Literature DB >> 28594322

Caspase-8 contributes to angiogenesis and chemotherapy resistance in glioblastoma.

Giulia Fianco1,2, Maria Patrizia Mongiardi3, Andrea Levi3, Teresa De Luca4, Marianna Desideri4, Daniela Trisciuoglio4, Donatella Del Bufalo4, Irene Cinà2, Anna Di Benedetto5, Marcella Mottolese5, Antonietta Gentile6,7, Diego Centonze6,7, Fabrizio Ferrè8, Daniela Barilà1,2.   

Abstract

Caspase-8 is a key player in extrinsic apoptosis and its activity is often downregulated in cancer. However, human Caspase-8 expression is retained in some tumors, including glioblastoma (GBM), suggesting that it may support cancer growth in these contexts. GBM, the most aggressive of the gliomas, is characterized by extensive angiogenesis and by an inflammatory microenvironment that support its development and resistance to therapies. We have recently shown that Caspase-8 sustains neoplastic transformation in vitro in human GBM cell lines. Here, we demonstrate that Caspase-8, through activation of NF-kB, enhances the expression and secretion of VEGF, IL-6, IL-8, IL-1beta and MCP-1, leading to neovascularization and increased resistance to Temozolomide. Importantly, the bioinformatics analysis of microarray gene expression data derived from a set of high-grade human gliomas, shows that high Caspase-8 expression levels correlate with a worse prognosis.

Entities:  

Keywords:  angiogenesis; cancer; cancer biology; cell biology; cell death; cell proliferation; human; mouse; signal transduction

Mesh:

Substances:

Year:  2017        PMID: 28594322      PMCID: PMC5464770          DOI: 10.7554/eLife.22593

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

The downregulation of apoptotic pathways is a hallmark of cancer (Hanahan and Weinberg, 2011). Caspase-8 is a central player in the apoptotic cascade triggered by death receptors stimulation (Juo et al., 1998); consistently, its expression (Pingoud-Meier et al., 2003) or its apoptotic activity (Cursi et al., 2006; Safa et al., 2008) are often reduced in cancer. The observation that Caspase-8 is retained in many tumors (reviewed in [Stupack, 2013]) suggests a dual role for Caspase-8 in cancer. The identification of several non-canonical functions of Caspase-8 that are independent of its enzymatic activity and of apoptosis, supports this idea. Indeed, Caspase-8 modulates cell adhesion and migration, suggesting that in cancer cells Caspase-8 may be rewired from apoptosis to alternative pathways that sustain tumor growth (reviewed in [Graf et al., 2014]). We recently demonstrated that Caspase-8 promotes the proliferation and neoplastic transformation of glioblastoma (GBM) cell lines (Fianco et al., 2016). Interestingly, large-scale gene expression approaches have demonstrated Caspase-8 upregulation in GBM compared to normal tissue; in particular, the mesenchymal subtype of GBMs is characterized by high Caspase-8 expression (Verhaak et al., 2010). The fatal nature of GBM is strongly associated with its extensive angiogenesis (Kargiotis et al., 2006), and with its capacity to infiltrate throughout the brain tissue and to resist to chemotherapy (Dunn et al., 2012). Tumor neoangiogenesis is strongly supported by an inflammatory microenvironment that also promotes the proliferation of tumor cells and the survival of malignant cells and alters responses to chemotherapeutic agents (Mantovani et al., 2008). Consistently, in vitro and in vivo studies have identified high levels of IL-8, IL-6 and IL-1beta in the conditioned media (CM) of several GBM cell lines and in microenvironment of clinical samples (reviewed in Yeung et al., [2013]). This often depends on overactive EGFR signalling, which stimulates NF-kB, AP-1 and cEBP transcription factors, thereby promoting the expression of IL-8 and IL-6 (Bonavia et al., 2012; Inda et al., 2010). The work of several laboratories has identified Caspase-8 as an activator of NF-kB in B cells downstream of antigen receptors (Su et al., 2005) and Toll-like receptors (Lemmers et al., 2007), as well as in T cells (Bidère et al., 2006). These observations, along with the pivotal role of NF-kB in modulating cytokine production, in shaping tumor microenvironment and in promoting angiogenesis and GBM progression (reviewed in Karin et al. [2002], Dunn et al. [2012], Yeung et al. [2013] and Nogueira et al. [2011]), prompted us to investigate whether high Caspase-8 expression in GBM promotes these functions.

Results and discussion

To investigate the possible role of Caspase-8 in GBM angiogenesis, we sub-cutaneously injected mice with matrigel-containing conditioned media (CM) from U87MG (U87) cells, in which Caspase-8 expression was genetically silenced (shC8) or not (shcontrol, named CTR) (as shown in Figure 1—figure supplement 1). Matrigel plugs containing CM from U87CTR induced a strong angiogenic response as evidenced by macroscopic analysis and haemoglobin content, similar to that detected in the positive control where VEGF has been added to the media. Importantly, matrigel plugs containing CM from U87 shC8 displayed a significant reduction of both angiogenesis in vivo and the haemoglobin content (Figure 1A and B).
Figure 1—figure supplement 1.

Caspase-8 mRNA and protein expression is efficiently silenced in shC8 and shC8#2 cell lines compared to CTR cells.

(A) Quantitative real-time RT-PCR for Caspase-8 mRNA on U87CTR (CTR), U87shC8 (shC8) and U87shC8#2 (shC8#2) cells. Relative qQuantities were calculated by normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates, each one performed in technical duplicate are shown as mean ± SD (***p<0.001). Three independent experiments were consistent. (B) Detection of Caspase-8 protein expression by western blot analysis of whole lysates of CTR, shC8 and shC8#2 cell lines.

DOI: http://dx.doi.org/10.7554/eLife.22593.008

Figure 1.

Caspase-8 expression promotes tumor growth and neoangiogenesis in vitro and in vivo.

(A, B) Caspase-8 expression promotes the ability of conditioned medium (CM) from U87 cells to induce neo-angiogenesis in vivo. Representative images illustrate the macroscopic analysis (A) and quantification of Hb content (B) of Matrigel plugs containing CM from Sh Control (CTR, n = 23) or Sh Caspase-8 (ShC8, n = 21) cells. The negative (Neg, n = 14) and positive (Pos, n = 20) controls contained heparin alone or heparin plus VEGF, respectively. The values of biological replicates (n) for each condition are shown as single dot, and are expressed as optical density (OD 540 nm)/g of the Matrigel plug. The Mann-Whitney test (independent samples) was used for statistical analyses. In all experiments, the volume of CM from different samples was normalized on the number of cells for each sample counted when CM was collected. (C) Comparison of the tumor size between U87 CTR and U87shC8 mouse xenografts. Quantitative analysis, by Kruskal-Wallis test with Bonferroni correction, of the volume of tumors measured at 3 and 6 weeks after cell injection. Each plot graphically shows the central location and scatter/dispersion of the values of each group: the line series in the rectangular-shaped boxes indicate the median value of the data and the end of the vertical lines indicate the minimum and the maximum data value. The means and their confidence intervals are shown in the diamond-shaped box. P-value was calculated according to the independent samples t-test. Each dot corresponds to the tumor value of one mouse. ***p<0.001. (D) The microvessel density, determined immunohistochemically by the means of an anti-CD31 antibody recognizing murine endothelial cells, evidenced the presence of a significantly higher number of vessels in CTR cells (evaluated as mean ± SD in CTR tumors) than in shC8 tumors (***p<0.001). Original magnification 40X, scale bar 50 µm.

DOI: http://dx.doi.org/10.7554/eLife.22593.003

Statistical analysis of quantitative real time RT-PCR Figure 1—figure supplement 1A.

DOI: http://dx.doi.org/10.7554/eLife.22593.004

Figure 1B Statistical analysis of the quantification of Hb content (Figure 1—figure supplement 2A, C). Statistical analysis of the quantification of HUVEC cells proliferation and of tubulogenesis.

DOI: http://dx.doi.org/10.7554/eLife.22593.005

Statistical analysis of tumor growth data from U87 and U87shC8 samples.

DOI: http://dx.doi.org/10.7554/eLife.22593.006

Statistical analysis of vessel content analysis from immunohystochemistry experiments (Figure 1D).

DOI: http://dx.doi.org/10.7554/eLife.22593.007

(A) Quantitative real-time RT-PCR for Caspase-8 mRNA on U87CTR (CTR), U87shC8 (shC8) and U87shC8#2 (shC8#2) cells. Relative qQuantities were calculated by normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates, each one performed in technical duplicate are shown as mean ± SD (***p<0.001). Three independent experiments were consistent. (B) Detection of Caspase-8 protein expression by western blot analysis of whole lysates of CTR, shC8 and shC8#2 cell lines.

DOI: http://dx.doi.org/10.7554/eLife.22593.008

(A) HUVEC proliferation evaluated after exposure for 72 hr to CM from Sh Control (CTR) or Sh Caspase-8 (ShC8) cells. Endothelial cells incubated in serum free medium (neg) or complete medium (pos) were used as negative or positive control, respectively. The results represent the mean ± SD. Error bars represent a SD between two independent experiments, each of them performed in six replicates. Student’s t test was used for statistical analyses. (B) Representative images of Capillary Tube-Like Network Formation Assay and quantification of sprouts formation, estimated by measuring the cumulative length of the sprouts (C), on Matrigel. Bar scale: 100 μm. Endothelial cells incubated in serum free medium (neg) or complete medium (pos) were used as negative or positive control, respectively. The values were expressed as mean of cumulative length of the sprouts ± SD. Error bars represent a SD among biological duplicates, with at least four technical replicates each, of a representative experiment. Student’s t test was used for statistical analyses. In all experiments, the volume of CM from different samples was normalized on the number on cells for each sample counted when CM was collected.

