat resistance in B. pseudomallei, six B. pseudomallei isolates were cultured in LB broth with different concentrations of NaCl for 6 hr to reach the log phase of bacterial growth, followed by heating at 50°C for 15 min. Figure 1 shows the percentage of surviving bacteria and demonstrates a significant difference in heat resistance between B. pseudomallei isolates cultured in NaCl‐free medium and those cultured in LB with 150 mmol L−1 NaCl (p = .014 for K96243, p = .011 for 153, p = .028 for 576, p = .027 for 1026b, p = .011 for 1530, and p = .040 for 1634) or those cultured in LB with 300 mmol L−1 NaCl (p = .020 for K96243, p = .004 for 153, p < .001 for 576, p < .001 for 1026b, p < .001 for 1530, and p = .002 for 1634). In addition, the data also showed a significant difference in the percentage of bacterial survival between B. pseudomallei isolates cultured in LB supplemented with 150 and 300 mmol L−1 NaCl (p = .038 for K96243, p = .002 for 153, p = .001 for 576, p < .001 for 1026b, p = .002 for 1530, and p = .008 for 1634). The mean and standard deviation (SD) of bacterial survival in NaCl‐free medium of the six B. pseudomallei isolates after heat treatment were 2.2 ± 0.5%. By contrast, the mean and SDs of bacterial survival of the six isolates in medium containing 150 mmol L−1 and 300 mmol L−1 NaCl were 18.2 ± 2.9% and 67.9 ± 8.9%, respectively. These data clearly revealed that salinity is associated with increased resistance of B. pseudomallei to heat stress.
Figure 1
Resistance to heat of Burkholderia pseudomallei after growth in Luria–Bertani (LB) broth containing 0, 150, or 300 mmol L−1 NaCl. (a) Cell viability of B. pseudomallei K96243 before and after heat treatment at 50°C for 15 min. Colony‐forming units were enumerated on LB agar plates after incubation at 37°C for 24 hr. (b) Percent survival of six B. pseudomallei isolates after heat treatment at 50°C for 15 min. 100% viability corresponds to the colony‐forming unit count of unexposed bacteria. The data were obtained from at least three experiments. Error bars represent the standard deviation of the mean for experiments performed in triplicate
Resistance to heat of Burkholderia pseudomallei after growth in Luria–Bertani (LB) broth containing 0, 150, or 300 mmol L−1 NaCl. (a) Cell viability of B. pseudomallei K96243 before and after heat treatment at 50°C for 15 min. Colony‐forming units were enumerated on LBagar plates after incubation at 37°C for 24 hr. (b) Percent survival of six B. pseudomallei isolates after heat treatment at 50°C for 15 min. 100% viability corresponds to the colony‐forming unit count of unexposed bacteria. The data were obtained from at least three experiments. Error bars represent the standard deviation of the mean for experiments performed in triplicateActivation of the oxidative response during survival in salt stress has been reported for various bacteria (den Besten, Mols, Moezelaar, Zwietering, & Abee, 2009; Metris, George, Mulholland, Carter, & Baranyi, 2014). We investigated the effect of NaCl on oxidative susceptibility of six B. pseudomallei isolates grown in different NaCl concentrations. Equal numbers of salt‐treated and untreated B. pseudomallei were exposed to 1 μmol L−1 H2O2 for 15 min, and their survival on LBagar was determined (Figure 2). The percentage of surviving bacteria among the B. pseudomallei isolates grown in salt‐free medium in the presence of H2O2 was significantly lower than the bacteria exposed to salt at a concentration of 150 mmol L−1 NaCl (p = .046 for K96243, p = .039 for 153, p = .019 for 576, p = .027 for 1026b, p = .043 for 1530, and p = .014 for 1634), or those exposed to 300 mmol L−1 NaCl (p = .004 for K96243, p = .004 for 153, p < .001 for 576, p = .010 for 1026b, p = .011 for 1530, and p < .001 for 1634). These data also showed a significant difference in the percentage of bacterial survival between B. pseudomallei isolates cultured in LB medium supplemented with 150 mmol L−1 and 300 mmol L−1 NaCl under oxidative stress conditions (p = .010 for K96243, p = .004 for 153, p = .005 for 576, p = .046 for 1026b, p = .049 for 1530, and p < .001 for 1634). In the presence of H2O2, the mean survival rate of untreated B. pseudomallei isolates was 1.7 ± 0.6%, compared with 5.6 ± 1.2% for those exposed to 150 mmol L−1 NaCl and 12.7 ± 2.3% for those exposed to 300 mmol L−1 NaCl. These data indicated that preexposing bacteria to salt stress reduced susceptibility to H2O2 in B. pseudomallei.
