Literature DB >> 28578513

The role of FV 1691G>A, FII 20210G>A mutations and MTHFR 677C>T; 1298A>C and 103G>T FXIII gene polymorphisms in pathogenesis of intraventricular hemorrhage in infants born before 32 weeks of gestation.

Dawid Szpecht1, Janusz Gadzinowski2, Agnieszka Seremak-Mrozikiewicz3,4, Grażyna Kurzawińska3, Krzysztof Drews3, Marta Szymankiewicz2.   

Abstract

BACKGROUND: Congenital thrombophilia is associated with an increased intraventricular hemorrhage (IVH) risk among newborns, but it may also play a protective role. The role of genetic polymorphisms involved in the coagulation pathway of IVH pathogenesis is probably a consequence of an increased risk of thrombosis in the fine blood vessels in the germinal matrix region.
MATERIAL AND METHODS: The aim of this study was to evaluate the possible relationship between Factor V (FV) 1691G>A, Factor II (FII) 20210G>A mutations and methylenetetrahydrofolate reductase (MTHFR) 677C>T; 1298A>C and Factor XIII (FXIII) 103G>T gene polymorphisms and the occurrence of IVH in 100 infants born from 24 + 0 to 32 + 0 weeks of gestation, born from singleton pregnancy, before 32 + 0 weeks of gestation, exposed to antenatal steroid therapy, and without congenital abnormalities.
RESULTS: IVH developed 45 (45%) infants, including 15 (33.33%) diagnosed with IVH stage I, 20 (42.22%) with stage II, 8 (17.77%) with stage III, and 3 (6.66%) with stage IV. Analysis showed a prevalence 4.5 times higher of IVH stages II to IV in infants with the genotype CC (OR 4511 (1147-17.75); p = 0.026) of MTHFR 1298A>C gene polymorphism. Our investigation did not confirm any significant prevalence of IVH development in other studied mutations/polymorphisms.
CONCLUSIONS: This study confirmed that the MTHFR 1298A>C polymorphism is associated with the risk of IVH. IVH is a significant problem for preterm infants. In addition to little progress in preventing IVH in preterm babies, substantial research that is focused on understanding the etiology, mechanism, and risk factors for IVH is imperative. In the era of personalized medicine, identification of genetic risk factors creates opportunities to generate preventative strategies.

Entities:  

Keywords:  Gene; Intraventricular hemorrhage; Polymorphism; Preterm newborn

Mesh:

Substances:

Year:  2017        PMID: 28578513      PMCID: PMC5496967          DOI: 10.1007/s00381-017-3460-8

Source DB:  PubMed          Journal:  Childs Nerv Syst        ISSN: 0256-7040            Impact factor:   1.475


Introduction

Congenital thrombophilia is a genetic predisposition for venous or arterial thrombosis. The resistance of factor V to the anti-coagulant action of activated protein C is the most prevalent type of congenital thrombophilia. In fact, in over 90% of patients, it is caused by a point mutation of the factor V (FV) gene at position 1691 (1691G>A). The other types include a mutation in factor II (FII) at position 20210 in the 3′ untranslated region of the gene (20210G>A) and a polymorphism in methylenetetrahydrofolate reductase (MTHFR) gene at position 677 (677C>T) and at 1298 (1298A>C) [1-3]. The role of genetic polymorphisms involved in the coagulation pathway of intraventricular hemorrhage (IVH) pathogenesis is probably a consequence of an increased risk of thrombosis in the fine blood vessels in the germinal matrix region. Increased blood pressure in germinal matrix vessels may lead to vessel wall rupture and to IVH. As indicated in literature, congenital thrombophilia is associated with an increased IVH risk among newborns, but it may also play a protective role [4-9]. Thus, the role of the gene mutations that are involved in coagulation pathway in the pathogenesis of IVH remains unclear. The heterogeneity, size, and ethnic diversity of previously studied infants are the most likely explanation for the differences in these findings. The aim of this study was to evaluate the possible relationship between FV 1691G>A (R506Q), FII 20210G>A mutations and MTHFR 677C>T (A222V); 1298A>C (E429A) and 103G>T FXIII gene polymorphisms and the occurrence of IVH in a population of newborns born from 24 + 0 to 32 + 0 weeks of gestation.

