Literature DB >> 28580932

Evidence for fungal and chemodenitrification based N2O flux from nitrogen impacted coastal sediments.

Scott D Wankel1, Wiebke Ziebis2, Carolyn Buchwald1, Chawalit Charoenpong1, Dirk de Beer3, Jane Dentinger2, Zhenjiang Xu4, Karsten Zengler4.   

Abstract

Although increasing atmospheric nitrous oxide (N2O) has been linked to nitrogen loading, predicting emissions remains difficult, in part due to challenges in disentangling diverse N2O production pathways. As coastal ecosystems are especially impacted by elevated nitrogen, we investigated controls on N2O production mechanisms in intertidal sediments using novel isotopic approaches and microsensors in flow-through incubations. Here we show that during incubations with elevated nitrate, increased N2O fluxes are not mediated by direct bacterial activity, but instead are largely catalysed by fungal denitrification and/or abiotic reactions (e.g., chemodenitrification). Results of these incubations shed new light on nitrogen cycling complexity and possible factors underlying variability of N2O fluxes, driven in part by fungal respiration and/or iron redox cycling. As both processes exhibit N2O yields typically far greater than direct bacterial production, these results emphasize their possibly substantial, yet widely overlooked, role in N2O fluxes, especially in redox-dynamic sediments of coastal ecosystems.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28580932      PMCID: PMC5465357          DOI: 10.1038/ncomms15595

Source DB:  PubMed          Journal:  Nat Commun        ISSN: 2041-1723            Impact factor:   14.919


Nitrogen (N) loading from anthropogenic activities profoundly impacts ecosystems worldwide, with loading to coastal zones among the largest challenges facing humanity, as nearly half the global population lives within 100 km of the coast. Coastal sediments are known hotspots of biogeochemical transformations and recognized as effective agents for removing excess nitrogen12. However, biological removal of reactive nitrogen may also occur at the expense of increased production of nitrous oxide (N2O), a potent climatically active trace gas. Despite being the largest ozone depleting substance currently emitted to the atmosphere3, N2O remains unregulated by the international community and large uncertainties exist concerning N2O budgets (>100%), particularly for heterogeneous environments such as coasts45. Redox-dynamic estuarine and coastal sediments routinely experience high N loading and low dissolved oxygen (O2), conditions that are strongly linked to elevated N2O and underlie their estimated 10% contribution to the global N2O flux46789. Thus, understanding their role in both nitrogen removal and N2O production is important for improving predictions of long-term impacts of human activity across globally relevant scales. Many studies have focused on the relative contribution of bacterial denitrification (bDNF) or nitrification (oxidation of ammonia (NH3) to nitrite (NO2−) or ‘AMO'), as controlling processes underlying N2O emissions (Fig. 1). While yields of N2O from both AMO and bDNF are low (<1% in terms of total moles of N converted), their magnitude and ubiquity across ecosystems translates into major atmospheric fluxes. Increasingly, however, the potential for other N2O production processes has become apparent, including production of N2O by fungi and/or abiotic reactions coupled to redox cycling of metals such as iron101112. In particular, the organic-rich and redox-dynamic regimes of estuarine and coastal sediments may promote both fungal activity and rapid redox cycling of iron. To examine controls and mechanisms of N2O production in coastal sediments (Fig. 1), we incubated natural sediment cores under flow-through conditions, manipulating both dissolved O2 and nitrate in the overlying water (using conditions typifying anthropogenically impacted ecosystems), while monitoring both porewater N2O profiles and stable isotopic fluxes of ammonium, nitrate, nitrite and N2O. Given the complexity of processes involved, we also leveraged the use of a less-traditional isotope system (17O, described below) to provide even broader perspective for disentangling operative N2O cycling mechanisms.
Figure 1

Schematic representation of N2O production pathways considered in this study.

N2O can form during decomposition/reaction of intermediate hydroxylamine (NH2OH) produced during ammonia oxidation by bacteria (bAMO) or archaea (aAMO). Some of these nitrifying organisms may also produce N2O during reduction of product nitrite (NO2−), known as nitrifier-denitrification (nDNF). N2O may also be produced during reduction of nitrate and/or nitrite by denitrification catalysed by bacteria (bDNF), fungi (fDNF) and/or by chemical reaction with Fe(II) or ‘chemodenitrification' (cDNF). Finally, N2O can also be reductively consumed by denitrifying bacteria (N2ORED). N2O produced having low or negative site preference values (−10 to 0‰) are indicated in blue, while those have high site preference values (>15‰) are indicated in green. Enzymes are indicated as ammonia monooxygenase (AMO), hydroxylamine oxidoreductase in bacterial nitrification (HAO), nitrate reductase (NAR), nitrite reductase (NIR), bacterial nitric oxide reductase (cNOR), nitrous oxide reductase (NOS) and fungal nitric oxide reductase (p450NOR). The detailed biochemical pathway of nitrite production by archaeal ammonia oxidation remains unclear.

The steady-state emission flux of N2O (FN2O) is governed by six possible production fluxes (F) (Fig. 1; bacterial denitrification (bDNF), fungal denitrification (fDNF), chemodenitrification (cDNF; specifically the abiotic reduction of NO2− to N2O by Fe(II)), ammonia oxidation by bacteria (bAMO) or archaea (aAMO) and nitrifier-denitrification (nDNF)), as well as respiratory consumption by denitrifying bacteria (N2ORED) such that: Stable isotopes of N2O have been widely used for studying its production and consumption, including both oxygen (18O/16O) and bulk nitrogen (15N/14N) (δ=(((Rsample/Rstandard)−1) × 1,000) and R=15N/14N or 18O/16O)13141516171819. In addition, the unique intra-molecular distribution of 15N within N2O molecules has emerged as a powerful tool for constraining N2O cycling, as differences in 15N content between the central ‘α' and outer ‘β' atoms of the N2O molecule (‘site preference' or SPN2O, where SPN2O15Nα−δ15Nβ) have been shown to reflect formation pathways13141618. Numerous studies have measured the steady-state δ15N offset between precursor molecules (NO3−, NO2− and NH4+) and N2O (‘Δδ15N'=δ15Nsource−δ15NN2Obulk), as well as SPN2O values towards characterizing signature compositions for the processes in equation 1. Some compositional overlap notwithstanding, the isotopic separation of many of these endmembers has been used to distinguish their relative contribution to N2O production, especially nitrification and denitrification141920. Notably, the respiratory reduction of N2O by denitrifying bacteria can increase the δ15Nbulk of the remaining N2O (decreasing Δδ15N values), as well as SPN2O values (with a distinctive relationship between isotope effects imparted on the δ15N of the bulk N2O and its site preference, 15ɛbulk and SPɛ, respectively2122) modifying mixing relationships. Nevertheless, measured values of Δδ15N and SPN2O are quantitative integrators of the proportion of each process (which may then be modified by N2O reduction; see Methods), serving as independently responsive tracers for constraining production mechanisms. To further interrogate N2O dynamics, we also used a natural atmospherically derived NO3− having an unusual triple oxygen isotopic composition (containing excess 17O) that provides novel ‘isotope space' for further resolving co-occurring processes. By comparing levels of 17O-excess within discrete N pools (see Methods), we are able to independently quantify the proportion of N2O deriving from NO3− (or NO2−) and thereby, in concert with the more conventional isotopic measurements (Δδ15N, SP), uniquely explain variations in N2O producing pathways. Below we summarize our results, combining microprofile perspectives with the use of these mass and isotopic fluxes to constrain N2O production mechanisms in coastal sediments of the Wadden Sea under a variety of incubation conditions (Supplementary Fig. 1). Specifically, we find that the isotopic composition of increased N2O fluxes resulting from elevated nitrate loading in our incubations requires substantial contribution by processes not regularly considered in coastal ecosystems, namely fungal and/or chemodenitrification. We suggest that variations in the contribution of these processes to N2O fluxes from coastal and other ecosystems may help to explain the notorious variability that is frequently encountered in studies of N2O dynamics.