Figure 2
Susceptibility to oxidative stress of six Burkholderia pseudomallei isolates grown in Luria–Bertani (LB) broth containing 0, 150, and 300 mmol L−1 NaCl. Susceptibility to killing by 1 μmol L−1 H2O2 was determined at 15 min. Surviving bacteria were enumerated on LB agar plates after incubation at 37°C for 24 hr and were expressed as the % survival. The data were obtained from three experiments. Error bars represent the standard deviation of the mean for three experiments
Susceptibility to oxidative stress of six Burkholderia pseudomallei isolates grown in Luria–Bertani (LB) broth containing 0, 150, and 300 mmol L−1 NaCl. Susceptibility to killing by 1 μmol L−1 H2O2 was determined at 15 min. Surviving bacteria were enumerated on LBagar plates after incubation at 37°C for 24 hr and were expressed as the % survival. The data were obtained from three experiments. Error bars represent the standard deviation of the mean for three experimentsThe response of B. pseudomallei to heat and oxidative stress has been reported to be dependent on various cellular components, including transcription factors, heat shock proteins, and virulent proteins (Jitprasutwit et al., 2014; Korbsrisate et al., 2005; Vanaporn et al., 2008). We therefore investigated whether NaCl affects the expression of the rpoE, groEL, htpG, bopA, bopE, and bipD. The rpoE, groEL, and htpG genes were selected because they code transcription factors or heat shock proteins that have previously been reported to be involved in heat and oxidative stress (Jitprasutwit et al., 2014; Korbsrisate et al., 2005; Vanaporn et al., 2008). The bopA, bopE, and bipD were T3SS genes which may be important for cell invasion (Gong et al., 2011; Muangsombut et al., 2008; Stevens et al., 2003). Real‐time RT‐PCR results showed that B. pseudomallei K96243 when exposed to NaCl (150 and 300 mmol L−1) exhibited increased expression of all tested genes, compared with bacteria grown under NaCl‐free conditions (Figure 3). These data suggested that NaCl is involved in increasing the expression of stress response proteins, which might be responsible for the enhanced resistance of B. pseudomallei to heat and oxidative stress.
Figure 3
Fold change of rpoE, gro, htpG, bopA, bopE, and bipD genes in Burkholderia pseudomallei K96243 grown in Luria–Bertani (LB) broth containing 0, 150, and 300 mmol L−1 NaCl. RNA of B. pseudomallei grown in LB broth with different NaCl concentrations for 6 hr was used for determination of gene expression by quantitative real‐time RT‐PCR using the Brilliant II SYBR
® Green QPCR Master Mix, one step (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's recommendation. Relative mRNA levels were determined by fold changes in expression, calculated by 2−ΔΔCT. 23S rRNA gene was used for normalization. Error bars represent the standard deviation of the means for experiments performed in triplicate
Fold change of rpoE, gro, htpG, bopA, bopE, and bipD genes in Burkholderia pseudomallei K96243 grown in Luria–Bertani (LB) broth containing 0, 150, and 300 mmol L−1 NaCl. RNA of B. pseudomallei grown in LB broth with different NaCl concentrations for 6 hr was used for determination of gene expression by quantitative real‐time RT‐PCR using the Brilliant II SYBR
® Green QPCR Master Mix, one step (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's recommendation. Relative mRNA levels were determined by fold changes in expression, calculated by 2−ΔΔCT. 23S rRNA gene was used for normalization. Error bars represent the standard deviation of the means for experiments performed in triplicate
NaCl decreases the expression of B. pseudomallei flagella
Motility is a crucial factor for bacterial pathogenesis. Using a microarray, we previously demonstrated that B. pseudomallei grown under high NaCl conditions exhibited downregulation of the flagella biosynthesis sigma factor gene “fliA” (bpsl3291) (Pumirat et al., 2010). Therefore, in this study, we further examined whether salt affects B. pseudomallei swarm motility. Six isolates of B. pseudomallei were grown in LB broth containing different concentrations of NaCl (0, 150, or 300 mmol L−1) for 6 hr, then equal numbers of bacteria for each isolate were used to inoculate swarm agar medium. After incubation at 37°C for 24 hr, the diameter of the swarming zone was measured (Figure S2). The mean and SDs of the swarming zone diameters of the six B. pseudomallei isolates were 23.7 ± 0.9, 21.8 ± 1.2, and 17.4 ± 1.6 mmol L−1 for bacteria exposed to 0, 150, and 300 mmol L−1 NaCl, respectively (Table 2).