Material and methods

Study population

In order to guarantee a homogenous group of patients, we created the following inclusion criteria for the study: Caucasian origin; neonates born from 24 + 0 to 32 + 0 weeks of pregnancy; singleton pregnancy; newborns with completed antenatal steroid therapy (AST), and newborns without chromosomal abnormalities, without toxoplasmosis, other, rubella, cytomegalovirus, and herpes (TORCH) infections, and also without inborn errors of metabolism. Based on inclusion criteria, we enrolled 100 of 428 (23.4%) infants into the study population. These patients were all born from 24 + 0 to 32 + 0 weeks of gestation in Clinical Hospital of Gynecology and Obstetrics at the University of Medical Sciences in Poznań, Poland, and then admitted to Neonatal Intensive Care Unit at Department of Neonatology between June 1, 2014, and August 15, 2016.

Clinical features

The following risk factors that may associate with the development of IVH were studied: gender, gestational age (GA; weeks), birth weight (BW, g), small for gestational age (SGA, defined as BW under 3th percentile), type of delivery (vaginal birth vs. cesarean section), birth asphyxia (defined as Apgar score less than 6 at 10 min and pH <7.0 or blood base excess (BE) <−15 mmol/l in cord blood), intrauterine infection (defined as positive culture in sterile originally accompanied by clinical symptoms), and thrombocytopenia (defined as platelet count less than 100,000 per microliter of blood found in first 7 days of life) in neonates.

IVH diagnosis

IVH was diagnosed by routine cranial ultrasound, which was performed on the first, third, and seventh days of life using the cranial ultrasonographic scanner (10-MHz transducer, Prosound α7 Premier, Aloka). The Papille IVH classification was used in staging IVH [10], and the results of cranial ultrasound were confirmed by two independent neonatologists.

Studied polymorphisms

Based on most common etiology of inherited thrombophilia in Caucasian population, we studied the following gene: FV 1691G>A (R506Q), FII 20210G>A, and polymorphism of MTHFR 677C>T (A222V) and 1298A>C (E429A) and FXIII 103G>T genes. Samples of blood were taken after delivery, collected in EDTA, and banked. Genomic DNA was extracted from blood leukocytes using QIAamp DNA Blood Mini Kit (QIAGEN Inc., Germany) according to the manufacturer’s recommendations. Genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) procedures. The description of the polymorphisms/mutations is shown in Table 1 [11-15].
Table 1

The description of the studied polymorphism genes

PolymorphismThe position of the gene on chromosomeSequence of primersRestriction enzymeIdentified sequenceSize of PCR product (bp)Products
MTHFR 677C>T (rs1801133) [11]1p36.35′ TGA AGG AGA AGG TGT CTG CGG GA 3′ 5′ AGG ACG GTG CGG TGA GAG TG 3′ HinfI (Eurx)G^ANTC198 CC—198 bp; CT—198, 175, 23 bp; TT—175, 23 bp
MTHFR 1298A>C (rs1801131) [11]1p36.35′ CTT CTA CCT GAA GAG CAA GTC 3′ 5′ CAT GTC CAC AGC ATG GAG-3′ MboII (Eurx)GAAGA (8/7)256 AA—176, 30, 28, 22 bp; AC—204, 30, 28, 22 bp; CC—204, 30, 22 bp
FV 1691G>A (rs6025) [12]1q235′ TGC CCA GTG CTT AAC AAG ACC A 3′ 5′ CTT GAA GGA AAT GCC CCA TTA 3′ MnlI (Eurx)CCTC (7/6)220 GG—116, 67, 37 bp; GA—153, 116, 67, 37 bp; AA—153, 67 bp
FII 20210G>A (rs3136516) [13]11p11-q125′ TCT AGA AAC AGT TGC CTG GC 3′ 5′ ATA GCA CTG GGA GCA TTG AAG C3′ HindIII (Thermo Scientific)A^AGCTT345 GG—345 bp; GA—345, 322, 23 bp; AA—322, 23 bp
FXIII 103G>T (rs5985) [14]6p25.15′ CATGCCTTTTCTGTTGTCTTC3′ 5′ ACCTTGCAGGTTGACGCCCCGGGGCACTA3′ HpyF3I (DdeI) (Thermo ScientificC^TNAG192GG—192 bp; GT—192, 161, 31 bp; TT—161, 31 bp
The description of the studied polymorphism genes Informed consent was obtained from parents of all infants enrolled into study. The study followed the tenets of the Declaration of Helsinki and was approved by the Bioethics Committee of Poznan University of Medical Sciences (66/14 and 799/16). Furthermore, all methods and examinations were performed in accordance with the relevant ethical guidelines and regulations.