Results

Microsensor and mass flux perspectives on N2O

Microsensor profiles revealed shallow O2 penetration (∼2–3 mm) typical of high-respiration rates occurring in organic-rich sediments, with occasional subsurface peaks in O2 reflecting bioturbation/bioirrigation (Fig. 2a). N2O profiles revealed striking vertical and lateral heterogeneity in location, magnitude and distribution of N2O, reflecting the complexity of N2O dynamics (Fig. 2b–f). Elevated N2O was often observed near the sediment–water interface, suggesting oxidative production by AMO. However, zones of extremely elevated N2O (>3 μM, not shown) were also observed much deeper, highlighting its spatial heterogeneity. In some cases, subsurface N2O appeared connected with the overlying water, co-occurring near subsurface O2 peaks and reflecting oxidative N2O production despite reducing surroundings. In others, elevated N2O coincided with anoxic conditions, suggesting N2O production by reductive pathways (Fig. 2b). Several cores had active burrows extending into the sediment, likely contributing to this heterogeneity. In part, these observations extend the view of N2O dynamics to slightly deeper sediment layers, in contrast to previous observations mostly focusing on dynamics in the upper 1 cm (refs 23, 24). This remarkable heterogeneity, often even laterally within a single core, hinders straightforward N2O flux calculations, yet emphasizes the utility of the whole core incubation stable isotope approach, which integrates this natural heterogeneity and provides a complementary and mechanistic perspective on underlying N2O dynamics.
Figure 2

Example microsensor profiles of O2 and N2O from sediment core incubations from the Mischwatt site illustrating typical heterogeneity observed.

Rapid consumption of O2 in the upper 2–3 mm (a) reflects the high organic matter content and respiration rates of these sediments. Depth profiles of N2O are shown in b through f. ‘Field' profile (b) reflects conditions immediately upon core collection. Profiles from experiment cores reflect porewater conditions after ∼7–8 days of incubation under low NO3− (c), low O2 and low NO3− (d), high NO3− (e) and low O2 and high NO3− (f). The complexity in the structure of the N2O profiles—including subsurface zones of production likely influenced by bioirrigation—complicate their use in conventional flux estimation by porewater models.

In contrast to the oxidative N2O production captured by the micro-profiles at the sediment–water interface, mass fluxes suggest an important role for reductive N2O production. Nitrate levels in the overlying water were closely related to N2O flux from the sediment, with net efflux of N2O from the sediment in all cases ranging from 1.4 up to 84.2 μmoles m−2 d−1 (Table 1; Supplementary Fig. 1; Supplementary Table 2). While fluxes of N2O under low nitrate conditions averaged 17.8 μmoles m−2 d−1 (Table 1), decreasing dissolved O2 saturation to ∼30% reduced N2O fluxes (5.9 μmoles m−2 d−1). In contrast, addition of NO3− to the overlying water significantly increased N2O (as well as NO2−) fluxes (Table 1) to the water column, consistent with other studies linking elevated coastal NO3− loading with efflux of N2O to the atmosphere6825. Corresponding NO3− consumption also increased significantly, reflecting diffusion-limitation of organic matter respiration (Table 1; Supplementary Fig. 1; Supplementary Table1).
Table 1

Steady state mass fluxes of measured nitrogen species.

 NO3 flux (mmolm2d1)NO2 flux (mmolm2d1)NH4+ flux (mmolm2d1)N2O flux (μmolm2d1)
Mean by treatment
Low NO3−4.7±1.10.7±0.37.1±1.717.8±6.5
Low O2, Low NO3−4.1±1.00.7±0.38.3±1.25.9±6.6
High NO3−10.4±1.41.3±0.28.6±1.449.0±18.5
Low O2, High NO3−17.4±2.12.4±0.77.1±1.451.1±23.1
Mean by site
Mud (MD)−9.4±1.21.1±0.410.7±1.431.9±17.0
Mixed (MX)−7.6±1.81.2±0.27.9±1.331.1±12.3
Sand (SD)−10.5±1.31.5±0.64.7±1.529.9±11.7

Mean values are shown grouped either by treatment type or by site. Negative values refer to uptake by the sediments.

Multi-isotope analysis of underlying N2O cycling processes

The stable isotopic composition of N2O and other nitrogen pools (Table 2; Supplementary Table 2) provides additional insight into specific biogeochemical mechanisms regulating sedimentary N2O fluxes. Average SPN2O for low-nitrate (LN) and low-O2/low-nitrate (LOLN) experiments were not significantly different (7.2±3.4 and 6.2±3.2‰, respectively) and, together with small differences between effluent NO3− and N2O δ15N (Δδ15N) indicate that N2O fluxes were largely linked to bacterial denitrification (having low SPN2O) that was limited by diffusive supply of NO3− (yielding low Δδ15N) (Fig. 3), a common characteristic of organic-rich sediments26. Notably, SPN2O values were higher than values expected from bDNF alone, however, reflecting contribution by additional N2O cycling processes.
Table 2

Steady state isotopic composition of measured nitrogen species.

 NO3
NO2
TRNN2O
 δ15NΔ17Oδ15NΔ17Oδ15Nδ15NΔ17OSP
By treatment
Low O2 (LO)14.0±1.0^6.6±2.2^11.9±1.113.7±1.7^7.2±3.4
Low O2, Low NO3 (LOLN)14.0±0.6^7.7±2.7^11.6±1.914.5±2.0^6.2±3.2
High NO3 (HN)4.6±0.214.7±0.7−1.2±1.88.5±2.411.9±1.10.0±0.66.5±1.216.2±5.0
Low O2, High NO3 (LOHN)5.3±0.514.7±0.6−1.5±1.99.2±3.212.9±6.8−0.7±1.15.4±1.312.9±2.5
By site
Mud (MD)9.2±0.515.2±0.71.6±1.95.4±2.512.0±1.7*6.4±1.25.3±1.512.5±4.3
Mixed (MX)9.4±0.614.5±0.62.8±1.710.0±2.313.5±1.55.8±0.96.6±1.26.4±3.5
Sand (SD)9.9±0.614.5±0.64.3±2.811.1±3.511.1±2.68.3±1.95.9±1.113.0±3.0
Inflow 
Low O2 (LO)12.7±1.20.0±0.6NDND^5.7±0.6^17.4±1.0
Low O2, Low NO3 (LOLN)11.7±0.50.0±0.6NDND^5.7±0.6^17.4±1.0
High NO3 (HN)4.3±0.315.3±0.7NDND^5.7±0.6^17.4±1.0
Low O2, High NO3 (LOHN)3.9±0.315.0±0.5NDND^5.7±0.6^17.4±1.0

Mean values are shown for either treatment type or by site. Values are also shown for the water used as inflow. All values are in units of permil (‰) with error indicated as ±1 s.d. based on all measurements conducted during steady-state conditions. TRN refers to total reduced nitrogen equal to the combined NH4+ and dissolved organic nitrogen pool. ND=not detected. Δ17O was only measured in effluent of experiments in which NO3− was amended. The symbol (^) indicates no measurements were made.