Table 2
Effect of NaCl on the swarming motility of B. pseudomallei
B. pseudomallei isolates
Diameter of swarm zone (mmol L−1)
0 mmol L−1 NaCl
150 mmol L−1 NaCl
300 mmol L−1 NaCl
K96243
24.0 ± 7.0
21.3 ± 6.7
17.7 ± 7.2
153
27.3 ± 4.6
26.3 ± 5.5
23.5 ± 4.4
576
24.7 ± 7.6
24.0 ± 8.2
16.0 ± 9.5
1026b
22.0 ± 7.0
21.7 ± 7.2
19.0 ± 8.2
1530
23.3 ± 9.1
18.3 ± 5.5
16.3 ± 6.4
1634
20.7 ± 2.3
19.3 ± 3.1
11.7 ± 8.1
Data represent the mean ± SD of three experiments each performed in triplicate.
Effect of NaCl on the swarming motility of B. pseudomalleiData represent the mean ± SD of three experiments each performed in triplicate.To determine whether altered expression of the fliA gene affects bacterial flagella, we examined the number of flagella on the six B. pseudomallei isolates during growth under different salt conditions using an electron microscope. The results showed that the number of flagella decreased with increasing concentrations of NaCl (Figure S3). The number of flagella counted on 100 bacteria for each of the six isolates is shown in Table 3. The majority of B. pseudomallei isolates (70.7 ± 3.5%) grown in LB with 300 mmol L−1 NaCl showed no flagella. By contrast, only 38.0 ± 3.8% and 49.3 ± 4.3% of B. pseudomallei cultured in NaCl‐free and 150 mmol L−1 NaCl‐supplemented media, respectively, had no flagella. The number of unflagellated bacteria among the B. pseudomallei isolates grown in 300 mmol L−1 NaCl‐supplemented medium was therefore significantly higher than among those grown in salt‐free (p < .001) or 150 mmol L−1 NaCl‐supplemented medium (p = .003, respectively). This phenomenon indicated that salinity affects flagella production in B. pseudomallei.
Table 3
Effect of NaCl on the number of flagella expressed on Burkholderia pseudomallei
B. pseudomallei isolates
NaCl (mmol L−1)
% Bacteria with flagella
0
1–3
>3
K96243
0
36
50
14
150
52
36
12
300
76
24
0
153
0
36
52
12
150
52
28
20
300
60
40
0
576
0
24
42
24
150
32
60
8
300
76
24
0
1026b
0
36
56
8
150
44
56
0
300
80
20
0
1530
0
52
44
4
150
52
44
4
300
60
40
0
1634
0
44
52
4
150
64
32
4
300
72
24
4
Data represent the mean ± SD of three experiments each performed in triplicate. One hundred bacterial cells were counted to determine the number of flagella.
Effect of NaCl on the number of flagella expressed on Burkholderia pseudomalleiData represent the mean ± SD of three experiments each performed in triplicate. One hundred bacterial cells were counted to determine the number of flagella.