Statistical analysis

The results are presented as percentage for categorical variables, or median (range) for non-normally distributed continuous variables as tested by the Shapiro–Wilk test. The Fisher exact probability test, the chi-squared test, Fisher–Freeman–Halton, and chi-squared test with Yates correction were used to evaluate the association between IVH and analyzed variables. Differences in non-normally distributed continuous variables were compared by the Mann–Whitney U test. The genotype and allele frequencies were compared between two groups: group 1: patients with or without IVH, with/without IVH grade I, and with IVH grades II–IV in the entire study group and group 2: with or without IVH, with/without IVH grade I, and with IVH grades II–IV in infants born from 24 + 0 to 28 + 0 weeks of gestation. A p value less than 0.05 is statistically significant. The expected genotype frequencies were calculated from allele frequencies with the Hardy-Weinberg equation. Statistical analysis was performed using Cytel Studio version 10.0, created January 16, 2013 (Cytel Studio Software Corporation, Cambridge, MA, USA), and Statistica version 10, 2011 (Stat Soft, Inc., Tulsa, OK, USA).

Results

IVH developed 45 (45%) infants, including 15 (33.33%) diagnosed with IVH stage I, 20 (42.22%) with stage II, 8 (17.77%) with stage III, and 3 (6.66%) with stage IV. No significant differences in the incidence of IVH were found between female (20; 44.44%) and male (25; 55.56%) neonates. The incidence of IVH stages II to IV was higher incidence with a lower GA, significantly higher in children born from 24 + 0 to 28 + 6 weeks of gestation compared to those born from 29 + 0 to 32 + 0 weeks of gestation (74.19 vs 25.81%; p = 0.007); higher incidence of a lower Apgar score in the first (6(1–10) vs 8(2–10); p = 0.007) and fifth minutes of life (4(1–10) vs 7(1–8); p = 0.001); and more often in children diagnosed with intrauterine infection (70.97 vs 47.83%; p = 0.031) and thrombocytopenia (45.16 vs 17.39%; p = 0.034). In the study population, 10 of 100 (10%) patients died. All children that died were born from 24 + 0 to 28 + 6 weeks of gestation (18.18%), 7 of which (70%) were diagnosed with IVH stages II to IV. Table 2 shows the characteristic of enrolled infants.
Table 2