Figure 3

Multiple isotope plot of N2O illustrating predicted compositional fields of various processes as well as steady-state composition of N2O fluxes from incubations.

For illustrating representative compositional fields of N2O production processes (boxes), ranges are taken from literature reports of the offset between precursor molecule and predicted N2O (Δδ15N, or the difference in δ15N between NH4+ and N2O for bacterial and archaeal ammonia oxidation, between NO2− and N2O for chemodenitrification or between NO3− and N2O for denitrification). References (in parentheses) include for (A) bacterial denitrification208384, (B) nitrifier-denitrification59, (C) bacterial ammonia oxidation20598485, (D) archaeal ammonia oxidation565758, (E) chemodenitrification474849, (F) fungal denitrification37424344 and (G) bacterial N2O reduction212286, which has been shown to result in a coupled increase in δ15N and SP of the remaining N2O pool (indicated by arrows). Experimental x-axis data are δ15NNO3–δ15NN2O. Error bars in the y-direction are 1 s.d., while in the x-direction error is smaller than the symbols. Note that for mass balance calculations the actual measured steady-state isotope values of precursor molecules (for example, NH4+ or NO3−) were used as appropriate for constraining endmember values of each process. In general, addition of ∼100 μM NO3− to the overlying water increased N2O fluxes with an accompanying increase in N2O site preference, while not decreasing the Δδ15N (as would be expected from N2O reduction, arrows), implicating an increased production of N2O from a process deriving from NO3− (or NO2−) yet also one yielding an elevated site preference such as chemodenitrification and/or fungal denitrification.

In contrast, the increased N2O fluxes under elevated NO3− exhibited higher SPN2O relative to low nitrate experiments, averaging 16.2±5.0 and 12.9±2.5‰ for the high-nitrate (HN) and low-O2/high nitrate (LOHN), respectively (Fig. 3, Table 2), and indicating a shift in N2O dynamics. This increase in SPN2O, however, was not accompanied by an increase in δ15N of the N2O pool (no apparent decrease in Δδ15N), as would be expected by increased N2O reduction2127. This observation implicates the stimulation of processes that produce N2O with high SPN2O—namely, b/aAMO, fDNF and/or cDNF. Below, we use the triple oxygen isotopes of co-existing NO3−, NO2− and N2O to further examine these candidate processes responding to elevated NO3− loading.

Triple oxygen isotopes as a tool for constraining nitrogen cycling

Our multi-pool Δ17O measurements enable disentangling of processes that are otherwise overlapping (in SPN2O values, for example), providing a complementary perspective to the N isotope analyses. First, these analyses revealed that nitrification played a relatively small role in NO3− production. As noted, amended nitrate had a high Δ17ONO3 value (+18.5‰), which when combined with pre-existing nitrate in the supply seawater17ONO3=0‰) yielded a Δ17ONO3 of ∼ +15.3‰ (Table 2). As changes to this Δ17ONO3 value occur only by production of new nitrate during nitrification2829, the small differences in Δ17ONO3 between the inflow and effluent (at most 0.8‰; Table 2), reflect small relative contribution of newly produced NO3− by nitrification. Comparatively, Δ17ON2O values averaged +6.5 and +5.4‰ for high nitrate (HN) and low O2/high nitrate (LOHN), respectively. These are lower than the corresponding Δ17ONO3 (Table 2), yet unequivocally reflect transfer of NO3− derived O atoms into the N2O flux. Whether the lower Δ17ON2O (relative to Δ17ONO3) stems from production of N2O by processes having a precursor other than NO3− (for example, bAMO/aAMO) or from the equilibration of intermediate NO2− with water (also causing Δ17O to approach 0‰) cannot be ascertained by comparing Δ17ONO3 and Δ17ON2O (equation 2). However, Δ17ONO2 values were also typically lower than steady-state Δ17ONO3, averaging +8.5 and +9.2‰, respectively (Table 2). While non-zero Δ17ONO2 values reflect reduction of NO3− to NO2− (since Δ17O is conserved), Δ17ONO2 values lower than steady-state Δ17ONO3 values must reflect NO2− production by ammonia oxidation (bAMO or aAMO) and/or partial equilibration of NO2− with water. Regardless, comparison of steady-state Δ17ON2O with Δ17ONO2 (equation 5) indicates an average of 70–80% of the N2O derived from a NO2− precursor under high NO3− incubations and thus indicates that the increased production occurred via reductive pathways (Fig. 4) and not by a/bAMO. Together with the elevated SPN2O and only small changes in Δδ15N, this suggests fungal and/or chemodenitrification as possible contributors (Fig. 4). Both fDNF and cDNF are dependent on supply of NO2− and typically exhibit yields far greater than bacterial N2O production (that is, the relative amount of N2O emitted per mole of NO3− or NO2− reduced or NH3 oxidized). Thus, only small levels of these processes would be required to contribute relatively large amounts of N2O—setting the stage for a potentially important role for these biogeochemical processes in regulating N2O fluxes wherever they occur.
Figure 4

Comparison of steady state triple oxygen isotope composition of N2O and NO2− with SPN2O for experiments amended with NO3−.

Endmember composition for the y-axis was based on the assumption that bacterial, fungal and chemodenitrification are utilizing the steady-state NO2− pool as a substrate (where Δ17ONO2=steady-state value), while nitrifier-denitrification uses only NO2− derived directly from NH4+ oxidation (Δ17ONO2=0‰). Increases in SPN2O values may be caused by N2O reduction (Ostrom et al.21; Jinuntuya-Nortman et al.86), however, this mass dependent process will only impact SPN2O and not alter Δ17O values (horizontal arrow). Error bars represent±1 σ for SPN2O and propagated error for Δ17ON2O/Δ17ONO2. Data demonstrate that associated increases in SPN2O upon elevated NO3− is not associated with ammonia oxidation, but instead is linked to increased contribution of fungal and/or chemodenitrification.