Effect of NaCl on B. pseudomallei biofilm formation
B. pseudomallei can produce biofilm, which may offer protection against hostile conditions such as antibiotic treatment, salinity, and immune responses (Cheng & Currie, 2005; Inglis & Sagripanti, 2006; Kamjumphol, Chareonsudjai, Chareonsudjai, Wongratanacheewin, & Taweechaisupapong, 2013). We therefore tested whether B. pseudomallei biofilm formation is affected by salt stress. Six isolates of B. pseudomallei were grown in LB broth with different concentrations of NaCl for 6 hr at 37°C prior to the induction of biofilm formation. The results in Table 4 demonstrate the biofilm formation capacity of each of the B. pseudomallei isolates. The mean OD values and SDs of the biofilm formation capacity of the B. pseudomallei isolates increased from 0.19 ± 0.01 to 0.24 ± 0.03 and then to 0.31 ± 0.03 when bacteria were grown in the presence of 0, 150, and 300 mmol L−1 NaCl, respectively. Although, each of the B. pseudomallei isolates tended to show increased biofilm formation when grown in the presence of NaCl compared with those grown in 0 mmol L−1 NaCl, we could not detect a significant difference in biofilm formation when comparing bacteria grown in the presence of 0, 150, and 300 mmol L−1 NaCl.
Table 4
Effect of NaCl on biofilm formation of Burkholderia pseudomallei
B. pseudomallei isolates
Corrected OD630 nm
0 mmol L−1 NaCl
150 mmol L−1 NaCl
300 mmol L−1 NaCl
K96243
0.16 ± 0.03
0.21 ± 0.07
0.23 ± 0.07
153
0.24 ± 0.12
0.33 ± 0.18
0.35 ± 0.18
576
0.14 ± 0.01
0.16 ± 0.02
0.22 ± 0.04
1026b
0.20 ± 0.07
0.35 ± 0.22
0.45 ± 0.27
1530
0.17 ± 0.04
0.18 ± 0.04
0.23 ± 0.03
1634
0.21 ± 0.03
0.23 ± 0.03
0.25 ± 0.01
Data represent the mean ± SD of three experiments each performed in triplicate.
Effect of NaCl on biofilm formation of Burkholderia pseudomalleiData represent the mean ± SD of three experiments each performed in triplicate.
NaCl affects B. pseudomallei plaque formation
B. pseudomallei is a facultative intracellular bacteria that harbors the ability for cell‐to‐cell spread (Kespichayawattana, Rattanachetkul, Wanun, Utaisincharoen, & Sirisinha, 2000), which is an important characteristic for pathogenesis. Previously, NaCl was found to increase expression of the Burkholderia secretion apparatus (Bsa) type III secretion system (T3SS), which involved a virulence‐associated interaction with the host cell (Pumirat et al., 2010). In particular, the translocon “BipB” and the secreted effector protein “Cif” homolog in B. pseudomallei were reported to induce cell‐to‐cell dissemination (Pumirat et al., 2014; Suparak et al., 2005). Hence, we investigated whether salt stress affects cell‐to‐cell spread of B. pseudomallei. Six B. pseudomallei isolates grown in LB with different concentrations of NaCl for 6 hr at 37°C were assessed for plaque formation. Figure 4a demonstrates plaque formation in the HeLa cell line induced by B. pseudomallei K96243 when grown in 0, 150, and 300 mmol L−1 NaCl. The mean and SD of the plaque‐forming efficiency of B. pseudomallei isolates grown in 300 mmol L−1 NaCl were 59.8 ± 2.8, compared with 41.7 ± 2.2 for bacteria grown in 150 mmol L−1 NaCl and 35.0 ± 2.7 for those grown in NaCl‐freeLB. All B. pseudomallei isolates grown in the presence of 300 mmol L−1 NaCl showed significantly increased plaque formation relative to bacteria cultured in NaCl‐free medium (p = .004 for K96243, p = .021 for 153, p = .002 for 576, p = .017 for 1026b, p = .032 for 1530, and p = .016 for 1634). Moreover, we also observed a significant difference in the plaque‐forming capacity of all B. pseudomallei isolates cultured in LB supplemented with 300 mmol L−1 NaCl compared with those cultured in 150 mmol L−1 NaCl (p = .027 for K96243, p = .029 for 153, p = .019 for 576, p = .033 for 1026b, p = .048 for 1530, and p = .042 for 1634). This finding indicated the influence of NaCl on B. pseudomallei pathogenesis.