DOI: http://dx.doi.org/10.7554/eLife.22593.009

Caspase-8 expression promotes tumor growth and neoangiogenesis in vitro and in vivo.

(A, B) Caspase-8 expression promotes the ability of conditioned medium (CM) from U87 cells to induce neo-angiogenesis in vivo. Representative images illustrate the macroscopic analysis (A) and quantification of Hb content (B) of Matrigel plugs containing CM from Sh Control (CTR, n = 23) or Sh Caspase-8 (ShC8, n = 21) cells. The negative (Neg, n = 14) and positive (Pos, n = 20) controls contained heparin alone or heparin plus VEGF, respectively. The values of biological replicates (n) for each condition are shown as single dot, and are expressed as optical density (OD 540 nm)/g of the Matrigel plug. The Mann-Whitney test (independent samples) was used for statistical analyses. In all experiments, the volume of CM from different samples was normalized on the number of cells for each sample counted when CM was collected. (C) Comparison of the tumor size between U87 CTR and U87shC8 mouse xenografts. Quantitative analysis, by Kruskal-Wallis test with Bonferroni correction, of the volume of tumors measured at 3 and 6 weeks after cell injection. Each plot graphically shows the central location and scatter/dispersion of the values of each group: the line series in the rectangular-shaped boxes indicate the median value of the data and the end of the vertical lines indicate the minimum and the maximum data value. The means and their confidence intervals are shown in the diamond-shaped box. P-value was calculated according to the independent samples t-test. Each dot corresponds to the tumor value of one mouse. ***p<0.001. (D) The microvessel density, determined immunohistochemically by the means of an anti-CD31 antibody recognizing murine endothelial cells, evidenced the presence of a significantly higher number of vessels in CTR cells (evaluated as mean ± SD in CTR tumors) than in shC8 tumors (***p<0.001). Original magnification 40X, scale bar 50 µm. DOI: http://dx.doi.org/10.7554/eLife.22593.003

Caspase-8 mRNA is efficiently silenced in shC8 and shC8#2 cell lines compared to CTR cells.

Statistical analysis of quantitative real time RT-PCR Figure 1—figure supplement 1A. DOI: http://dx.doi.org/10.7554/eLife.22593.004

Caspase-8 expression promotes the ability of conditioned medium (CM) from U87 cells to induce neo-angiogenesis

Figure 1B Statistical analysis of the quantification of Hb content (Figure 1—figure supplement 2A, C). Statistical analysis of the quantification of HUVEC cells proliferation and of tubulogenesis.
Figure 1—figure supplement 2.

Caspase-8 expression promotes the ability of conditioned medium from U87 cells to induce endothelial cells proliferation and Capillary Tube-Like Network Formation.

(A) HUVEC proliferation evaluated after exposure for 72 hr to CM from Sh Control (CTR) or Sh Caspase-8 (ShC8) cells. Endothelial cells incubated in serum free medium (neg) or complete medium (pos) were used as negative or positive control, respectively. The results represent the mean ± SD. Error bars represent a SD between two independent experiments, each of them performed in six replicates. Student’s t test was used for statistical analyses. (B) Representative images of Capillary Tube-Like Network Formation Assay and quantification of sprouts formation, estimated by measuring the cumulative length of the sprouts (C), on Matrigel. Bar scale: 100 μm. Endothelial cells incubated in serum free medium (neg) or complete medium (pos) were used as negative or positive control, respectively. The values were expressed as mean of cumulative length of the sprouts ± SD. Error bars represent a SD among biological duplicates, with at least four technical replicates each, of a representative experiment. Student’s t test was used for statistical analyses. In all experiments, the volume of CM from different samples was normalized on the number on cells for each sample counted when CM was collected.

DOI: http://dx.doi.org/10.7554/eLife.22593.009

DOI: http://dx.doi.org/10.7554/eLife.22593.005

Caspase-8 expression promotes tumor growth in mouse xenograft experiments.

Statistical analysis of tumor growth data from U87 and U87shC8 samples. DOI: http://dx.doi.org/10.7554/eLife.22593.006

Caspase-8 expression promotes neovascularization in vivo.

Statistical analysis of vessel content analysis from immunohystochemistry experiments (Figure 1D). DOI: http://dx.doi.org/10.7554/eLife.22593.007

Caspase-8 mRNA and protein expression is efficiently silenced in shC8 and shC8#2 cell lines compared to CTR cells.

(A) Quantitative real-time RT-PCR for Caspase-8 mRNA on U87CTR (CTR), U87shC8 (shC8) and U87shC8#2 (shC8#2) cells. Relative qQuantities were calculated by normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates, each one performed in technical duplicate are shown as mean ± SD (***p<0.001). Three independent experiments were consistent. (B) Detection of Caspase-8 protein expression by western blot analysis of whole lysates of CTR, shC8 and shC8#2 cell lines. DOI: http://dx.doi.org/10.7554/eLife.22593.008

Caspase-8 expression promotes the ability of conditioned medium from U87 cells to induce endothelial cells proliferation and Capillary Tube-Like Network Formation.

(A) HUVEC proliferation evaluated after exposure for 72 hr to CM from Sh Control (CTR) or Sh Caspase-8 (ShC8) cells. Endothelial cells incubated in serum free medium (neg) or complete medium (pos) were used as negative or positive control, respectively. The results represent the mean ± SD. Error bars represent a SD between two independent experiments, each of them performed in six replicates. Student’s t test was used for statistical analyses. (B) Representative images of Capillary Tube-Like Network Formation Assay and quantification of sprouts formation, estimated by measuring the cumulative length of the sprouts (C), on Matrigel. Bar scale: 100 μm. Endothelial cells incubated in serum free medium (neg) or complete medium (pos) were used as negative or positive control, respectively. The values were expressed as mean of cumulative length of the sprouts ± SD. Error bars represent a SD among biological duplicates, with at least four technical replicates each, of a representative experiment. Student’s t test was used for statistical analyses. In all experiments, the volume of CM from different samples was normalized on the number on cells for each sample counted when CM was collected. DOI: http://dx.doi.org/10.7554/eLife.22593.009 In agreement with this finding, CM from U87shC8 cells was 2.5-fold less potent in triggering the proliferation of Human Umbilical Vein Endothelial Cells (HUVECs) compared to CM from U87CTR cells (Figure 1—figure supplement 2). Moreover, when exposed to CM from U87CTR cells, HUVECs formed tube-like structures resembling a capillary plexus; conversely, partially organized and rounded endothelial cells were observed after the addition of CM from U87shC8 cells (Figure 1—figure supplement 2). To uncover whether Caspase-8 dependent regulation of angiogenesis correlates with the modulation of tumor growth in vivo, we compared the tumorigenic potential of U87 cells in which the expression of Caspase-8 was genetically inhibited or not. As reported in Figure 1C, after three weeks, U87 cells formed tumors of an average volume of ~1,254 mm3 in all injected mice, whereas U87shC8 cells exhibited a drastically reduced capacity to form tumors (mean tumor volume: ~148 mm3), which were detected in only 29% of injected mice. After 6 weeks, the mean tumor volume generated by U87sh8 cells was ~344 mm3 and tumors were identified in 67% of injected mice (Figure 1C). In order to evaluate whether the decreased tumor growth observed in shC8 mice compared to CTR was associated with a lower vascular density, we evaluated neovascularization in CTR and shC8 tumors. Tumor vessels were visualized using anti-CD31 mAb, which permitted an assessment of the vascular density of the tumors. Figure 1D shows that there was a significant difference in vascularization between CTR and shC8 tumors; the mean number of vessels per mm2 field was 20.52 (±0.62) for CTR and 1.21 (±0.41) for shC8 (p=0.001). Overall, these data suggest that Caspase-8 expression in GBM is required for tumor growth, maximal proliferation of GBM-associated endothelial cells and angiogenesis, probably through the production of secreted factors. To measure whether Caspase-8 expression affects the profile of secreted cytokines and growth factors, we used LUMINEX multiplex bead assay, which allows the simultaneous quantification of several cytokines from the same sample (Khalifian et al., 2015). High levels of IL-1β, IL-6, IL-8, MCP-1, VEGF-A and TNFalpha were present in the CM of U87CTR, as is consistent with previous reports (Albulescu et al., 2013), and the genetic inhibition of Caspase-8 caused a strong decrease in the levels of these cytokines (except TNF alpha) in the CM (Figure 2A). Accordingly, we observed a dramatic reduction of the respective mRNAs upon Caspase-8 downregulation (Figure 2B). We obtained similar results in U87 cells where Caspase-8 expression was inhibited using a different interfering sequence (Figure 2—figure supplement 1), as well as in U251, another GBM cell line (Figure 2—figure supplement 1).
Figure 2.

Caspase-8 promotes the expression and secretion of cytokines and growth factors.