Discussion

Diversity and abundance of fungi in oxygen-depleted coastal sediments is generally thought to represent a small fraction of their soil-hosted counterparts303132. Nevertheless, their ecological role remains unclear—with recent studies challenging the perspective that fungi are only ecologically significant under aerobic conditions313233. Adapted for organic-rich environments often depleted in O2, many fungi have a range of cellular adaptations to life under suboxic conditions32343536, including the ability to couple denitrification37 directly to mitochondrial respiration38—a metabolic capacity that has been documented in a variety of environments including coastal sediments3439. Given this respiratory flexibility, fDNF is poised to be especially important under hypoxic conditions and wetland environments, where access to O2 in overlying water is juxtaposed with anoxic, carbon-rich conditions40. The most characteristic feature of the fungal-denitrifying system is a P450 cytochrome operating as a nitric oxide reductase (P450nor)41 giving rise to the characteristically high SP of ∼35–37‰ (refs 42, 43), the biochemical nature of which was recently interrogated in the purified enzyme44. Although assessment of fungal metabolic activity was beyond our scope, sequencing of the fungal ITS region revealed the presence of fungi across all incubations and study sites (Supplementary Fig. 3), indicating diverse sequences including members of several divisions, some of which include N2O producing isolates37. While their presence does not confirm specific physiological activity involved in nitrogen transformations, taken together our results point to an unexplored role of fungi in coastal sedimentary N cycling. In particular, as fungi lack N2O reductase38, yields from fDNF are also typically 1–2 orders of magnitude greater than for bDNF (generally <0.1%) and N2O production appears to be physiologically widespread among fungi37. Indeed the importance of fungi in contributing to N2O production is well-recognized across a range of terrestrial ecosystems45. While their overall role in the reductive elimination of reactive N may be small relative to that of bacterial denitrification, these high yields mean that even small levels of fDNF could have disproportionately large impacts on N2O release, serving as an important, yet under-recognized source to the atmosphere. Although biological N2O production has received much attention, abiotic production of N2O is also widely documented, typically via reactions involving intermediates such as NH2OH and NO2−—though its environmental role remains unclear (Zhu-Barker et al.11, and references therein). Specifically, reduced iron (Fe(II)), especially mineral or surface-bound Fe(II), is an effective catalyst of NO2− reduction under a range of conditions46, and the presence of mineral surfaces and elevated levels of Fe(II) has also been shown to increase N2O yield4748. Although data are limited, SPN2O from chemodenitrification is generally >10‰ and recent evidence suggests that elevated reaction rates, promoted by high levels of Fe(II), may also increase SPN2O (up to 26‰) (4748495051). The production of reactive Fe(II) as the result of direct or indirect microbial activity is a ubiquitous feature of marine sediments. Our sites contained between 67 and 1344 μM HCl-extractable Fe(II) g−1 wet sediment (Supplementary Fig. 4). However, prediction of reaction kinetics between Fe(II) and NO2− in these porewater environments is complex, particularly given the range of binding environments of Fe(II), which largely controls its reactivity5253. Nonetheless, the positive flux of NO2− together with the porewater Fe(II) levels suggests that cDNF may also have contributed to N2O production. Interestingly, however, despite its lower Fe(II), the sandy site (SD) exhibited similar overall N2O isotope dynamics to the other two more Fe-rich sites (Table 2), suggesting that perhaps the increased response of N2O production to NO3− loading was perhaps not as tightly linked to Fe(II) content. On the basis of the isotope systematics described, we use an isotope mass balance (based on equations 1, 2, 5 and 6 and defined endmember compositions (Supplementary Table 3)) to estimate relative contribution of operative N2O producing mechanisms (see Methods). While fDNF and cDNF are not mutually exclusive, we consider them separately to more robustly evaluate their potential contribution. Previous studies appear to demonstrate a strong relative dominance of ammonia oxidizing bacterial abundance compared to archaea in organic-rich coastal sediments5455. An assumed numerical dominance of bacterial ammonia oxidizers notwithstanding, pure culture studies of archaeal ammonia oxidizers typically produce N2O reflecting a isotopic compositional mixture of both the AMO and nDNF pathways565758, as has been more directly characterized in bacterial ammonia oxidizers59. Ongoing studies of N2O production mechanisms in ammonia oxidizing archaea will undoubtedly provide more insight on their unique biochemical nature. Differences in biochemistry aside, however, given the apparent similarity in isotopic composition of N2O deriving from bAMO and aAMO (especially a high SPN2O value, Figs 3 and 4), here we opt to combine bacterial and archaeal AMO for consideration in our mass balance analysis—setting endmember values to those previously determined for bAMO, as these have been studied in far more detail59. Thus, for elevated nitrate experiments (in which we can leverage the use of the positive Δ17O), we consider N2O production by bDNF, nDNF and AMO (bAMO+aAMO) together with either fDNF or cDNF (Supplementary Table 4), while also examining the relative influence of N2O reduction on the calculated steady-state contributions of each process (see Methods). Error was estimated using a Monte Carlo approach in R with 10,000 simulations (Supplementary Table 4; see Supplementary Information for a more detailed sensitivity analysis of endmember composition). Under elevated nitrate, mass balance indicates N2O production predominantly driven by varying contribution of bacterial and fungal denitrification (Fig. 5; Supplementary Table 4). For the base case (Supplementary Table 3), fungal denitrification contributed on average 36% of the N2O flux (up to 70% in one core). In evaluating the sensitivity of these estimates to endmember composition, this average value increased to 41 or 56% (if using a lower SP value of 30.3‰ for fDNF or a lower Δδ15N value for the nDNF endmember, respectively; Supplementary Table 5) or decreased to 28% (if all nDNF derived N2O were to originate from NO2− having a positive Δ17O value instead of 0‰; Supplementary Table 6). In contrast, ammonia-oxidation contributed on average only 3–12% (via NH2OH decomposition) and 8–17% (via nDNF) for the base case. Consideration of cDNF (in lieu of fDNF) as the endmember having both a high SPN2O and a NO2− precursor required an even higher proportion of this process to satisfy mass balance (Supplementary Table 4). However, two cores in this case exhibited isotopic compositions violating mass balance (those with highest SPN2O), evidently requiring at least some contribution of fDNF (having a higher endmember SPN2O) over cDNF. Although the LN and LOLN treatments did not involve the Δ17O approach, the statistically higher SPN2O values under elevated nitrate (relative to low nitrate; Fig. 3, Supplementary Table 2) point to a shift in N2O production mechanisms in response to NO3−, which must have included increased contribution by fDNF and/or cDNF. Ultimately, while the precise contribution of N2O pathways varies depending on prescribed endmember compositions, all scenarios indicated substantial contribution by these non-traditional N2O production pathways.
Figure 5

Relative contribution of N2O produced by four cycling processes as calculated by N2O isotope mass balance.

Each bar reflects steady-state calculations using measurements from a single core incubation (two cores were incubated per site per treatment and are shown separately), considering bacterial denitrification, ammonia oxidation, nitrifier denitrification and fungal denitrification. For illustration of the relative influence that N2O reduction (and its associated isotope fractionation) plays in the mass balance estimates, scenarios of both low (10%, upper) and high (90%, lower) relative N2O consumption are considered for each core (right side axis). Contribution by processes where mass balance estimates yielded small negative values (Supplementary Table 4) were considered equal to zero for this figure, with other values weighted accordingly to sum to 100%. The reader is also referred to Supplementary Table 4 for associated error in mass balance estimates calculated by Monte Carlo simulation, as well as Supplementary Tables 5 and 6 for sensitivity analyses of alternative endmember compositions.