Figure 4
Plaque formation by Burkholderia pseudomallei after growth in Luria–Bertani (LB) broth containing 0, 150, and 300 mmol L−1 NaCl. (a) Images of plaques formed by B. pseudomallei K96243. Representative images of HeLa cell monolayers after infection with B. pseudomallei K96243, which had been grown in LB broth containing 0, 150, or 300 mmol L−1 NaCl for 20 hr. (b) Plaque‐forming efficiency of six B. pseudomallei isolates. HeLa cells were infected with B. pseudomallei grown in LB broth containing 0, 150, or 300 mmol L−1 NaCl at a multiplicity of infection of 20. The infected cells were stained with crystal violet after 20 hr incubation. Plaque‐forming efficiency was calculated as the number of plaques × 100/number of colony‐forming units of bacteria added per well. Error bars represent the standard deviation of the means for experiments performed in triplicate
Plaque formation by Burkholderia pseudomallei after growth in Luria–Bertani (LB) broth containing 0, 150, and 300 mmol L−1 NaCl. (a) Images of plaques formed by B. pseudomallei K96243. Representative images of HeLa cell monolayers after infection with B. pseudomallei K96243, which had been grown in LB broth containing 0, 150, or 300 mmol L−1 NaCl for 20 hr. (b) Plaque‐forming efficiency of six B. pseudomallei isolates. HeLa cells were infected with B. pseudomallei grown in LB broth containing 0, 150, or 300 mmol L−1 NaCl at a multiplicity of infection of 20. The infected cells were stained with crystal violet after 20 hr incubation. Plaque‐forming efficiency was calculated as the number of plaques × 100/number of colony‐forming units of bacteria added per well. Error bars represent the standard deviation of the means for experiments performed in triplicate
DISCUSSION
B. pseudomallei is a saprophyte that can survive and multiply under different environmental conditions (Cheng & Currie, 2005; Dharakul & Songsivilai, 1999; White, 2003). It is a difficult microorganism to kill. It can inhabit harsh environments for many years, especially in endemic areas, including northeast Thailand (Wuthiekanun et al., 1995) where saline soil and water are abundant. B. pseudomallei was reported as potential opportunist pathogens of CFpatients (Mahenthiralingam et al., 2002; O'Carroll et al., 2003; O'Sullivan et al., 2011; Vandamme et al., 1997), who have a high concentration of NaCl in their lung airway surface liquid. Adaptive responses of Burkholderia species, including B. pseudomallei, to high salt conditions have been investigated previously (Inglis & Sagripanti, 2006; O'Quinn, Wiegand, & Jeddeloh, 2001; Pumirat et al., 2009, 2010), however, the mechanisms underlying these remain poorly understood. This study demonstrated the adaptive phenotypes of six B. pseudomallei isolates to NaCl in various concentrations. The concentrations of NaCl used in our experiments were in the range of salt concentrations found in the soil and water in northeast Thailand. We showed that adaptations under salt stress conditions were associated with cross‐protection against other environmental stresses, as well as increased pathogenicity.Our present study verified that the growth rate of six B. pseudomallei isolates in LB containing 0, 150, and 300 mmol L−1 NaCl remained constant. We therefore conducted our experiments within this range of concentrations. Although high salinity seems to be a disadvantage for B. pseudomallei, as high salt (≥470 mmol L−1 NaCl) diminished bacterial growth (Pumirat et al., 2010; Wang‐Ngarm, Chareonsudjai, & Chareonsudjai, 2014), B. pseudomallei would regularly encounter a high salinity environment in its physiological habitat. In this study, we demonstrated that NaCl enhanced the ability of B. pseudomallei to survive under heat and oxidative stress. Several studies in other bacteria, such as Bacillus cereus (den Besten et al., 2009), Bacillus subtilis (Volker, Mach, Schmid, & Hecker, 1992), and Escherichia coli (Gunasekera, Csonka, & Paliy, 2008), have also reported that