Demographic and clinical characteristic of enrolled infants

Group without IVH and IVH stage IGroup with IVH stage II- IV P value
N = 69 (%) N = 31 (%)
Gender0.585
 Male36 (52.17)18 (58.06)
 Female33 (47.83)13 (41.94)
Gestational age (weeks)0.007
 24 + 0–28 + 631 (44.93)23 (74.19)
 29 + 0–32 + 038 (55.07)8 (25.81)
Birth weight (g)0.004
 <7506 (8.70)8 (25.81)
 750–100015 (21.74)12 (38.71)
>100048 (69.57)11 (35.48)
Apgar score (median and range)
 1st minute8 (2–10)6 (1–10)0.007
 5th minute7 (1–8)4 (1–10)0.001
Mode of delivery0.148
 Vaginal25 (36.23)16 (51.61)
 Cesarean section44 (63.76)15 (48.38)
Asphyxia (pH lower than 7.0 or BE lower than −12)0.468
 Yes1 (1.44)2 (6.45)
 No68 (98.56)29 (93.55)
Intrauterine infection0.031
 Yes33 (47.83)22 (70.97)
 No36 (52.17)9 (29.03)
Thrombocytopenia0.034
 Yes12 (17.39)14 (45.16)
 No57 (82.61)17 (54.84)
Deaths3 (4.41)7 (22.58)0.015
Demographic and clinical characteristic of enrolled infants Analysis showed a prevalence 4.5 times higher of IVH stages II to IV in infants with the genotype CC (OR 4511 (1147–17.75); p = 0.026) of MTHFR 1298A>C gene polymorphism. There was a higher prevalence of allele C carriers of MTHFR 1298A>C in patients with stage II to IV IVH (OR 1.816 (0.984–3.352); p = 0.056). Our investigation did not confirm any significant prevalence of IVH development in other studied mutations/polymorphisms. Genotype distribution of the studied mutations/polymorphisms in infants with/without IVH or with/without IVH grade I and with IVH grades II–IV is presented in Tables 3 and 4.
Table 3

Genotype distribution in infants without and with IVH or without/with IVH grade I and with IVH grades II–IV (N observed, Exp expected—genotype frequencies calculated from allele frequencies with the Hardy-Weinberg (H-W) equation)

Gene symbolGroup without IVHExpGroup with IVH grades I–IVExp P valueORGroup without IVH and IVH IExpGroup with IVH grades II–IVExp P valueOR
N = 54 (%) N = 46 (%) N = 69 (%) N = 31 (%)
FV 1691G>A Genotype
GG 49 (90.74)49.1244 (95.65)44.02References63 (91.30)63.1330 (96.77)30.01References
GA 5 (9.26)4.772 (4.35)1.960.5790.446 (0.041–2.912)6 (8.70)5.741 (3.23)0.980.5990.35 (0.007–3.114)
AA 0 (0.00)0.120 (0.00)0.020 (0.00)0.130 (0.00)0.01
 H-W0.9380.9890.9310.996
Allele
G 103 (95.37)90 (97.83)References132 (95.65)61 (98.39)References
A 5 (4.63)2 (2.17)0.5870.458 (0.043–2.89)6 (4.35)1 (1.61)0.6080.361 (0.008–3.085)
FII 20210G>A Genotype
GG 54 (100.0)54.0046 (100.0)46.0069 (100.0)69.0031 (100.0)31.00
GA 00.0000.0000.0000.00
AA 00.0000.0000.0000.00
 H-W
Allele
G 108 (100.0)92 (100.0)138 (100.0)62 (100.0)
A 0000
MTHFR 677C>T Genotype
CC 30 (55.56)27.4524 (52.17)25.88References39 (56.52)36.9615 (48.39)16.33References
CT 17 (31.48)22.1021 (45.65) 17.25 0.418 1.544 (0.618–3.872) 23 (33.33) 27.08 15 (48.39) 12.34 0.341 1.696 (0.638–4.485)
TT 7 (12.96)4.451 (2.17) 2.88 0.175 0.179 (0.004–1.582) 7 (10.14) 4.96 1 (3.23) 2.33 0.661 0.371 (0.008–3.357)
 H-W0.237 0.337 0.457 0.486
Allele
C 77 (71.30)69 (75.00)References 101 (73.19) 45 (72.58) References
T 31 (28.70)23 (25.00) 0.670 0.828 (0.418–1.626) 37 (26.81) 17 (27.42) 1.000 1.031 (0.490–2.112)
MTHFR 1298A>C Genotype
AA 24 (44.44)24.6714 (30.43)15.27References 29 (42.03) 31.34 9 (29.03) 8.78References
AC 25 (46.30)23.6625 (54.35) 22.47 0.311 1.714 (0.667–4.454) 35 (50.72) 30.33 15 (48.39) 15.44 0.680 1.381 (0.480–4.128)
CC 5 (9.26)5.677 (15.22) 8.27 0.327 2.4 (0.528–11.4) 5 (7.25) 7.34 7 (22.58) 6.78 0.026 4.511 (1.147–17.75)
 H-W0.917 0.747 0.441 0.988
Allele
A 73 (67.59)53 (57.61)References 93 (67.39) 33 (53.23) References
C 35 (32.41) 39 (42.39) 0.190 1.535 (0.827–2.848) 45 (32.61) 29 (46.77) 0.056 1.816 (0.984–3.352)
FXIII 103G>T Genotype
GG 28 (51.85)28.1721 (45.65)20.89References 35 (50.72) 35.51 14 (45.16) 13.56References
GT 22 (40.74)21.6720 (43.48) 20.22 0.807 1.212 (0.488–3.01) 29 (42.03) 27.98 13 (41.94) 13.89 0.984 1.121 (0.411–3.036)
TT 4 (7.41)4.175 (10.87) 4.89 0.730 1.667 (0.313–9.411) 5 (7.25) 5.51 4 (12.90) 3.56 0.565 2.00 (0.340–10.75)
 H-W0.994 0.997 0.955 0.939
Allele
G 78 (72.22)62 (67.39)References 99 (71.74) 41 (66.13) References
T 30 (27.78)30 (32.61) 0.556 1.258 (0.656–2.412) 39 (28.26) 21 (33.87) 0.523 1.3 (0.644–2.584)
Table 4