Increased N2O emissions from coastal systems receiving elevated NO3− are well documented489 and the ‘central role' of NO2− in relation to N2O has been emphasized by others6. For example, large increases in N2O from sediments amended with NO2− (relative to NO3−) was previously interpreted as evidence for ‘obligate nitrite-denitrifying bacteria' that reduce NO2− to N2O (ref. 6). Similarly, based on SPN2O it was concluded that N2O production in estuarine sediments was controlled by an as yet ‘unidentified process'60 having an isotopic composition consistent with more recent studies of fungal and chemodenitrification. On the basis of our results, we suggest that these previously ‘missing' and/or ‘unidentified' pathways likely represent non-traditional pathways including denitrification catalysed either by fungi or reactions involving Fe(II). To the degree that our sediment incubations reflect processes ongoing under natural conditions, elevated NO3− loading to coastal sediments appears to increase N2O fluxes largely through reactions involving a NO2− intermediate, yet also exhibiting elevated SP values. This combination of characteristics pinpoints an increased involvement of processes not regularly considered in coastal ecosystems—namely fungal and chemodenitrification. We suggest that both may represent important, yet under-appreciated sources regulating N2O fluxes from redox-dynamic, organic-rich environments and warrant further examination. Studies are frequently challenged by the dynamic nature of N2O fluxes, which are often episodic and difficult to link to specific factors or processes (for example, refs 23, 25). Although our study was conducted at steady-state (enabling our assessment of fDNF and cDNF), we posit that the commonly observed patchy and dynamic nature of N2O fluxes may stem from a complex network of differential contribution by direct and indirect, biological and abiotic processes, including the metabolic activity of fungi and biogeochemical redox cycling of iron. In particular, compared to bacterial denitrification and/or ammonia oxidation, their especially high yields poise these processes to be important, yet under-recognized, contributors to N2O dynamics in many systems.

Methods

Study site and experimental setup

Twenty-four sediment cores were collected in August of 2013, from three intertidal sites near Königshafen on the island of Sylt in the North Sea, Germany. Sites were ∼100 m apart and chosen based on qualitative differences in sediment grain size and location characteristics. The ‘Schlickwatt (MD)' and ‘Mischwatt (MX)' sites were located inside a small lagoon, while the ‘Sandwatt (SD)' site was more openly exposed to wind and waves (Supplementary Fig. 1). Thirty intact push cores (30 cm length, 10 cm OD, 1/8″ wall thickness) were taken using polycarbonate core liners having vertical lines of silicone sealed holes (ø 3 mm) at 1-cm intervals to allow porewater collection using Rhizon samplers. Cores were retrieved leaving ∼10 cm of overlying water and sealed with double o-ring Delrin caps to minimize gas exchange during transport, and brought immediately back to the laboratory. In addition to the cores used for the incubations, two additional cores were used from each site for immediate microsensor profiling (O2, N2O) and pore-water extraction (‘field cores'). The remaining cores were prepared in parallel for incubations. On completion of the incubations, microsensor profiling of O2 and N2O was conducted immediately followed by extraction of porewaters.

Incubations

The gas-tight sealed sediment cores were incubated in the dark at in situ temperatures (19 °C) in a temperature-controlled room at the Alfred Wegener Institute—Waddensee Field Station. Throughout the incubations the overlying water of the cores was continuously supplied with filtered seawater from large carboys, which were refilled as needed. The o-ring sealed core tops contained inlet/outlet fittings for continual delievery of fresh seawater through gas impermeable PEEK tubing (1/8″ OD). Peristaltic pumps were used to regulate flow rates at 1.8±0.06 ml min−1 (measured gravimetrically at each sampling point) for ∼8 days. The inflow line was placed near the sediment–water interface to minimized stratification. For experimental manipulations, four different inflow seawater compositions were used: ‘Low nitrate' (air sparged; ∼20 μM; LN), ‘Low oxygen, low nitrate' (sparged with N2 to 30–35% O2 saturation; ∼20 μM; LOLN), ‘High nitrate' (amended with NaNO3 to ∼120 μM (above background nitrate); HN) and ‘low oxygen, high nitrate' (combined treatments; LOHN).

Sample collection

Samples of each sediment core effluent were taken twice per day. For dissolved ions, effluent was directed into HDPE bottles and allowed to fill for ∼60 min before subsampling, filtering (0.2 μm) and freezing (−20 °C). Separate 20 ml aliquots were taken for measurement of dissolved inorganic nitrogen concentrations (nitrate, nitrite and ammonium) and stable isotopic composition. Concentrations of nitrite and ammonium were made immediately (see below), while nitrate concentrations were measured later in the Wankel lab at WHOI. Samples for dissolved N2O were directed through gas impermeable PEEK tubing directly into pre-evacuated Tedlar gas sampling bags followed by gentle transfer into 160 ml serum bottles using a ¼″ OD silicone tubing, filling from the bottom to minimize turbulence and gas exchange. Sample water was allowed to overflow the bottle volume for at least two volumes before crimp-sealing with grey butyl septa and preserving with 100 μl of a saturated HgCl2 solution.

Porewater sampling

Pore water samples were collected from sediment cores in 1-cm depth intervals using Rhizons61, which were inserted into intact sediment cores through silicon-filled ports in the walls of the core tubes. Samples of 5–10 ml volume were taken starting at the sediment–water interface down to 16 cm depth and frozen immediately for later analysis. Parallel cores were sectioned in 1-cm intervals for the analyses of iron. HCl extractable Fe(II) and the amorphous, poorly crystalline fraction of the Fe(III) minerals were measured by procedures described in ref. 63, with the modifications as in ref. 64.

Concentration and flux measurements of N bearing species

Concentrations of NO3−+NO2− were measured by chemiluminescence after reduction in a hot acidic vanadyl sulfate solution on a NOx analyser65. Concentrations of NO2− were quantified by using the Griess–Ilosvay method followed by measuring absorption 540 nm, and NO3− was quantified by difference66. Concentrations of NH4+ were measured by fluorescence using the OPA method62. Concentrations of N2O were made using the integrated peak area of the m/z 44 beam on the IRMS (see below), standardizing to analyses of known amounts of N2O (injected into N2 sparged seawater in 160 ml serum bottles) and normalizing to sample volume (158 ml). Mass fluxes (Supplementary Fig. 2; Supplementary Table 1) were calculated as a function of the steady-state difference (usually after ∼3 days) between influent and effluent concentrations (Δ[C]), flow rate (r) and sediment surface area (A) using: Flux=(Δ[C] × r)/A. Error estimates of fluxes incorporate variations in both measured flow rates as well as steady state concentrations.