(A) Concentrations (pg/ml) of IL-1β, IL-6, IL-8, MCP-1 (CCL-2), VEGF-A and TNF-α were measured by Luminex assay, in the supernatants of U87 cells upon stable genetic silencing of Caspase-8 expression (Sh C8) or not (ShCTR, named CTR). Data were plotted as mean ± SD and statistical significance was estimated by Unpaired T-test, ***p<0.001. Error bars represent a SD between three independent experiments, each of them performed in technical duplicate. In all experiments, the volume of CM from different samples was normalized on the number of cells for each sample counted when CM was collected. (B) Quantitative real time RT-PCR on U87CTR cells and U87shC8 cells. Relative quantities were calculated normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates, each one performed in technical duplicate, are shown as mean ± SD (***p-value<0.001). Three independent experiments were consistent. (C) Correlation between Caspase-8 and IL-6, IL-8, IL1β, MCP-1 and VEGF expression in human glioblastoma. Pearson correlation coefficients computed between gene expression profiles for CASP-8, IL-6, IL-8, IL1β, MCP-1 and VEGF, in 174 glioblastoma RNA-Seq samples retrieved from the Cancer Genome Atlas. The correlation coefficient between expression profiles is proportional to the circle radii in the matrix, and additionally color-coded using the color scale reported to the right of the matrix. The plot was generated using the /corrplot/ R package (https://cran.r-project.org/web/packages/corrplot).

DOI: http://dx.doi.org/10.7554/eLife.22593.010

Statistical analysis of Luminex Experiments (Figure 2A).

DOI: http://dx.doi.org/10.7554/eLife.22593.011

Statistical analysis of quantitative real time RT-PCR Figure 2B and Figure 2—figure supplement 1A and B.

DOI: http://dx.doi.org/10.7554/eLife.22593.012

DOI: http://dx.doi.org/10.7554/eLife.22593.013

The Pearson correlation coefficients and corresponding p-values between Caspase-8 expression and those of the different cytokine and growth factor genes are displayed.

DOI: http://dx.doi.org/10.7554/eLife.22593.014

(A) Quantitative real time RT-PCR for IL-6, IL-8 and VEGF mRNAs in U87 CTR and U87 ShC8#2. (B) Quantitative real time RT-PCR for IL-6, IL-8 and VEGF mRNAs in U251 Sh control and Sh Caspase-8 (shC8) cell lines. Relatives quantities were calculated to TBP and are relative to U87 Sh CTR cells. n = 3 biological replicates, each performed in technical duplicate ***p-value<0.001, **p-value<0.01, NS = not significant.

DOI: http://dx.doi.org/10.7554/eLife.22593.015

Quantitative real time RT-PCR on U87 stably overexpressing a dominant negative IKBalpha construct (IKB alpha SR) or not. Relative quantities were calculated by normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates are shown as mean ± SD (***p-value<0.001).

DOI: http://dx.doi.org/10.7554/eLife.22593.016

Figure 2—figure supplement 1.

Silencing of Caspase-8 triggers the downregulation of IL-6, IL-8 and VEGF mRNA expression.

(A) Quantitative real time RT-PCR for IL-6, IL-8 and VEGF mRNAs in U87 CTR and U87 ShC8#2. (B) Quantitative real time RT-PCR for IL-6, IL-8 and VEGF mRNAs in U251 Sh control and Sh Caspase-8 (shC8) cell lines. Relatives quantities were calculated to TBP and are relative to U87 Sh CTR cells. n = 3 biological replicates, each performed in technical duplicate ***p-value<0.001, **p-value<0.01, NS = not significant.

DOI: http://dx.doi.org/10.7554/eLife.22593.015

Caspase-8 promotes the expression and secretion of cytokines and growth factors.

(A) Concentrations (pg/ml) of IL-1β, IL-6, IL-8, MCP-1 (CCL-2), VEGF-A and TNF-α were measured by Luminex assay, in the supernatants of U87 cells upon stable genetic silencing of Caspase-8 expression (Sh C8) or not (ShCTR, named CTR). Data were plotted as mean ± SD and statistical significance was estimated by Unpaired T-test, ***p<0.001. Error bars represent a SD between three independent experiments, each of them performed in technical duplicate. In all experiments, the volume of CM from different samples was normalized on the number of cells for each sample counted when CM was collected. (B) Quantitative real time RT-PCR on U87CTR cells and U87shC8 cells. Relative quantities were calculated normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates, each one performed in technical duplicate, are shown as mean ± SD (***p-value<0.001). Three independent experiments were consistent. (C) Correlation between Caspase-8 and IL-6, IL-8, IL1β, MCP-1 and VEGF expression in human glioblastoma. Pearson correlation coefficients computed between gene expression profiles for CASP-8, IL-6, IL-8, IL1β, MCP-1 and VEGF, in 174 glioblastoma RNA-Seq samples retrieved from the Cancer Genome Atlas. The correlation coefficient between expression profiles is proportional to the circle radii in the matrix, and additionally color-coded using the color scale reported to the right of the matrix. The plot was generated using the /corrplot/ R package (https://cran.r-project.org/web/packages/corrplot). DOI: http://dx.doi.org/10.7554/eLife.22593.010

Caspase-8 promotes the secretion of cytokines and growth factors.

Statistical analysis of Luminex Experiments (Figure 2A). DOI: http://dx.doi.org/10.7554/eLife.22593.011

Caspase-8 promotes mRNA expression of cytokines and growth factors.

Statistical analysis of quantitative real time RT-PCR Figure 2B and Figure 2—figure supplement 1A and B. DOI: http://dx.doi.org/10.7554/eLife.22593.012

Data collection for the analysis of the correlation between Caspase-8 and IL-6, IL-8, IL1β, MCP-1 and VEGF expression in human glioblastoma, Figure 2C.

DOI: http://dx.doi.org/10.7554/eLife.22593.013

Correlation between Caspase-8 and IL-6, IL-8, IL1β, MCP-1 and VEGF expression in human glioblastoma.

The Pearson correlation coefficients and corresponding p-values between Caspase-8 expression and those of the different cytokine and growth factor genes are displayed. DOI: http://dx.doi.org/10.7554/eLife.22593.014

Silencing of Caspase-8 triggers the downregulation of IL-6, IL-8 and VEGF mRNA expression.

(A) Quantitative real time RT-PCR for IL-6, IL-8 and VEGF mRNAs in U87 CTR and U87 ShC8#2. (B) Quantitative real time RT-PCR for IL-6, IL-8 and VEGF mRNAs in U251 Sh control and Sh Caspase-8 (shC8) cell lines. Relatives quantities were calculated to TBP and are relative to U87 Sh CTR cells. n = 3 biological replicates, each performed in technical duplicate ***p-value<0.001, **p-value<0.01, NS = not significant. DOI: http://dx.doi.org/10.7554/eLife.22593.015

Ectopic expression of a dominant negative IKBα triggers the downregulation of IL-6, IL-8, IL-1β, MCP-1 and VEGF mRNA expression.

Quantitative real time RT-PCR on U87 stably overexpressing a dominant negative IKBalpha construct (IKB alpha SR) or not. Relative quantities were calculated by normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates are shown as mean ± SD (***p-value<0.001). DOI: http://dx.doi.org/10.7554/eLife.22593.016 To clarify the significance of our findings, we interrogated mRNA levels in a RNA-seq data set derived from 174 human GBM patients, which is available in Cancer Genome Atlas (TCGA). For each gene, we built a profile of normalized expression data from the 174 samples, and we then compared these profiles using the Pearson product-moment correlation coefficient. Interestingly, the Caspase-8 expression profile positively correlated with those of IL-6, IL-8, IL1β and MCP-1 (Figure 2C and Figure 2—source data 4), ranging from 0.25 when comparing the Caspase-8 and IL-6 GBM expression profiles, to 0.53 for Caspase-8 and MCP-1. All of these correlations were statistically significant (P-value < 0.0008 for each comparison), whereas there was no significant relationship between the Caspase-8 and VEGF expression profiles (Pearson correlation coefficient 0.09, p-value 0.22). Overall these results identified a novel role of Caspase-8 in promoting neoangiogenesis. This is in agreement with previous studies on Caspase-8 null mice, which showed defects in the angiogenesis programme during development (Scharner et al., 2009). The expression of the aforementioned cytokines is finely tuned by several transcription factors, among which is NF-kB. In gliomas, NF-kB is often constitutively activated (Cahill et al., 2016), NF-kB-regulated genes are induced (Bonavia et al., 2012), and the expression of these genes correlates inversely with patient prognosis (Nogueira et al., 2011). Consistently, the overexpression of a dominant negative mutant of IKBalpha (IKBaphaS32A/S36A, named IKBapha SR) that inhibits NF-kB signalling severely decreased the expression of IL-6, IL-8, IL1β, MCP-1 and VEGF-A mRNAs in U87 cells (Figure 2—figure supplement 2). Silencing of Caspase-8 in U87 cells did not reduce the amount of NF-kB but strongly decreased its nuclear localization (Figure 3A and B). Similar results were also obtained in U251 GBM cells (Figure 3C). Preliminary immunohistochemistry analysis in formalin-fixed paraffin-embedded tissues suggests a different distribution of NF-kB in CTR (nuclear and cytoplasmic) and in shC8 (mainly cytoplasmic) tumors (Figure 3—figure supplement 1). Consistently, we could detect a significant reduction of VEGF and IL-8 mRNA levels in shC8-derived tumor samples (Figure 3—figure supplement 1). Our results provide the first evidence that Caspase-8 promotes NF-kB activity in GBM in vitro and in vivo. Interestingly, cancer-associated missense mutations of Caspase-8 resulting in stronger activation of NF-kB have been identified recently in head and neck squamous cell carcinoma (Ando et al., 2013).
Figure 2—figure supplement 2.