Genotype distribution in infants 24–28 weeks of gestation without and with IVH or without/with IVH grade I and with IVH grades II–IV (N observed, Exp expected—genotype frequencies calculated from allele frequencies with the Hardy-Weinberg (H-W) equation)

Gene symbolGroup without IVHExpGroup with IVH grades I–IVExp P valueORGroup without IVH and IVH IExpGroup with IVH grades II–IVExp P valueOR
N = 19 (%) N = 35 (%) N = 31 (%) N = 23 (%)
FV 1691G>A Genotype
GG 18 (94.74)18.0133 (94.29)33.03References29 (93.55)29.0322 (95.65)22.01References
GA 1 (5.26)0.972 (5.71)1.941.0001.091 (0.053–67.89)2 (6.45)1.941 (4.35)0.981.0000.659 (0.011–13.53)
AA 0 (0.00)0.010 (0.00)0.030 (0.00)0.030 (0.00)0.01
 H-W0.9930.9850.9830.994
Allele
G 37 (97.37)68 (97.14)References60 (96.77)45 (97.83)References
A 1 (2.63)2 (2.86)1.0001.088 (0.055–65.91)2 (3.23)1 (2.17)1.0000.667 (0.011–13.23)
FII 20210G>A Genotype
GG 19 (100)19.0035 (100)35.0031 (100)31.0023 (100)23.00
GA 00.0000.0000.0000.00
AA 00.0000.0000.0000.00
 H-W
Allele
G 38 (100)70 (100)62 (100)46 (100)
A 0000
MTHFR 677C>T Genotype
CC 10 (52.63)9.5918 (51.43)19.31References18 (58.06)17.8110 (43.48)11.13References
CT 7 (36.84)7.8216 (45.71) 13.37 0.924 1.27 (0.338–4.933) 11 (35.48) 11.37 12 (52.17) 9.74 0.370 1.964 (0.554–7.017)
TT 2 (10.53)1.591 (2.86) 2.31 0.656 0.278 (0.004–6.222) 2 (6.45) 1.81 1 (4.35) 2.13 1.000 0.9 (0.014–19.45)
 H-W0.902 0.508 0.984 0.538
Allele
C 27 (71.05)52 (74.29)References 47 (75.81) 32 (69.57) References
T 11 (28.95)18 (25.71) 0.885 0.850 (0.325–2.298) 15 (24.19) 14 (30.43) 0.612 1.371 (0.531–3.515)
MTHFR 1298A>C Genotype
AA 5 (26.32)6.9611 (31.43)12.01References 10 (32.26) 12.90 6 (26.09) 6.26References
AC 13 (68.42)9.0819 (54.29) 16.99 0.759 0.664 (0.146–2.744) 20 (64.52) 14.19 12 (52.17) 11.48 1.000 1.000 (0.248–4.263)
CC 1 (5.26)2.965 (14.29) 6.01 0.917 2.273 (0.168–128.7) 1 (3.23) 3.9 5 (21.74) 5.26 0.149 8.333 (0.627–432.6)
 H-W0.170 0.782 0.075 0.976
Allele
A 23 (60.53)41 (58.57)References 40 (64.52) 24 (52.17) References
C 15 (39.47) 29 (41.43) 1.000 1.085 (0.451–2.645) 22 (35.48) 22 (47.83) 0.275 1.667 (0.712–3.899)
FXIII 103G>T Genotype
GG 12 (63.16)10.3216 (45.71)16.46References 17 (54.84) 15.61 11 (47.83) 11.13References
GT 4 (21.05)7.3716 (45.71) 15.09 0.176 3.00 (0.691–15.22) 10 (32.26) 12.77 10 (43.48) 9.74 0.657 1.545 (0.416–5.74)
TT 3 (15.79)1.323 (8.57) 3.46 1.000 0.75 (0.055–6.683) 4 (12.90) 2.61 2 (8.7) 2.13 1.000 0.773 (0.061–6.568)
 H-W0.137 0.938 0.481 0.992
Allele
G 28 (73.68)48 (65.75)References 44 (70.97) 32 (69.57) References
T 10 (26.32)25 (34.25) 0.527 1.458 (0.570–3.912) 18 (29.03) 14 (30.43) 1.000 1.069 (0.424–2.661)
Genotype distribution in infants without and with IVH or without/with IVH grade I and with IVH grades II–IV (N observed, Exp expected—genotype frequencies calculated from allele frequencies with the Hardy-Weinberg (H-W) equation) Genotype distribution in infants 24–28 weeks of gestation without and with IVH or without/with IVH grade I and with IVH grades II–IV (N observed, Exp expected—genotype frequencies calculated from allele frequencies with the Hardy-Weinberg (H-W) equation) Seven patients needed ventriculo-peritoneal shunt placement. We did not find any link between studied polymorphisms and necessity of surgical intervention.