activation of the salt stress response conferred cross‐protection against other stresses, that is, increased resistance to heat and H2O2. Recently, Yuan, Agoston, Lee, Lee, & Yuk, (2012) and Yoon et al., (2013) also showed that the heat resistance of Salmonella enterica was increased after exposure to NaCl. Moreover, it is evident that growing Vibrio harveyi in LB broth supplemented with 2% NaCl (34.2 mmol L−1) resulted in increased resistance to menadione killing compared with the same organism grown in normal LB broth (Vattanaviboon, Panmanee, & Mongkolsuk, 2003). It is possible that the salt stress adaptation may reflect the ability of these bacteria, including B. pseudomallei, to survive under hostile environmental conditions, such as high temperature and oxidative stress.As B. pseudomallei is an intracellular organism, it has the capability to survive in phagocytic cells (Allwood, Devenish, Prescott, Adler, & Boyce, 2011). While trafficking within macrophages, B. pseudomallei may be exposed to oxidative stress. Interestingly, Scott & Gruenberg (2011) reported that chloride and sodium ion channels play important roles in regulating the phagosomal environment through counter ion regulation and charge compensation of macrophages. Therefore, the salt content in the phagosome may promote bacterial resistance to oxidative stress and allow B. pseudomallei to survive within the host cell.These oxidative and heat protective effects of NaCl could be a result of the increased expression of stress response cellular components. The increased expression of the rpoE and groEL genes detected in this study was in agreement with previous reports for the B. pseudomallei transcriptome (Pumirat et al., 2010) and secretome (Pumirat et al., 2009) under high salinity conditions. The expression of groEL (bpss0477) and rpoE (bpsl2434) was upregulated in B. pseudomallei cultured in LB containing 320 mmol L−1 NaCl, by approximately 1.2‐ and 1.4‐fold, respectively, compared with B. pseudomallei cultured in 170 mmol L−1 NaCl at the 6‐hr time point (Pumirat et al., 2010). Indeed, the secretomic profile confirmed the presence of GroEL in the culture supernatant only after exposure to 320 mmol L−1 NaCl (Pumirat et al., 2009). Moreover, our results were consistent with the observation that inactivation of the rpoE operon increased susceptibility of B. pseudomallei to killing by menadione and H2O2 and high osmolarity (Korbsrisate et al., 2005). Furthermore, it has been demonstrated that rpoE regulated a heat‐inducible promoter of the rpoH gene in B. pseudomallei (Vanaporn et al., 2008). These data implied that RpoE plays an important role in the increased resistance of B. pseudomallei in response to heat and oxidative stress.Among the salt‐altered genes of B. pseudomallei K96243 (Pumirat et al., 2010), we previously detected downregulation of the flagella biosynthesis sigma factor fliA gene (bpsl3291), by approximately 1.5‐ and 1.2‐fold (at 3 and 6 hr, respectively), when B. pseudomallei was grown in medium supplemented with 320 mmol L−1 NaCl compared with 170 mmol L−1 NaCl. This observation led us to examine whether growth of B. pseudomallei under high salt conditions affected the production of flagella. Under electron microscopic examination (Table 3), we found that most B. pseudomallei isolates grown under high salt conditions (300 mmol L−1 NaCl) did not produce flagella, whereas the majority of B. pseudomallei isolates grown under lower salt concentrations (0 and 150 mmol L−1 NaCl) presented at least one flagellum. The decreased expression of motility genes due to salt stress has also been documented for other bacteria such as Sphingomonas sp. strain LH128 (Fida et al., 2012) and B. subtilis (Hoper, Bernhardt, & Hecker, 2006; Steil, Hoffmann, Budde, Volker, & Bremer, 2003). All six B. pseudomallei isolates exhibited a smaller mean diameter for their motility zone when cultured under high salt conditions (300 mmol L−1 NaCl), compared with culturing under