Ectopic expression of a dominant negative IKBα triggers the downregulation of IL-6, IL-8, IL-1β, MCP-1 and VEGF mRNA expression.

Quantitative real time RT-PCR on U87 stably overexpressing a dominant negative IKBalpha construct (IKB alpha SR) or not. Relative quantities were calculated by normalizing for TBP. Representative results of a single experiment with n = 3 biological replicates are shown as mean ± SD (***p-value<0.001).

DOI: http://dx.doi.org/10.7554/eLife.22593.016

Figure 3.

Caspase-8 expression promotes NFkB translocation into the nucleus.

(A) Immunostaining α-p65-NFkB in U87 Sh Caspase-8 and control cell lines. Bar scale: 25 μm. The bar chart represents the cytoplasmic (cyt)/nuclear (nuc) ratio of cell fluorescence intensity (FI) obtained using the Image J program. ***p-value<0.001. (B, C) Western blot analysis of fractionated cell lysates of U87 (B) and U251 (C) cell lines.

DOI: http://dx.doi.org/10.7554/eLife.22593.017

Statistical analysis of Image J Quantification of NFkB cellular localization (Figure 3A).

DOI: http://dx.doi.org/10.7554/eLife.22593.018

Statistical analysis of quantitative real time RT-PCR (Figure 3—figure supplement 1B).

DOI: http://dx.doi.org/10.7554/eLife.22593.019

(A) NF-kB immunohistochemical expression performed in formalin-fixed paraffin-embedded tissues evidences a different distribution of NFkB in shC8 (mainly cytoplasmic) with respect to CTR (nuclear and cytoplasmic) tumor samples (original magnification 40X, scale bar 50 µm). (B) Quantitative real time RT-PCR for Caspase-8, VEGF and IL-8 mRNAs in tumor mass caused by subcutaneous injection of U87 CTR control and U87 shC8 cells. Relative quantities were normalized to TBP and calculated relative to U87 Sh CTR. n = 4 (CTR) or n = 6 (shC8) biological replicates, each performed in technical duplicate. ***p-value<0.001, **p-value<0.01.

DOI: http://dx.doi.org/10.7554/eLife.22593.020

Figure 3—figure supplement 1.

Caspase-8 expression promotes NFkB activity in vivo.

(A) NF-kB immunohistochemical expression performed in formalin-fixed paraffin-embedded tissues evidences a different distribution of NFkB in shC8 (mainly cytoplasmic) with respect to CTR (nuclear and cytoplasmic) tumor samples (original magnification 40X, scale bar 50 µm). (B) Quantitative real time RT-PCR for Caspase-8, VEGF and IL-8 mRNAs in tumor mass caused by subcutaneous injection of U87 CTR control and U87 shC8 cells. Relative quantities were normalized to TBP and calculated relative to U87 Sh CTR. n = 4 (CTR) or n = 6 (shC8) biological replicates, each performed in technical duplicate. ***p-value<0.001, **p-value<0.01.

DOI: http://dx.doi.org/10.7554/eLife.22593.020

Caspase-8 expression promotes NFkB translocation into the nucleus.

(A) Immunostaining α-p65-NFkB in U87 Sh Caspase-8 and control cell lines. Bar scale: 25 μm. The bar chart represents the cytoplasmic (cyt)/nuclear (nuc) ratio of cell fluorescence intensity (FI) obtained using the Image J program. ***p-value<0.001. (B, C) Western blot analysis of fractionated cell lysates of U87 (B) and U251 (C) cell lines. DOI: http://dx.doi.org/10.7554/eLife.22593.017

Caspase-8 promotes NFkB nuclear localization in U87 GBM cells.

Statistical analysis of Image J Quantification of NFkB cellular localization (Figure 3A). DOI: http://dx.doi.org/10.7554/eLife.22593.018

Caspase-8 promotes IL8 and VEGFA mRNA expression in tumors derived from mouse xenograft experiments.

Statistical analysis of quantitative real time RT-PCR (Figure 3—figure supplement 1B). DOI: http://dx.doi.org/10.7554/eLife.22593.019

Caspase-8 expression promotes NFkB activity in vivo.

(A) NF-kB immunohistochemical expression performed in formalin-fixed paraffin-embedded tissues evidences a different distribution of NFkB in shC8 (mainly cytoplasmic) with respect to CTR (nuclear and cytoplasmic) tumor samples (original magnification 40X, scale bar 50 µm). (B) Quantitative real time RT-PCR for Caspase-8, VEGF and IL-8 mRNAs in tumor mass caused by subcutaneous injection of U87 CTR control and U87 shC8 cells. Relative quantities were normalized to TBP and calculated relative to U87 Sh CTR. n = 4 (CTR) or n = 6 (shC8) biological replicates, each performed in technical duplicate. ***p-value<0.001, **p-value<0.01. DOI: http://dx.doi.org/10.7554/eLife.22593.020 Having demonstrated that Caspase-8 expression promotes neoplastic transformation in vitro (Fianco et al., 2016) and sustains tumor growth and its microenvironment (Figures 1, 2 and 3), we asked whether Caspase-8 expression affects GBM cells response to therapy. For several decades, the typical treatment for GBM has been radiotherapy; more recently, Temozolomide (TMZ) has been incorporated into the standard treatment as an essential component (Stupp et al., 2005). As shown in Figure 4A and in Figure 4—figure supplement 1, the down-regulation of Caspase-8 expression significantly sensitized U87 cells to the cytotoxic effects of TMZ. Interestingly, the expression of the dominant negative mutant of IKBalpha, IKBaphaSR, had a similar effect (Figure 4B), suggesting that Caspase-8 exerts its function via NF-kB signalling, possibly through secreted cytokines. Indeed, as shown in Figure 4C, CM of control cells that endogenously express Caspase-8 was sufficient to restore resistance to TMZ in cells silenced for Caspase-8. Importantly, CM from IKBalphaSR-expressing cells, like that from Caspase-8-deficient cells, lost such a protective capability (Figure 4D). These results support the conclusion that Caspase-8 expression in GBM cells triggers resistance to TMZ via an autocrine loop and suggest that the level of Caspase-8 expression may correlate with prognosis. To test this hypothesis, we analyzed the survival of 77 high-glioma patients (of which 15 were censored), whose gene expression was measured using microarrays (Phillips et al., 2006). We classified the patients on their Caspase-8 expression, dividing the Caspase-8 expression distribution into three quantiles and considering the first quantile as low expression and the last quantile as high expression. Analysis of the survival curves shows that patients that have higher Caspase-8 expression levels have a lower survival chance than those with lower expression (Chi-squared 10.5 on 1 degree of freedom, p-value 0.00117), supporting our hypothesis (Figure 4E). In addition, we investigated the survival rates of the same 77 patients classified into three distinct subtypes: mesenchymal (23 cases), proneural (30 cases) and proliferative (24 cases) tumors. Patients belonging to each subtype were stratified in terms of high and low Caspase-8 expression, based on the distribution of Caspase-8 probe intensities specific for each subtype. The significantly different Caspase-8 expression levels in the proneural, mesenchymal and proliferative GBMs justified the use of different thresholds for each subtype. For patients classified as proneural, those having high Caspase-8 expression show significantly lower survival probability (Chi-squared 7.2 on 1 degree of freedom, p-value 0.00732), while no difference was observed for the mesenchymal and proliferative subtypes (Figure 4—figure supplement 2).
Figure 4.

Downregulation of Caspase-8 increases sensibility to Temozolomide (TMZ).

(A, B) Viability assay represented in the histogram as mean ± SD. U87CTR control cell lines, U87shCaspase-8 and U87 IKBalphaSR, were incubated in the presence of Temozolomide (TMZ 0.5 mM for 72 hr) or not. The viability of TMZ-treated cells was assessed with the CellTiter 96 Aqueous One Solution Cell proliferation assay, and was represented as the percentage of inhibition of viability measured in cells without TMZ treatment. Data are represented in the histogram as mean ± SD. Error bars represent a SD between three (A) or two (B) independent experiments, each of them performed at least in technical triplicate. Student’s t test was used for statistical analyses. **p<0.01 (A, B). (C, D) U87shCaspase-8 were incubated or not in the presence of Temozolomide (TMZ 0.5 mM for 72 hr) dissolved in conditioned media derived from U87 ShCtr (CTR), U87 shCaspase-8 (shC8) or U87IKBa SR. Data are represented in the histogram as mean ± SD. Error bars represent a SD between two (C) or three (D) independent experiments, each of them performed in technical triplicate. Student’s t test was used for statistical analyses. *p-value<0.05 (C), NS=not significant. In all experiments shown in panel A–D, the volume of CM from different samples was normalized on the number on cells for each sample counted when the CM was collected. (E) Survival curves of high-grade glioma classified based on Caspase-8 expression levels. Glioma patients were classified as low Caspase-8 expression (green curve) and high Caspase-8 expression level (red curve), as described in the text. The Kaplan-Meier test supports a significant difference (p-value 0.00117) between the survival rates of the two groups, with patients having a low Caspase-8 expression showing a higher survival probability. (F) Proposed model depicting the link between Caspase-8 and cytokines in glioblastoma. Caspase-8 promotes NFkB nuclear localization and sustains the production of VEGF, IL-6, IL-8, IL-1β and MCP-1. This pathway promotes neoangiogenesis and triggers resistance to Temozolomide.