Discussion

In our study, we evaluated the possible association between genes involved in the coagulation pathway and the development of IVH, in a large study population of preterm infants born from 24 + 0 to 32 + 0 weeks of gestation with the exposure to AST. It is hypothesized that increased fibrinolytic activity and decreased levels of clotting factors may contribute to the severity of IVH. The univariate analysis confirmed the previously reported association of IVH with younger GA, lower Apgar score in first and fifth minutes of life, intrauterine infection, and thrombocytopenia [16-19].

677C>T; 1298A>C MTHFR polymorphisms

MTHFR is an enzyme that catalyzes the reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a substrate in remethylation of homocysteine to methionine. The MTHFR is code by the gene on chromosome 1 location p36.2. Polymorphism of MTHFR gene consists of cytosine replaced by thymine at position 677 or adenosine replaced by cytosine at position 1298 in the gene, encoding a thermolabile enzyme with reduced activity, consequently resulting in increased blood plasma homocysteine concentration [20-22]. Hyperhomocysteinemia may lead to injury of vascular endothelium and lead to stroke, thrombosis, migraine, and vascular disorder IVH [20, 22]. Aden et al. evaluated genotypes for seven genes from 224 inborn, preterm infants with BW 500–1250 g, treated with AST and grade III IVH. MTHFR 1298A>C polymorphism was more prevalent in cases of IVH [8]. Based on our results in a comparable study population, we confirmed 4.5-fold increased prevalence of IVH stages II to IV in patients with the genotype CC of MTHFR 1298A>C gene polymorphism. We did not find any statistical significance association of MTHFR 677C>T polymorphism and IVH occurrence. Ment et al. demonstrated that MTHFR 1298A>C gene polymorphism is an independent risk factor for IVH. MTHFR 677C>T polymorphism increases the risk of IVH in patients with low Apgar score. Ment et al. studied different populations compared to us, including multiple pregnancies and infants with body weight 500–1250 g [9].