Isotope measurements

All N and O isotopic composition measurements (δ15N and δ18O; where δ15N=((15Rsample/15RAir)−1) × 1,000 in units of ‰, and 15R=15N/14N and where δ18O=((18Rsample/18RVSMOW)−1) × 1,000 in units of ‰, and 18R=18O/16O) were made after conversion of analytes to nitrous oxide, followed by purification with a customized purge and trap system and analysis on a continuous flow IsoPrime 100 isotope ratio mass spectrometer (IRMS). Nitrate. Nitrate was converted to N2O using the denitrifier method6768 after removal of nitrite by addition of sulfamic acid69. Corrections for drift, size and fractionation of O isotopes during bacterial conversion were carried out using NO3− reference materials USGS 32, USGS 34 and USGS 35 (refs 67, 70), with a typical reproducibility of 0.2 and 0.4‰ for δ15N and δ18O, respectively, in the course of single run. Triple oxygen isotope measurements allow for the determination of ‘anomalous 17O,' (the deviation from the terrestrial fractionation line) with the magnitude of this anomaly expressed as Δ17O (after71), where: Nitrate Δ17O measurements were made on separate aliquots by routing denitrifier-produced N2O through a gold tube (1/16″ OD) held at 780 °C, thermally decomposing the N2O into N2 and O2, which were chromatographically separated using a 2 m column (1/16″ OD) packed with molecular sieve (5 Å) before analysis on the IRMS7273. Nitrate reference materials USGS 35 and USGS 34 were used to normalize any scale contraction during conversion, with reproducibility of Δ17O typically ±0.8‰. Nitrite. All samples for nitrite N and O isotope measurements were converted to N2O within 2 h of collection using the azide method74. Parallel conversions of internal nitrite standards (WILIS 10, 11 and 20) were conducted to assess potential changes in reagents with time. Internal nitrite standards were also used correct for any variations due to peak size linearity and instrumental drift, with a typical reproducibility for both δ15N and δ18O of ±0.2‰. On the basis of calibrations against isotope reference materials USGS 32, 34 and 35 for δ15N (ref. 75) and N23, N7373 and N10129 for δ18O (ref. 76), the values of WILIS 10, 11 and 20 are reported here to be −1.7, +57.1 and −7.8‰ for δ15N and +13.2, +8.6 and +47.6‰ for δ18O, respectively. Nitrite Δ17O measurements were made after conversion to N2O using the azide method and normalized using a combination of NO2− and NO3− isotopic reference materials. Δ17O values of NO2− isotope standards WILIS 10 and WILIS 11 were calibrated previously against USGS 34 and USGS 35 using the denitrifier method followed by thermal decomposition of N2O to N2 and O2 as described above—yielding Δ17O values of 0‰ for both. For sample NO2−, raw δ17O and δ18O values were first normalized for oxygen isotopic exchange with water during the azide reaction74 using the calibrated δ17O and δ18O values of WILIS 10 and WILIS 11. During the same IRMS run, N2O produced from USGS 34 and USGS 35 via the denitrifier method was also thermally converted and analysed as N2 and O2. Because any isotope fractionation occurring during these reactions is mass dependent (Δ17O is unaffected), the Δ17O of NO2− can be calculated by normalizing to Δ17O values of these NO3− standards. We disregard the small amount of oxygen isotope exchange occurring during the denitrifier method, as this would have only a small impact on the calculated Δ17O values. Reduced nitrogen. Total reduced nitrogen (TRN=DON+NH4+) was measured in a subset of incubation cores by oxidation of the total dissolved nitrogen (TDN) pool to nitrate via persulfate digest—followed by δ15N analysis using the denitrifier method77. The δ15N of the TRN pool was then calculated by mass balance by subtracting the molar contribution of the measured δ15N of NO3− and NO2− pools to the TDN pool. On the basis of the measurement of NH4+ concentrations, the DON flux was generally of the same magnitude as the NH4+ flux (not shown). For use in the mass balance calculations (for estimation of the bAMO endmember Δδ15N value), the δ15N of the TRN pool was assumed to be a reasonable proxy for the δ15N of the NH4+ pool. In general, this assumption had only a very small impact on the apportionment N2O sources by mass balance (<1%). Nitrous oxide. For dissolved N2O, samples were extracted from the 160 ml serum bottles using a purge and trap approach78. Liquid samples were quantitatively transferred from the sample bottle into a purging flask using a 20 psi He stream, followed by He-sparging (∼45 min) and cryogenic trapping using the same system described above for nitrate and nitrite derived N2O. Isotopic composition of the dissolved N2O was measured by direct comparison against the N2O reference tank, as no isotopic reference materials were available at the time of the analyses (USGS 51 and USGS 52 have since been publicly released: http://isotopes.usgs.gov/lab/referencematerials.html). The composition of this tank (δ15Nbulk=−0.7‰; δ18O=+39.1‰; SPN2O=−5.3‰, where SPN2O15N(α)−δ15N(β) and α and β refer to the central and outer N atoms in the linear N2O molecule, respectively) was calibrated directly against aliquots of two previously calibrated N2O tanks from the Ostrom Lab at Michigan State University, having been calibrated by Tokyo Tech (Ostrom, pers. comm.). Several sample analyses of tropospheric N2O from the study site using this system yielded isotope values of +6.8±0.7‰ for δ15Nbulk, +44.1±1.7‰ for δ18O and +17.4±2.2‰ for SPN2O (error reported as s.d. of n=6 samples). Reported values have been corrected for any size linearity effects on isotopic ratios (31/30, 45/44 and 46/44) by using a series of reference tank subsamples injected into He-purged 20 ml headspace vials using a gastight syringe. Precision for replicate analyses of this reference gas analysed as samples (that is, aliquots injected into sample vials and analysed via purge and trap) for δ15N is±0.3‰, for δ18O is ±0.4‰ and for SPN2O is ±0.8‰. The Δ17O of N2O was calculated similar to that described above for NO2−. After extraction and cryotrapping, the N2O sample is thermally decomposed to N2 and O2 and chromatographically separated before measurement on the IRMS. Regular analyses of N2O converted from NO3− isotope reference materials (USGS 35 and USGS 34) via the denitrifier method were made to normalize Δ17O values.

Triple oxygen isotope tracing of N2O production

While the δ18O of most terrestrial O-bearing materials tightly co-varies with δ17O (along the ‘terrestrial fractionation line'), atmospn>heric NO3−, stemming from reactions involving stratospheric ozone, contains a large relative excess of 17O giving rise to a composition falling above the terrestrial fractionation line79 (with the magnitude of this anomaly expressed as Δ17O; see equation 2). Since kinetic isotope effects lead to mass dependent changes in δ17O values approximately half as large as in δ18O, the Δ17O remains unchanged808182. Therefore N2O produced from this NO3− (whether by bDNF, fDNF or cDNF) will retain its Δ17O, despite any kinetic isotope fractionation. Changes in Δ17O of an O-bearing N pool only occur through production incorporating O atoms having Δ17O ∼0‰ (O2 (Δ17O=−0.3‰) or H2O17O=0‰) incorporated during AMO), thus, decreasing the Δ17O of the standing pool towards ∼0‰. To the degree that NO2− derives from NO3− reduction (and hence carries its Δ17O value), isotope equilibration between NO2− and water O may also ‘erase' a non-zero Δ17O signal. Thus, in our incubations Δ17ON2O provides independent quantification of the fraction of O atoms originally deriving from NO3− (through a NO2− intermediate): Normalizing for any potential equilibration of intermediate NO2− with water, Δ17ON2O can similarly be compared to Δ17O of the NO2− pool:

Isotope mass balance approach

Isotope mass balance calculations were made for estimating the relative contribution of N2O production pathways in the sediment incubations (denitrification by bacteria (bDNF), by fungi (fDNF), or by chemodenitrification (cDNF), as well as combined production by ammonia oxidizing bacteria and archaea via NH2OH decomposition (AMO) or nitrifier denitrification (nDNF)). By combining four independent mass balance expressions (equations 5, 6, 9 and 11 below) we can solve for the contribution of four independent N2O production processes (here we describe consideration of fDNF (case 1), with cDNF being considered separately (case 2)). Equation 1 can be expressed in terms of the fractional contribution (f) of each production process to the total flux of N2O: Equation 4, incorporating the Δ<span class="Chemical">17O measurements, is used but neglecting <span class="Chemical">cDNF for this case: For measured Δδ<span class="Chemical">15N values, equation 7 describes the mass balance contribution of each process to the cumulative steady-state flux (Δδ<span class="Chemical">15Nmeas): where again f refers to the fractional contribution of a given process, Δδ15N is equal to the steady-state difference (or offset) between δ15N of NO3− and N2O, and where the endmember Δδ15N for given process is expressed based on measured steady-state δ15N values of NO3−, NO2− or NH4+ and the isotope offsets for each process (Supplementary Table 3). For example, the difference between δ15N of reactant NH3 and N2O (15ɛNH3-N2O) produced by bAMO has been estimated to be ∼3.7±3‰, with δ15NN2Obulk depleted in 15N relative to the NH3 source59. To express this in terms of a Δδ15N value for the NO3−/N2O mass balance in equation 7, we also need to account for the steady-state difference between the δ15N of NO3− and NH4+ such that: As the isotopic composition of <span class="Chemical">N2O from bAMO and aAMO are very similar in the context of the isotope space evaluated here565758, we choose to combine these terms into a single term (AMO), having the composition of bAMO (Supplementary Table 3). Together with the fact that we will treat <span class="Chemical">cDNF separately, equation 7 thus simplifies to: Similar to equation 7, the fractional contribution of each process to the measured <span class="Chemical">SPN2O of the effluent can be expressed as: where f denotes the fractional contribution of a given process having a particular SP value, and where f(N2ORED) is equal to 1−(FN2O/(FbDNF+FfDNF+FcDNF+FbAMO+FaAMO+FnDNF)) and SPɛN2ORED is the kinetic isotope effect on SP for N2O reduction of −6‰ (refs 21, 22). As in equation 9, consideration of four processes simplifies equation 10 to: By combining equations 5, 6, 9 and 11—we can uniquely solve for the fractional contribution of four processes (bDNF, fDNF, AMO and nDNF) to the total observed N2O fluxes of the core incubations (Fig. 5; Supplementary Table 4). Isotope offsets (Δδ15N) and SPN2O values for defining endmember compositions are given in Supplementary Table 3, as well as the expected Δ17ON2O17ONO2 values for the high nitrate incubations.

Error propagation and sensitivity analysis

Error estimates for these mass balance calculations (Supplementary Tables 4,5 and 6) were calculated using a Monte Carlo error propagation approach in R (with 10,000 simulations), in which randomized Gaussian distributions of values were generated, as defined by their mean and s.d. given in Supplementary Table 3. This approach takes into account both the error associated with measurement of steady-state isotopic compositions (Supplementary Table 2; which implicitly incorporates both analytical error during instrument measurement, as well as natural variability during operation of the incubations) as well as error associated with the definition of endmembers (Supplementary Table 3). Beyond these estimates of error, we also evaluated the sensitivity of specific endmember values to the calculated mass balance estimates—focusing on variations for endmember values having the least amount of certainty. First, the endmember values of Δδ15N for bDNF and fDNF (and cDNF) are prescribed to be low as an inferred consequence of diffusion-limited expression of intrinsic (enzyme level) isotope effects (Supplementary Table 3). For nDNF, we chose to use a Δδ15N value established by a study of nitrifiers under varying oxygen tension (Frame and Casciotti59), as nitrifiers will be growing at the sharp oxic/anoxic interface in our sediment core incubations. Whether their supply of NO2− (as a substrate for nDNF) could be considered to be limited by diffusion is perhaps a matter of debate. However, we reasoned that nitrifiers will most generally be denitrifying the product NO2− that they themselves are producing (for detoxification) and therefore would not be limited by diffusion of NO2− from anoxic depths below. Further, the positive flux of NO2− out of the sediments—also indicates that the diffusive supply of NO2− should not have been limited (regardless of the source of the NO2−). Nevertheless, we discretely examined the impact that these assumptions make by decreasing the endmember Δδ15N value for nDNF from 56.9 to 28‰ and then to 14‰. Under these scenarios (assuming 10% N2O reduction, for example)—the average relative contribution of nDNF increases from 8 to 14 and 26%, respectively, though mostly at the expense of bDNF, which decreases on average from 45 to 38 and 25%, respectively. In comparison, these scenarios actually increase estimated contribution of fDNF from 36 to 43 and 56%, respectively (Supplementary Table 5). Endmember SP values have been generally well established for bDNF, nDNF and bAMO through culture studies under a variety of growth conditions. SP for fungal DNF is admittedly less well studied, however, several studies have shown that SP values are universally elevated (often clustering ∼35–37‰). Recent studies3742 observe that most N2O producing fungal cultures yielded SP values >30‰. Finally, even the purified N2O producing fungal enzyme (p450nor) has been shown to exhibit elevated SP values, albeit at somewhat lower values (15–29‰). Notably, our choice of +37‰ for the fDNF endmember is conservative in estimation of the relative contribution of fDNF. For example, decreasing this value to the mean reported by Maeda et al.37 of +30.3±4.8‰ (which notably also contained some questionably low values), results in an average of a 6% increase in the contribution of fDNF to N2O production, with the average contribution of 36% shifting up to an average of 41–42% (Supplementary Table 6). Finally, we evaluated our assumption that the extracellular NO2− pool could be disregarded as a reactant source for nDNF (that in situ, nDNF only occurred from NO2− supplied via bAMO), by setting the prescribed Δ17O-N2O17O-NO2− value for nDNF to a value of ‘1' instead of ‘0'—representing the most extreme case. Indeed, under this scenario—the average estimated contribution of bNDF and nDNF actually do not change by >∼1%, while bAMO is increased (from 12 to 19%) and fDNF is decreased (from 36 to 28%) (Supplementary Table 6).

Fungal genetic sequencing

Sediment samples for fungal sequence analysis were collected and stored frozen at −80 °C. Genomic DNA from marine sediment samples was extracted using a bead beating protocol according to the manufacturer's instruction (Mo Bio, Carlsbad, CA). ITS region sequences were amplified using the fungal ITS primer pair F (ITS5): GGAAGTAAAAGTCGTAACAAGG and R (ITS4): TCCTCCGCTTATTGATATGC generating fragments of ∼600 bps in length. PCR products were cloned using Zero Blunt TOPO PCR Cloning (Thermo Fisher, Carlsbad, CA). After a ligate buffer exchange the plasmid was transferred into TOP10 electrocompetent cells. Cells were plated and grown on LB agar containing kanamycin. Single colonies were recovered from each plate and amplified using M13F&R primers. The products were sequenced by Sanger method (EtonBio, San Diego, CA). Sequences were analysed using BLAST. Taxonomy was assigned for fungal sequences (Supplementary Figure S3) by comparison against untrimmed ITS in the UNITE database (01/08/2015 version), using QIIME v1.91. Sequences were assigned only if the database match had a similarity of at least 90% and maximum e-value of 0.001.