salt‐free or low salt conditions (0 and 150 mmol L−1 NaCl). This observation implied that salt stress plays an important role in regulating the production of bacterial flagella. One possible explanation for this is that in order to cope with stressful environmental conditions the bacteria conserve energy by diminishing nonvital activities, such as motility, by reducing the production of flagella by decreasing the expression of the motility regulator gene.The ability to form a biofilm is important for B. pseudomallei to gain resistance to numerous environmental factors, including certain antibiotics and stresses (Cheng & Currie, 2005; Inglis & Sagripanti, 2006; Kamjumphol et al., 2013). Our study detected the increased ability of B. pseudomallei to form a biofilm when bacterial isolates were grown in medium supplemented with NaCl, compared with salt‐free medium (Table 4). This was consistent with the findings of Kamjumphol et al. who demonstrated that biofilm formation was increased when B. pseudomallei was grown in modified Vogel and Bonner's medium containing 0.85–1.7 mol L−1 NaCl (Kamjumphol et al., 2013). This indicated that B. pseudomallei responds to salt stress by producing a biofilm that could confer cross‐protection against other environmental stresses.Exposure to high salinity is likely to be associated with pathogenesis in B. pseudomallei. Previously, invasion of A549 cells was enhanced by culturing of B. pseudomallei K96243 in salt‐supplemented LB medium (Pumirat et al., 2010). Our results showed that when grown in the presence of NaCl, all six B. pseudomallei isolates exhibited significantly increased plague formation in HeLa cells (Figure 4). The elevated rate of cellular invasion in response to NaCl may increase the load of intracellular bacteria, contributing to cell‐to‐cell spread or enhance cell cytotoxicity. Several studies have demonstrated the requirement of the Bsa T3SS and type VI secretion system (T6SS) for the intracellular pathogenicity of B. pseudomallei (Burtnick et al., 2008, 2011; Lim et al., 2015; Shalom, Shaw, & Thomas, 2007; Stevens et al., 2002; Warawa & Woods, 2005). We postulate that these systems may participate in the enhanced plaque formation of B. pseudomallei observed after exposure to NaCl. However, further experiments are required to investigate this possibility.
CONCLUSIONS
In conclusion, our results demonstrated that high salt conditions modulate adaptive responses in B. pseudomallei isolates. These adaptive responses include increased thermal resistance, plaque formation, and decreased flagella and oxidative susceptibility. Similar results were observed in all six isolates tested; suggesting that salt stress induces a general, conserved response in B. pseudomallei. Our findings provide insight into how these bacteria persist in endemic environments abundant in saline soil and water, and may indicate the link between the establishment and pathogenesis of B. pseudomallei infection in CFpatients.
CONFLICT OF INTEREST
The authors declare that they have no competing interests.Click here for additional data file.Click here for additional data file.Click here for additional data file.
Authors: Heidy M W den Besten; Maarten Mols; Roy Moezelaar; Marcel H Zwietering; Tjakko Abee Journal: Appl Environ Microbiol Date: 2009-04-24 Impact factor: 4.792
Authors: Brian P O'Sullivan; Brenda Torres; Giuseppe Conidi; Sandra Smole; Cheryl Gauthier; Kendra E Stauffer; Mindy B Glass; Jay E Gee; David Blaney; Theresa L Smith Journal: Chest Date: 2011-07 Impact factor: 9.410
Authors: Tekle Tafese Fida; Philip Breugelmans; Rob Lavigne; Edith Coronado; David R Johnson; Jan Roelof van der Meer; Antonia P Mayer; Hermann J Heipieper; Johan Hofkens; Dirk Springael Journal: Appl Environ Microbiol Date: 2012-09-21 Impact factor: 4.792
Authors: Lan Gong; Meabh Cullinane; Puthayalai Treerat; Georg Ramm; Mark Prescott; Ben Adler; John D Boyce; Rodney J Devenish Journal: PLoS One Date: 2011-03-11 Impact factor: 3.240