1691G>A FV mutation

Activated protein C resistance (APCR) is the resistance of FV to the anti-coagulant action of APC. APCR is the most prevalent type of congenital thrombophilia, and in over 90% of patients, it is caused by a mutation of the FV gene on chromosome 1 (the Leiden mutation). Factor V (FV) is synthesized by hepatocytes, monocytes, macrophages, and megakaryocytes. FV undergoes thrombin-dependent activation and APC-dependent inactivation. FV is transformed to its active form (factor Va (FVa)) by the thrombin that cleaves FV at Arg709, Arg1018, and Arg1545 within the B domain of FV. FVa with FXa and calcium ions forms the FIIase complex that converts FII into thrombin. FVa plays also an anti-coagulant role (APC-dependent) by the proteolysis of FVa to FVi, when APC is attached to FVa at Arg306, Arg506, and Arg679 of the heavy chain of FVa. Connecting APC to FVa at Arg506 and forming FVac inactivates FVIIIa [2, 23–25]. FV Leiden mutation is an autosomal dominant genetic mutation and occurs between 2 and 10% of the Caucasian race and in 90% of cases is caused by the replacement of arginine at position 506 of the heavy chain with glutamine, which results in resistance to APC-dependent proteolysis and retained pro-coagulant activity of FV [2]. In our study population, mutated allele A was found in 7% patients (only heterozygotes GA). We evaluated a role of mutation Leiden in pathogenesis of IVH development. The results of previous studies are unclear. Gopel et al. indicated an association of mutation FV (Leiden) with the incidence of IVH grades 1 and 2 and with protection role of it against IVH progression and extension [4]. In contrast, Ryckman et al. showed that heterozygotes may be predisposed for IVH grade I and II occurrence, but not grades III and IV [7]. Ramenghi et al. indicated that the risk ratio for IVH was 2.65 higher in carriers of mutation FV Leiden. The presence of mutation was associated with the severity of IVH [26]. Komlosi et al. [6], Aden et al. [8], Baier et al. [27], Petaja et al. [28], and Aronis et al. [29] did not find any association mutation of gene FV (Leiden) with IVH in preterm newborns. We did not find any association between FV Leiden mutation and incidence of IVH in preterm infants. However, the lack of association detected must be interpreted with caution, due to our small sample size with mutated allele A (n = 7).

20210G>A FII mutation

Factor II (FII) is a vitamin K-dependent pro-enzyme produced in the liver. The role of FII is converting fibrinogen to fibrin. The FII-encoding gene is located on chromosome 11 (region: p11–q12). The replacement of guanine at position 20210 with adenine is associated with higher levels of FII synthesis. It has been shown that the mutation of the FII gene is related to the incidence of thrombosis in certain venous locations (portal vein, intracranial veins). Being a carrier of both FV Leiden gene mutation and the FII G20210A mutation increases the risk of thrombotic incidents, and in the Polish population, carriers are estimated at approximately 1% [30]. We have not found any patient in our study population with a mutated allele A. That is the reason why further analysis of the FII G20210A mutation and its impact on IVH incidence in preterm infants was not performed. In contrast to previous studies published by Baier et al. [27], Gopel et al. [4], Hartemann et al. [31], Petaja et al. [28], Ryckman et al. [7], and Aden et al. [8], Ramenghi showed that infants with VLBW and heterozygous for FII G20210A mutation are at increased risk for developing IVH [26].

103G>T factor XIII polymorphism

FXIII plays an important role in the terminal phase of the clotting cascade. FXIII is composed of A and B subunits. FXIII is activated by thrombin in the presence of calcium by dissociation of subunit B, which consequently stabilizes the fibrin clot and increases its resistance to fibrinolysis. 103G>T FXIII polymorphism is caused by a point mutation in codon 34 of exon 2 of the FXIII gene and leads to valine-leucine change in the subunit A of the FXIII. The 103G>T polymorphism in subunit A is located in the activation peptide 3 amino acid, near the thrombin activation side [32]. The FXIII 103G>T polymorphism accelerates activation of FXIII by thrombin and changes the structure of fibrin clots into thinner fibers that are more densely packed [33]. Homozygous and heterozygous carriers of the FXIII 103G>T polymorphism have higher rates of hemorrhagic stroke among adults [34], but not in children [35]. Gopel et al. showed that very-low-body-weight infants who carried the factor XIII 34Leu allele had a moderately increased risk of IVH development [36]. These findings were not confirmed by Ryckman et al. [7]. In our study, we did not confirm any link between IVH occurrence and polymorphism FXIII 103G>T.