DOI: http://dx.doi.org/10.7554/eLife.22593.021

Statistical analysis of experiments (Figure 4A,B,C,D).

DOI: http://dx.doi.org/10.7554/eLife.22593.022

Data collection.

DOI: http://dx.doi.org/10.7554/eLife.22593.023

Statistical analysis of experiments (Figure 4—figure supplement 1).

DOI: http://dx.doi.org/10.7554/eLife.22593.024

Viability assay represented in the histogram as mean ± SD. U87CTR control cells (CTR), U87shC8 (shC8) and U87shCaspase-8#2 (shC8#2) cells were incubated or not in the presence of Temozolomide (TMZ 0.5 mM for 72 hr). The viability of TMZ-treated cells was assessed with the CellTiter 96 Aqueous One Solution Cell Proliferation assay, and is represented as the percentage of inhibition of viability measured in cells treated without TMZ. Data are represented in the histogram as mean ± SD. Error bars represent SD between two independent experiments each of them performed at least in technical triplicate. Student’s t test was used for statistical analysis. ***p<0.001. In all experiments, the volume of CM from different samples was normalized on the number on cells for each sample counted when the CM was collected.

DOI: http://dx.doi.org/10.7554/eLife.22593.025

Survival of patients classified as proneural (A), proliferative (B) and mesenchymal (C) and stratified into low and high Caspase-8 expression groups on the basis of the expression distribution. (D) Caspase-8 (CASP8) expression distributions, estimated as microarray probe intensity, in samples belonging to the proneural (blue curve), mesenchymal (orange curve) and proliferative (pink curve) subtypes.

DOI: http://dx.doi.org/10.7554/eLife.22593.026

Figure 4—figure supplement 1.

Caspase-8 downregulation by two independent interference sequences increases sensibility to Temozolomide (TMZ).

Viability assay represented in the histogram as mean ± SD. U87CTR control cells (CTR), U87shC8 (shC8) and U87shCaspase-8#2 (shC8#2) cells were incubated or not in the presence of Temozolomide (TMZ 0.5 mM for 72 hr). The viability of TMZ-treated cells was assessed with the CellTiter 96 Aqueous One Solution Cell Proliferation assay, and is represented as the percentage of inhibition of viability measured in cells treated without TMZ. Data are represented in the histogram as mean ± SD. Error bars represent SD between two independent experiments each of them performed at least in technical triplicate. Student’s t test was used for statistical analysis. ***p<0.001. In all experiments, the volume of CM from different samples was normalized on the number on cells for each sample counted when the CM was collected.

DOI: http://dx.doi.org/10.7554/eLife.22593.025

Figure 4—figure supplement 2.

Survival curves and Caspase-8 expression levels in three GBM subtypes.

Survival of patients classified as proneural (A), proliferative (B) and mesenchymal (C) and stratified into low and high Caspase-8 expression groups on the basis of the expression distribution. (D) Caspase-8 (CASP8) expression distributions, estimated as microarray probe intensity, in samples belonging to the proneural (blue curve), mesenchymal (orange curve) and proliferative (pink curve) subtypes.

DOI: http://dx.doi.org/10.7554/eLife.22593.026

Overall, we identify a novel function of Caspase-8 (Figure 4F), which supports a double agent role of Caspase-8 in cancer. The classical role of Caspase-8 in apoptosis may account for the correlation between loss of Caspase-8 expression and unfavourable prognosis in medulloblastoma (Pingoud-Meier et al., 2003). Conversely, tumors that are strongly dependent on NFkB activity and cytokine production, such as GBM, may have a selective advantage in retaining Caspase-8 expression. In these contexts, targeting of Caspase-8 expression or of its tumorigenic functions represents a novel therapeutic approach.

Downregulation of Caspase-8 increases sensibility to Temozolomide (TMZ).

(A, B) Viability assay represented in the histogram as mean ± SD. U87CTR control cell lines, U87shCaspase-8 and U87 IKBalphaSR, were incubated in the presence of Temozolomide (TMZ 0.5 mM for 72 hr) or not. The viability of TMZ-treated cells was assessed with the CellTiter 96 Aqueous One Solution Cell proliferation assay, and was represented as the percentage of inhibition of viability measured in cells without TMZ treatment. Data are represented in the histogram as mean ± SD. Error bars represent a SD between three (A) or two (B) independent experiments, each of them performed at least in technical triplicate. Student’s t test was used for statistical analyses. **p<0.01 (A, B). (C, D) U87shCaspase-8 were incubated or not in the presence of Temozolomide (TMZ 0.5 mM for 72 hr) dissolved in conditioned media derived from U87 ShCtr (CTR), U87 shCaspase-8 (shC8) or U87IKBa SR. Data are represented in the histogram as mean ± SD. Error bars represent a SD between two (C) or three (D) independent experiments, each of them performed in technical triplicate. Student’s t test was used for statistical analyses. *p-value<0.05 (C), NS=not significant. In all experiments shown in panel A–D, the volume of CM from different samples was normalized on the number on cells for each sample counted when the CM was collected. (E) Survival curves of high-grade glioma classified based on Caspase-8 expression levels. Glioma patients were classified as low Caspase-8 expression (green curve) and high Caspase-8 expression level (red curve), as described in the text. The Kaplan-Meier test supports a significant difference (p-value 0.00117) between the survival rates of the two groups, with patients having a low Caspase-8 expression showing a higher survival probability. (F) Proposed model depicting the link between Caspase-8 and cytokines in glioblastoma. Caspase-8 promotes NFkB nuclear localization and sustains the production of VEGF, IL-6, IL-8, IL-1β and MCP-1. This pathway promotes neoangiogenesis and triggers resistance to Temozolomide. DOI: http://dx.doi.org/10.7554/eLife.22593.021

Caspase-8 downregulation increases sensibility to Temozolomide (TMZ).

Statistical analysis of experiments (Figure 4A,B,C,D). DOI: http://dx.doi.org/10.7554/eLife.22593.022

Survival curves of high-grade glioma classified on the basis of Caspase-8 (CASP8) expression levels.

Data collection. DOI: http://dx.doi.org/10.7554/eLife.22593.023

Caspase-8 downregulation by two different shC8 constructs increases sensibility to Temozolomide (TMZ).

Statistical analysis of experiments (Figure 4—figure supplement 1). DOI: http://dx.doi.org/10.7554/eLife.22593.024

Caspase-8 downregulation by two independent interference sequences increases sensibility to Temozolomide (TMZ).

Viability assay represented in the histogram as mean ± SD. U87CTR control cells (CTR), U87shC8 (shC8) and U87shCaspase-8#2 (shC8#2) cells were incubated or not in the presence of Temozolomide (TMZ 0.5 mM for 72 hr). The viability of TMZ-treated cells was assessed with the CellTiter 96 Aqueous One Solution Cell Proliferation assay, and is represented as the percentage of inhibition of viability measured in cells treated without TMZ. Data are represented in the histogram as mean ± SD. Error bars represent SD between two independent experiments each of them performed at least in technical triplicate. Student’s t test was used for statistical analysis. ***p<0.001. In all experiments, the volume of CM from different samples was normalized on the number on cells for each sample counted when the CM was collected. DOI: http://dx.doi.org/10.7554/eLife.22593.025

Survival curves and Caspase-8 expression levels in three GBM subtypes.

Survival of patients classified as proneural (A), proliferative (B) and mesenchymal (C) and stratified into low and high Caspase-8 expression groups on the basis of the expression distribution. (D) Caspase-8 (CASP8) expression distributions, estimated as microarray probe intensity, in samples belonging to the proneural (blue curve), mesenchymal (orange curve) and proliferative (pink curve) subtypes. DOI: http://dx.doi.org/10.7554/eLife.22593.026

Materials and methods

Cell cultures

Caspase-8 was stably genetically silenced in U87 (originally obtained by ATCC) and U251 cell lines as previously described (Fianco et al., 2016). All cell lines were maintained in DMEM supplemented with 10% fetal bovine serum and were routinely tested negative for mycoplasma contamination. Following thawing, cells were used for no longer than one month. Human umbilical endothelial cells (HUVEC; PromoCell GmbH, Heidelberg, Germany) were cultured as previously reported (Gabellini et al., 2013). The sequences of Caspase-8 used for interference are: shC8 5’-ATCACAGACTTTGGACAAA-3’, shC8#2 5’-GCCTGGATGTTATTCCAG-3’; the sequence used as control, shcontrol (CTR), is: 5’-GGATATCCCTCTAGATTA-3’. The pMIGIKBalphaS32A/S36A (IKBalpha SR) construct was kindly provided by Y. Ciribilli and A. Inga (Brockman et al., 1995; Bisio et al., 2014).

Antibodies and other reagents

Anti Caspase 8 (MBL 1:1000) RRID:AB_590760; anti Tubulin (Sigma-Aldrich 1:2000) RRID:AB_10013740; anti NF-kB (p65) (Santa Cruz 1:1000) RRID:AB_632037; anti SP1 (Santa Cruz 1:1000) RRID:AB_2171050; anti rat mAb CD31 (clone SZ31, Dianova GmbH 1:10) RRID:AB_2631039; anti-NF-kB p65 (clone E379, abcam, 1:1000) RRID:AB_776751; TMZ: temozolomide.