Data availability

The data sets generated during this study are available by request from corresponding author.

Additional information

How to cite this article: Wankel, S. D. et al. Evidence for fungal and chemodenitrification based <span class="Chemical">N2O flux from <span class="Chemical">nitrogen impacted coastal sediments. Nat. Commun. 8, 15595 doi: 10.1038/ncomms15595 (2017). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  39 in total

1.  A bacterial method for the nitrogen isotopic analysis of nitrate in seawater and freshwater.

Authors:  D M Sigman; K L Casciotti; M Andreani; C Barford; M Galanter; J K Böhlke
Journal:  Anal Chem       Date:  2001-09-01       Impact factor: 6.986

2.  Distinguishing nitrous oxide production from nitrification and denitrification on the basis of isotopomer abundances.

Authors:  R L Sutka; N E Ostrom; P H Ostrom; J A Breznak; H Gandhi; A J Pitt; F Li
Journal:  Appl Environ Microbiol       Date:  2006-01       Impact factor: 4.792

3.  Triple oxygen isotope analysis of nitrate using the denitrifier method and thermal decomposition of N2O.

Authors:  Jan Kaiser; Meredith G Hastings; Benjamin Z Houlton; Thomas Röckmann; Daniel M Sigman
Journal:  Anal Chem       Date:  2007-01-15       Impact factor: 6.986

4.  Measurement of the oxygen isotopic composition of nitrate in seawater and freshwater using the denitrifier method.

Authors:  K L Casciotti; D M Sigman; M Galanter Hastings; J K Böhlke; A Hilkert
Journal:  Anal Chem       Date:  2002-10-01       Impact factor: 6.986

5.  Nanogram nitrite and nitrate determination in environmental and biological materials by vanadium (III) reduction with chemiluminescence detection.

Authors:  R S Braman; S A Hendrix
Journal:  Anal Chem       Date:  1989-12-15       Impact factor: 6.986

6.  Nitrous oxide formation in the Colne estuary, England: the central role of nitrite.

Authors:  Liang F Dong; David B Nedwell; Graham J C Underwood; Daniel C O Thornton; Iman Rusmana
Journal:  Appl Environ Microbiol       Date:  2002-03       Impact factor: 4.792

7.  Tracing atmospheric nitrate deposition in a complex semiarid ecosystem using delta17O.

Authors:  Greg Michalski; Thomas Meixner; Mark Fenn; Larry Hernandez; Abby Sirulnik; Edith Allen; Mark Thiemens
Journal:  Environ Sci Technol       Date:  2004-04-01       Impact factor: 9.028

8.  Oxygen isotopes in nitrate: new reference materials for 18O:17O:16O measurements and observations on nitrate-water equilibration.

Authors:  J K Böhlke; S J Mroczkowski; T B Coplen
Journal:  Rapid Commun Mass Spectrom       Date:  2003       Impact factor: 2.419

9.  Nitrite reactivity with magnetite.

Authors:  P Dhakal; C J Matocha; F E Huggins; M M Vandiviere
Journal:  Environ Sci Technol       Date:  2013-05-31       Impact factor: 9.028

10.  Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

Authors:  William Orsi; Jennifer F Biddle; Virginia Edgcomb
Journal:  PLoS One       Date:  2013-02-13       Impact factor: 3.240

View more
  9 in total

Review 1.  Biological and Bioinspired Inorganic N-N Bond-Forming Reactions.

Authors:  Christina Ferousi; Sean H Majer; Ida M DiMucci; Kyle M Lancaster
Journal:  Chem Rev       Date:  2020-02-28       Impact factor: 60.622

2.  Estuarine plastisphere as an overlooked source of N2O production.

Authors:  Xiaoxuan Su; Leyang Yang; Kai Yang; Yijia Tang; Teng Wen; Yingmu Wang; Matthias C Rillig; Lena Rohe; Junliang Pan; Hu Li; Yong-Guan Zhu
Journal:  Nat Commun       Date:  2022-07-06       Impact factor: 17.694

Review 3.  Characterizing Natural Organic Matter Transformations by Microbial Communities in Terrestrial Subsurface Ecosystems: A Critical Review of Analytical Techniques and Challenges.

Authors:  Kristine Grace M Cabugao; Sara Gushgari-Doyle; Stephany S Chacon; Xiaoqin Wu; Amrita Bhattacharyya; Nicholas Bouskill; Romy Chakraborty
Journal:  Front Microbiol       Date:  2022-05-04       Impact factor: 6.064

4.  Fungi and Archaea Control Soil N2O Production Potential in Chinese Grasslands Rather Than Bacteria.

Authors:  Lei Zhong; Jinwu Qing; Min Liu; Xiaoxian Cai; Gaoyuan Li; Frank Yonghong Li; Guanyi Chen; Xingliang Xu; Kai Xue; Yanfen Wang
Journal:  Front Microbiol       Date:  2022-05-16       Impact factor: 6.064

5.  Denitrification by Anaeromyxobacter dehalogenans, a Common Soil Bacterium Lacking the Nitrite Reductase Genes nirS and nirK.

Authors:  Jenny R Onley; Samiha Ahsan; Robert A Sanford; Frank E Löffler
Journal:  Appl Environ Microbiol       Date:  2018-01-31       Impact factor: 4.792

6.  N2O formation by nitrite-induced (chemo)denitrification in coastal marine sediment.

Authors:  Julia M Otte; Nia Blackwell; Reiner Ruser; Andreas Kappler; Sara Kleindienst; Caroline Schmidt
Journal:  Sci Rep       Date:  2019-07-31       Impact factor: 4.379

7.  Forest streams are important sources for nitrous oxide emissions.

Authors:  Joachim Audet; David Bastviken; Mirco Bundschuh; Ishi Buffam; Alexander Feckler; Leif Klemedtsson; Hjalmar Laudon; Stefan Löfgren; Sivakiruthika Natchimuthu; Mats Öquist; Mike Peacock; Marcus B Wallin
Journal:  Glob Chang Biol       Date:  2019-09-25       Impact factor: 10.863

8.  Phylogenomics Reveal the Dynamic Evolution of Fungal Nitric Oxide Reductases and Their Relationship to Secondary Metabolism.

Authors:  Steven A Higgins; Christopher W Schadt; Patrick B Matheny; Frank E Löffler
Journal:  Genome Biol Evol       Date:  2018-09-01       Impact factor: 3.416

9.  Diversity and N2O Production Potential of Fungi in an Oceanic Oxygen Minimum Zone.

Authors:  Xuefeng Peng; David L Valentine
Journal:  J Fungi (Basel)       Date:  2021-03-17
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.