In vitro and in vivo angiogenesis assays

All procedures involving animals and their care were authorized and certified by the decree n.26/2014 of the Italian Minister of Health following the relative guide lines. For in vivo Matrigel assays, 60 μl 10× concentrated CM from the different cell lines, obtained using Centricon-3 concentrators (Merck Millipore, Billerica, MA) were mixed with 600 μl of Matrigel (BD Bioscience, San Jose, CA), supplemented with heparin (19.2 U; Schwarz Pharma SpA, Milan, Italy). This medium was injected subcutaneously into the flank of 8-week-old C57BL/6 mice (provided by the Animal Care Unit of the Regina Elena Cancer Institute, Rome, Italy). The negative and positive controls contained heparin alone or heparin plus VEGF (60 ng/mice; R&D Systems, Minneapolis, MN), respectively. After 5 days, the angiogenic response was evaluated by macroscopic analysis at autopsy, and by measurement of the hemoglobin (Hb) content in the pellet of matrigel as previously reported (Gabellini et al., 2013). The values were expressed as optical density (OD at 540 nm)/100 mg of matrigel. Each group consisted of ten animals. The experiments were repeated three times. In vitro HUVEC cell proliferation was evaluated by a colorimetric assay at the end of treatment as described previously (Gabellini et al., 2013). Endothelial capillary tube-like network formation was assessed using Matrigel as described previously (Gabellini et al., 2013). Briefly, 24–well microtiter plates were coated with 300 µl/well unpolymerized matrigel (10 mg/ml) and allowed to polymerize at 37°C. Endothelial cells were plated (5 × 104 cells/well) in 1 ml of serum free medium (negative control), complete medium (positive control), or conditioned medium (CM) obtained from sh control (CTR) or sh Caspase 8 (shC8) cells. After 8 hr, cell growth was observed through a reverted, phase-contrast photomicroscope and photographed. Experiments were repeated at least three times, and each sample was tested in triplicate. Angiogenic activity was quantified by measuring the cumulative length of the sprouts using digital imaging software (Image J) to analyze ten fields per experimental group and experiment.

Luminex assay

Concentrations of IL1-β, IL-6, IL-8, MCP-1 and VEGF-A were simultaneously determined in supernatants of shCtr (CTR) and ShC8 cells (n = 3 biological replicates per group and two technical duplicates for each sample) using a custom-made human magnetic Luminex assay kit (E-Bioscience). The assay procedure was performed according to the manufacturer's instructions and the plate was read on a Luminex-200 instrument (Luminex Corp., Austin, TX). Data were calculated by generating a calibration curve using the recombinant cytokines specified above, diluted in the cell culture medium used for culturing cells. Concentrations of each analyte were calculated using a standard 5P-logistic weighted curve generated for each target and expressed as picograms per milliliter (pg/ml). Due to out of range readings of undiluted samples, IL-8 concentrations were calculated on 1:10 diluted supernatants. Data were presented as the mean ± SD and the statistical analysis was performed using unpaired T-tests.

Immunofluorescence

Cells were plated on coverslips and maintained at 37°C and 5% CO2 for 24 hr before staining. Cells were treated or not with TNFα (20 ng/ml) 20 min before staining. Cells were washed with 1x phosphate buffer salin (PBS) three times. They were fixed in 4% paraformaldehyde for 15 min, permeabilized in 0.3% triton x100 for 15 min, blocked with 1% BSA for 1 hr at room temperature, and incubated with primary antibody overnight at 4°C. Secondary antibodies were applied for 1 hr at room temperature, stained with Hoechst for 5 min. The primary antibody used was anti NFkB p65 Santa Cruz (clone C20) 1:200. The secondary antibody was donkey anti rabbit 488 (Jackson Immune Research) 1:200. Images of immunostaining cells were obtained by microscopy using a Olympus BX53 microscope. Quantitative fluorescence data were exported from ImageJ generated histograms into Microsoft Excel software for further analysis and presentation. Cytoplasmic and nuclear staining intensities were compared to give the cytoplasmic/nuclear ratio.

Reverse transcription and real time RT-PCR analyses

One microgram of total RNA isolated by TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) was retrotranscribed with MLV-Reverse Transcriptase (Promega, Madison, WI, USA) according to standard procedures. Ten nanograms of cDNA were employed to quantify the transcripts by real time RT-PCR using SYBR Select Master Mix (Applied Biosystem Foster City, CA, USA) and gene-specific primers, which are listed in supplemental information. Real-time PCR was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystem). Relative quantity (RQ) was calculated normalizing for TBP and using a U87CTR sampleas calibrator. Mean values and standard deviations of RQ were generated from three biological replicates. Each experiment was performed for two technical replicates. The following primer sequences were used:

Protein extracts and immunoblotting analysis

Cell extracts were prepared in IP buffer (50 mM Tris–HCl [pH 7.5], 250 mM NaCl, 1% NP-40, 5 mM EDTA, 5 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 25 mM NaF, 1 mM sodium orthovanadate, 10 µg/ml TPCK, 5 µg/ml TLCK, 1 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor, 1 µg/ml aprotinin). For nuclei/cytoplasm cell fractionation, cells were in hypotonic buffer (10 mM HEPES [pH 7.5], 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and protease and phosphatase inhibitors at concentrations described below) and incubated for 15 min on ice. NP-40 (0.6% final concentration) was added, and nuclei were harvested by centrifugation at 12,000 g at 4°C for 30 s. The cytoplasmic fraction was recovered, and nuclear proteins were extracted from the pellet in nucleus buffer (20 mM HEPES [pH 7.5], 0.4M NaCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and protease and phosphatase inhibitors at concentrations described below) for 1 hr at 4°C on a rotating wheel. For immunoblotting, 50–100 µg of proteins were separated by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE), blotted onto nitrocellulose membrane, and detected with specific antibodies.

Cell viability analysis

U87 cell lines (U87 CTR and U87 Sh Caspase 8) were seeded in 96-well plates (1,000 cells/well) and treated for 72 hr with TMZ 0.5 mM or DMSO as control. Cell viability was analysed by CellTiter 96 Aqueous One Solution Cell proliferation assay (Promega) as previously described (Stagni et al., 2015).

In vivo tumorigenic assay and angiogenesis analysis

For in vivo tumorigenicity, female CD-1 nude (nu/nu) mice, at 6–8 weeks old and 22–24 g in body weight, were purchased from Charles River Laboratories (Calco, Italy). 4 × 106 U87CTR and U87ShC8 cells were injected subcutaneously into the flank of these mice (24 for each group). Two different experiments (the first one with 8 and the second one with 16 animals for each group) were performed. The mice were observed daily, and their tumor volume (mm3) was calculated as length × width 2 × π/6. The animals were sacrificed 3 (CTR) and 6 (shC8) weeks after cell injection. The results were analysed by pooling together the two experiments to evaluate tumor growth at three weeks (CTR and shC8) and at six weeks (shC8). The three groups were compared using the Kruskal-Wallis test with Bonferroni correction. Immediately after sacrifice, the tumors were removed: half of each tumor was frozen in Trizol and stored at −80°C and the remaining half was fixed in 4% buffered formalin and paraffin embedded for immunohistochemical analysis. Microvessel density and NFkB expression were evaluated on tumor xenograft paraffin-embedded sections by staining endothelial cells using a CD31 anti rat mAb and the rabbit mAb anti-NF-kB, respectively. Immunoreactions were revealed by ULTRATEK HRP (Scy Tek Laboratories, UT, USA) for CD31 and by Bond Polymer Refine Detection in an automated stainer (Leica Biosystem, Milan, Italy) for NFkB.

Correlation study

A collection of 174 RNA-Seq data samples from patients diagnosed with glioblastoma multiforme was retrieved from the Cancer Genome Atlas (TCGA). The data were produced by the University of North Carolina Cancer Genomic Characterization Center (CGCC) using the Illumina HiSeq 2000 platform, and made available in TCGA as Level 3 (preprocessed) data. The TCGA data were retrieved from the Genomic Data Commons (GDC) using the following search query: Disease Type IS Glioblastoma Multiforme AND Primary Site IS Brain AND Program Name IS TCGA AND Project Id IS TCGA-GBM AND Access IS open AND Data Category IS Gene expression AND Data Format IS TXT AND Data Type IS Gene expression quantification AND Experimental Strategy IS RNA-Seq AND Platform IS Illumina HiSeq Among the files retrieved by this query, we employed the files reporting RSEM normalized gene expression. More details on how to retrieve these data are provided in the Supplementary Materials (Supplementary file 1). Data processing was carried out using the SeqWare Pipeline project's MapspliceRSEM workflow (version 0.7) (O'Connor et al., 2010). Gene-level expression data were estimated using RSEM (Li and Dewey, 2011) and normalized to set the upper quartile count at 1,000 for gene level. Correlation between gene expression profiles in the 174 samples was computed as the Pearson product-moment correlation coefficient, setting the p-value threshold at 0.01.

Survival analysis on high-grade glioma patients

Microarray gene expression data, obtained using the Affymetrix U133A chip on a set of 77 high-grade gliomas (Phillips et al., 2006) and for which patient follow-up was available, were retrieved from the Gene Expression Omnibus (GEO series Id GSE4271) in the form of MAS5-normalized intensities. The distribution of Caspase-8 expression was divided in three equal-size quantiles; patients whose Caspase-8 expression was in the first quantile were classified as 'Low Expression', while those whose Caspase-8 expression was in the third quantile were classified as 'High Expression'. Patient stratification depending on Caspase-8 expression was computed for all patients together, and also independently for the three subtypes in which the patients were classified (proneural, mesenchymal or proliferative). Survival curves and the Kaplan-Meier estimator were computed and plotted using the R package survival (https://cran.r-project.org/web/packages/survival/index.html). In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Caspase-8 contributes to angiogenesis and chemotherapy resistance in glioblastoma" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by Jonathan Cooper as the Senior Editor and Reviewing Editor. The following individual involved in review of your submission has agreed to reveal his identity: Marcel Kool (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: The authors have studied the role of Caspase 8 in glioblastoma. Caspase 8 is a key player of extrinsic apoptosis and is often down-regulated in many cancers. However, Caspase 8 expression is often retained in glioblastoma. Following up on their previous findings that caspase 8 sustains neoplastic transformation in vitro, the authors now show that caspase 8 enhances expression and secretion of VEGF, IL6, IL8, IL1beta and MCP1 leading to increased neovascularization and increased resistance to temozolomide. They also show that high levels of caspase 8 in high grade gliomas are correlated with poor patient outcome. The manuscript is well-written, figures are clear, and the findings presented are interesting, showing a new role for Caspase 8 in glioblastoma, different from its role in cancers where Caspase 8 is down-regulated and being mainly involved in apoptosis. Required revisions: There are a few important controls and other issues that must be addressed: 1) The manuscript presents two aspects of Casp-8 mediated functions (angiogenesis and TMZ resistance), both working through NFkB regulation of secreted factors. The main concern is lack of direct in vivo evidence. The addition of in vivo tumor angiogenesis (with staining for blood vessel content) would greatly improve the data (flank or orthotopic). It would also allow for more precise NFkB staining (with IHC) to show changes in localization. 2) It is important to show that the expression of Casp-8 is silenced by the shRNA in these cells either by protein or by mRNA analyses (preferably both). 3) To exclude off-target effects, the independent Casp-8 shRNA used in the supplementary figure must also be used for endothelial tube formation and TMZ experiments, and/or rescues done by expressing a Casp-8 cDNA that cannot be targeted by the shRNA. 4) Figures 1 and 2 – The data presented show that shRNA targeting Casp-8 (shC8) decreases angiogenesis driven by GBM secreted factors in the assays used (Matrigel plug, endothelial tube formation), and causes down-regulation of associated secreted factors, which mostly correlate with gene expression data in human GBM samples. The impact of shC8 on GBM cell proliferation and survival during collection of the conditioned media (CM) should be quantified. 5) Figure 3 – Immunofluorescence staining for NFkB nuclear localization is not convincing and better data are needed. 6) Figure 4 – Analysis of GBM patient survival based on Casp-8 expression shows a significant impact on overall survival. Is the impact on survival due to elevated Casp-8 expression within the mesenchymal subgroup of GBM? The authors should comment on subgroup specific Casp-8 expression, and associated survival rates. Required revisions: There are a few important controls and other issues that must be addressed: 1) The manuscript presents two aspects of Casp-8 mediated functions (angiogenesis and TMZ resistance), both working through NFkB regulation of secreted factors. The main concern is lack of direct in vivo evidence. The addition of in vivo tumor angiogenesis (with staining for blood vessel content) would greatly improve the data (flank or orthotopic). It would also allow for more precise NFkB staining (with IHC) to show changes in localization. To address this issue and uncover the in vivo relevance of Caspase-8 in GBM, mouse xenograft experiments were carried out as suggested by reviewers. We compared the tumorigenic potential of U87 cells stably interfered for Caspase-8 expression or not in nude mice xenograft experiments. Two experiments were performed: the first one with 8 animals for each group and the second one with 16 animals for each group. As reported in novel Figure 1C, U87shC8 cells exhibited a drastically reduced capacity to form tumours as well as a significant reduction of tumor growth compared to U87 CTR cells. To evaluate whether the decreased tumor growth observed in shC8 mice compared to CTR was associated to a lower vascular density, we evaluated neovascularization in CTR and shC8 tumors. Tumor vessels were visualized using anti-CD31 mAb which permitted an assessment of the vascular density of the tumors. Figure 1D shows that there was a significant difference in the vascularization between CTR and shC8 tumors. Preliminary experiments on tumor samples, suggest that shC8 tumors show a different distribution of NFkB compared to CTR ones (Figure 3—figure supplement 1), consistently with results obtained on U87 cells; furthermore, we could show in the same samples a significant reduction of VEGF and IL-8 expression (Figure 3—figure supplement 1). Overall these data suggest that NFkB signaling may be compromised also in vivo. Future experiments will clarify this issue. 2) It is important to show that the expression of Casp-8 is silenced by the shRNA in these cells either by protein or by mRNA analyses (preferably both). We apologize with the reviewer for not including in our previous version this information. Caspase-8 mRNA and protein expression in U87 cells interfered for Caspase-8 expression (with both shCasp8 sequences) or not, have been analyzed respectively by Quantitative Real Time RT-PCR and immunoblotting. These results clearly show that both our shCasp8 sequences are effective. We added this information in a novel figure named Figure 1—figure supplement 1. 3) To exclude off-target effects, the independent Casp-8 shRNA used in the supplementary figure must also be used for endothelial tube formation and TMZ experiments, and/or rescues done by expressing a Casp-8 cDNA that cannot be targeted by the shRNA. As suggested by reviewers endothelial tube formation experiments as well as TMZ experiments including the independent Casp-8 shRNA (shC8#2) have been performed. The results obtained using shC8#2 were fully consistent with the ones obtained using the first shC8 sequence. The new TMZ experiment has been added as Figure 4—figure supplement 1. All the experiments on endothelial cells have been moved in this revised version from Figure 2 (panels C, D, E in the original submission) to Figure 1—figure supplement 2 (panels A, B, C). We provide the images of the new experiment with shC8#2 to the reviewers (Author response image 1).
Author response image 1.

(A) Cell proliferation analysis of U87 sh CTR and U87 shC8 cell lines after starvation (16 or 24 hour) Cell number shave been counted in triplicate. Data are shown as mean ± SD. * Pvalue=0,04 (CTR/shC8 16 h starvation); *Pvalue=0,009 (CTR/shC8 24 h starvation (B) Viability assay represented in the histogram as mean ± s. U87CTR control cell lines, U87shCaspase 8 cell lines were incubated without serum (starvation) for 72 hours and viability was assessed with the CellTiter 96 Aqueous One Solution Cell Proliferation assay. Data are represented in the histogram as mean ± SD. Error bars represent a SD between technical triplicates. Student’s t test was used for statistical analysis. * P value=0,007

DOI: http://dx.doi.org/10.7554/eLife.22593.028

(A) Cell proliferation analysis of U87 sh CTR and U87 shC8 cell lines after starvation (16 or 24 hour) Cell number shave been counted in triplicate. Data are shown as mean ± SD. * Pvalue=0,04 (CTR/shC8 16 h starvation); *Pvalue=0,009 (CTR/shC8 24 h starvation (B) Viability assay represented in the histogram as mean ± s. U87CTR control cell lines, U87shCaspase 8 cell lines were incubated without serum (starvation) for 72 hours and viability was assessed with the CellTiter 96 Aqueous One Solution Cell Proliferation assay. Data are represented in the histogram as mean ± SD. Error bars represent a SD between technical triplicates. Student’s t test was used for statistical analysis. * P value=0,007 DOI: http://dx.doi.org/10.7554/eLife.22593.028 4) We thank the reviewers for this observation that allowed us to better clarify an important issue of our experiments. As previously shown shC8 severely affects GBM cell proliferation in normal conditions (Fianco et. al, 2016, Exp Cell Research). According to this observation, as expected, we could indeed appreciate a decrease in cell proliferation and survival of shC8 cells compared to control ones during collection of the conditioned media (CM). We quantified this effect and we provide this information to the reviewers (Author response image 2).
Author response image 2.

HUVEC formed tube-like structures resembling a capillary plexus when exposed to conditioned media from U87 shcontrol cells (3156 ± 1474 mean of cumulative length of the sprouts ± SD), on the contrary when HUVEC are exposed to conditioned media collected from U87 shC8#2 cells, they are poorly organized (1105 ± 1960 mean of cumulative length of the sprouts ± SD) and most of the cells are rounded.

DOI: http://dx.doi.org/10.7554/eLife.22593.029

HUVEC formed tube-like structures resembling a capillary plexus when exposed to conditioned media from U87 shcontrol cells (3156 ± 1474 mean of cumulative length of the sprouts ± SD), on the contrary when HUVEC are exposed to conditioned media collected from U87 shC8#2 cells, they are poorly organized (1105 ± 1960 mean of cumulative length of the sprouts ± SD) and most of the cells are rounded.

DOI: http://dx.doi.org/10.7554/eLife.22593.029 Being fully aware of this effect, all the experiment with CM performed in the original version of this manuscript as well as in the revised version were carried out normalizing the volume of CM of the different samples on the cell number of the different samples counted when collecting CM, in order to really compare the effect of different CMs (obtained from the same number of cells). We clarified this issue in the manuscript by adding a note in the Figure Legends. 5) We performed several additional experiments and we always confirmed the same result. In addition, we quantified our results using Image J program to evaluate the Cytoplasmic/Nuclear ratio of cell fluorescence. A graph representing the Cytoplasmic/Nuclear ratio of cell fluorescence intensity using Image J program has been added in Figure 3. 6) To evaluate this issue we investigated survival rates of the same 77 patients classified into three distinct subtypes: Mesenchymal (23 cases), Proneural (30 cases) and Proliferative (24 cases). Patients belonging to each subtype were stratified in high and low Caspase-8 expression, based on the distribution of Caspase-8 probe intensities specific for each subtype. We could observe a significantly difference of Caspase-8 expression levels between the Proneural and the Mesenchymal and Proliferative GBMs and therefore we used different thresholds for each subtype (Figure 4—figure supplement 2). For patients classified as Proneural (which are generally characterized by lower Caspase-8 expression), those having higher Caspase-8 expression show significantly lower survival chance (Chi-squared 7.2 on 1 degree of freedom, p-value 0.00732), while no difference was observed for the Mesenchymal and Proliferative subtypes. These data have been included in Figure 4—figure supplement 2. We can speculate that the effect of an increase of Caspase-8 expression level may be more relevant in the tumor subtype that is characterized by lower Caspase-8 expression levels. Future experiments will be required to 1) better clarify this issue extending the study to other GBM databases; 2) further clarify the molecular requirement for Caspase-8 function in GBM.
Primer sequences list
IL-6-FW5’- CAGGAGCCCAGCTATGAACT -3’
IL-6-REV5’-GAAGGCAGCAGGCAACAC- 3’
IL-8-FW5’-GGTGCAGTTTTGCCAAGGAG-3’
IL-8-RV5’-TGGGGTGGAAAGGTTTGGAG-3’
VEGF-FW5’-CCTTGCTGCTCTACCTCCAC-3’
VEGF-RV5’-CAACTTCGTGATGATTCTGC-3’
CCL2-MCP1-FW5’-CTTCATTCCCCAAGGGCTCG-3’
CCL2-MCP1-RV5’-GCTTCTTTGGGACACTTGCTG-3’
TNFA-FW5’-GGGACCTCTCTCTAATCAGC-3’
TNFA-RV5’-TCAGCTTGAGGGTTTGCTAC-3’
TBP-FW5’-TGCCCGAAACGCCGAATATAATC-3’
TBP RV5’-TGGTTCGTGGCTCTCTTATCCTC-3’
CASP8-FW5’- CAGCAGCCTTGAAGGAAGTC -3’
CASP8-RV5’-CGAGATTGTCATTACCCCACA-3’
  33 in total

1.  Essential role for caspase-8 in Toll-like receptors and NFkappaB signaling.

Authors:  Bénédicte Lemmers; Leonardo Salmena; Nicolas Bidère; Helen Su; Elzbieta Matysiak-Zablocki; Kiichi Murakami; Pamela S Ohashi; Andrea Jurisicova; Michael Lenardo; Razqallah Hakem; Anne Hakem
Journal:  J Biol Chem       Date:  2007-01-09       Impact factor: 5.157

2.  Coupling of a signal response domain in I kappa B alpha to multiple pathways for NF-kappa B activation.

Authors:  J A Brockman; D C Scherer; T A McKinsey; S M Hall; X Qi; W Y Lee; D W Ballard
Journal:  Mol Cell Biol       Date:  1995-05       Impact factor: 4.272

3.  BH4 domain of bcl-2 protein is required for its proangiogenic function under hypoxic condition.

Authors:  Chiara Gabellini; Teresa De Luca; Daniela Trisciuoglio; Marianna Desideri; Marta Di Martile; Daniela Passeri; Antonio Candiloro; Mauro Biffoni; Maria Giulia Rizzo; Augusto Orlandi; Donatella Del Bufalo
Journal:  Carcinogenesis       Date:  2013-07-08       Impact factor: 4.944

4.  ATM kinase sustains HER2 tumorigenicity in breast cancer.

Authors:  Venturina Stagni; Isabella Manni; Veronica Oropallo; Marcella Mottolese; Anna Di Benedetto; Giulia Piaggio; Rita Falcioni; Danilo Giaccari; Selene Di Carlo; Francesca Sperati; Maria Teresa Cencioni; Daniela Barilà
Journal:  Nat Commun       Date:  2015-04-16       Impact factor: 14.919

5.  Src kinase phosphorylates Caspase-8 on Tyr380: a novel mechanism of apoptosis suppression.

Authors:  Silvia Cursi; Alessandra Rufini; Venturina Stagni; Ivano Condò; Vittoria Matafora; Angela Bachi; Antonio Paniccià Bonifazi; Luigi Coppola; Giulio Superti-Furga; Roberto Testi; Daniela Barilà
Journal:  EMBO J       Date:  2006-04-13       Impact factor: 11.598

Review 6.  Interleukins in glioblastoma pathophysiology: implications for therapy.

Authors:  Y T Yeung; K L McDonald; T Grewal; L Munoz
Journal:  Br J Pharmacol       Date:  2013-02       Impact factor: 8.739

7.  Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis.

Authors:  Heidi S Phillips; Samir Kharbanda; Ruihuan Chen; William F Forrest; Robert H Soriano; Thomas D Wu; Anjan Misra; Janice M Nigro; Howard Colman; Liliana Soroceanu; P Mickey Williams; Zora Modrusan; Burt G Feuerstein; Ken Aldape
Journal:  Cancer Cell       Date:  2006-03       Impact factor: 31.743

Review 8.  Nuclear factor-κB in glioblastoma: insights into regulators and targeted therapy.

Authors:  Kirk E Cahill; Ramin A Morshed; Bakhtiar Yamini
Journal:  Neuro Oncol       Date:  2015-11-02       Impact factor: 12.300

9.  Loss of caspase-8 protein expression correlates with unfavorable survival outcome in childhood medulloblastoma.

Authors:  Carmen Pingoud-Meier; Doris Lang; Anna J Janss; Lucy B Rorke; Peter C Phillips; Tarek Shalaby; Michael A Grotzer
Journal:  Clin Cancer Res       Date:  2003-12-15       Impact factor: 12.531

10.  RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome.

Authors:  Bo Li; Colin N Dewey
Journal:  BMC Bioinformatics       Date:  2011-08-04       Impact factor: 3.307

View more
  17 in total

1.  Regorafenib Reverses Temozolomide-Induced CXCL12/CXCR4 Signaling and Triggers Apoptosis Mechanism in Glioblastoma.

Authors:  I-Tsang Chiang; Yu-Chang Liu; Hua-Shan Liu; Ahmed Atef Ahmed Ali; Szu-Yi Chou; Tsung-I Hsu; Fei-Ting Hsu
Journal:  Neurotherapeutics       Date:  2022-03-10       Impact factor: 6.088

Review 2.  Targeting apoptotic caspases in cancer.

Authors:  Ashley Boice; Lisa Bouchier-Hayes
Journal:  Biochim Biophys Acta Mol Cell Res       Date:  2020-02-19       Impact factor: 4.739

Review 3.  How do phosphodiesterase-5 inhibitors affect cancer? A focus on glioblastoma multiforme.

Authors:  Mehdi Sanati; Samaneh Aminyavari; Hamid Mollazadeh; Bahram Bibak; Elmira Mohtashami; Amir R Afshari
Journal:  Pharmacol Rep       Date:  2022-01-20       Impact factor: 3.024

4.  Transcriptome analysis of clock disrupted cancer cells reveals differential alternative splicing of cancer hallmarks genes.

Authors:  Deeksha Malhan; Alireza Basti; Angela Relógio
Journal:  NPJ Syst Biol Appl       Date:  2022-05-12

5.  CCL2-SQSTM1 positive feedback loop suppresses autophagy to promote chemoresistance in gastric cancer.

Authors:  Wenxia Xu; Qi Wei; Mengjiao Han; Bingluo Zhou; Hanying Wang; Jianbing Zhang; Qiang Wang; Jie Sun; Lifeng Feng; Shouyu Wang; Yang Ye; Xian Wang; Jianwei Zhou; Hongchuan Jin
Journal:  Int J Biol Sci       Date:  2018-06-03       Impact factor: 6.580

Review 6.  Caspase-8: A Novel Target to Overcome Resistance to Chemotherapy in Glioblastoma.

Authors:  Giulia Fianco; Claudia Contadini; Alessandra Ferri; Claudia Cirotti; Venturina Stagni; Daniela Barilà
Journal:  Int J Mol Sci       Date:  2018-11-29       Impact factor: 5.923

7.  Pharmacological Inhibition of Caspase-8 Suppresses Inflammation-Induced Angiogenesis in the Cornea.

Authors:  Yunzhe Tian; He Li; Xiuxing Liu; Lihui Xie; Zhaohao Huang; Weihua Li; Zhuang Li; Yuan Pan; Xiaoqing Chen; Wenru Su
Journal:  Biomolecules       Date:  2020-01-31

8.  SNHG16 promotes tumorigenesis and cisplatin resistance by regulating miR-338-3p/PLK4 pathway in neuroblastoma cells.

Authors:  Zhaoying Xu; Yongfa Sun; Danfeng Wang; Huifang Sun; Xiaojun Liu
Journal:  Cancer Cell Int       Date:  2020-06-12       Impact factor: 5.722

Review 9.  SRC Kinase in Glioblastoma News from an Old Acquaintance.

Authors:  Claudia Cirotti; Claudia Contadini; Daniela Barilà
Journal:  Cancers (Basel)       Date:  2020-06-12       Impact factor: 6.639

Review 10.  Glioblastoma Chemoresistance: The Double Play by Microenvironment and Blood-Brain Barrier.

Authors:  Martina Da Ros; Veronica De Gregorio; Anna Lisa Iorio; Laura Giunti; Milena Guidi; Maurizio de Martino; Lorenzo Genitori; Iacopo Sardi
Journal:  Int J Mol Sci       Date:  2018-09-22       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.