Conclusions

This study confirmed that the MTHFR 1298A>C polymorphism is associated with the risk of IVH. IVH is a significant problem for preterm infants. In addition to little progress in preventing IVH in preterm babies, substantial research that is focused on understanding the etiology, mechanism, and risk factors for IVH is imperative. In the era of personalized medicine, identification of genetic risk factors creates opportunities to generate preventative strategies. (XLS 42 kb)
  34 in total

1.  Influence of blood coagulation factor XIII and FXIII Val34Leu on plasma clot formation measured by thrombelastography.

Authors:  V Schroeder; T Chatterjee; H P Kohler
Journal:  Thromb Res       Date:  2001-12-15       Impact factor: 3.944

2.  C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: incidence and effect of combined genotypes on plasma fasting and post-methionine load homocysteine in vascular disease.

Authors:  N Q Hanson; O Aras ; F Yang; M Y Tsai
Journal:  Clin Chem       Date:  2001-04       Impact factor: 8.327

3.  Genetic polymorphisms of hemostasis genes and primary outcome of very low birth weight infants.

Authors:  Christoph Härtel; Inke König; Stefan Köster; Evelyn Kattner; Eckhardt Kuhls; Helmut Küster; Jens Möller; Dirk Müller; Angela Kribs; Hugo Segerer; Christian Wieg; Egbert Herting; Wolfgang Göpel
Journal:  Pediatrics       Date:  2006-08       Impact factor: 7.124

4.  Replication of genetic associations in the inflammation, complement, and coagulation pathways with intraventricular hemorrhage in LBW preterm neonates.

Authors:  Kelli K Ryckman; John M Dagle; Keegan Kelsey; Allison M Momany; Jeffrey C Murray
Journal:  Pediatr Res       Date:  2011-07       Impact factor: 3.756

Review 5.  The link between vascular features and thrombosis.

Authors:  Charles T Esmon; Naomi L Esmon
Journal:  Annu Rev Physiol       Date:  2011       Impact factor: 19.318

Review 6.  Pediatric thrombophilia.

Authors:  Janet Y K Yang; Anthony K C Chan
Journal:  Pediatr Clin North Am       Date:  2013-12       Impact factor: 3.278

7.  Increased prevalence of factor V Leiden mutation in premature but not in full-term infants with grade I intracranial haemorrhage.

Authors:  K Komlósi; V Havasi; J Bene; J Storcz; J Stankovics; G Mohay; J Weisenbach; G Kosztolányi; B Melegh
Journal:  Biol Neonate       Date:  2004-09-30

8.  FXIII gene Val34Leu polymorphism in Turkish children with cerebral infarct.

Authors:  Nejat Akar; Buket Dönmez; Gülhis Deda
Journal:  J Child Neurol       Date:  2007-02       Impact factor: 1.987

9.  The significance of genetic polymorphisms of factor V Leiden and prothrombin in the preeclamptic Polish women.

Authors:  Agnieszka Seremak-Mrozikiewicz; Krzysztof Drews; Ewa Wender-Ozegowska; Przemyslaw M Mrozikiewicz
Journal:  J Thromb Thrombolysis       Date:  2010-07       Impact factor: 2.300

Review 10.  Factor V Leiden thrombophilia.

Authors:  Jody Lynn Kujovich
Journal:  Genet Med       Date:  2011-01       Impact factor: 8.822

View more
  4 in total

1.  Genetic and epigenetic factors and early life inflammation as predictors of neurodevelopmental outcomes.

Authors:  Kirsi S Oldenburg; T Michael O'Shea; Rebecca C Fry
Journal:  Semin Fetal Neonatal Med       Date:  2020-05-15       Impact factor: 3.926

Review 2.  Research Advances of Germinal Matrix Hemorrhage: An Update Review.

Authors:  Jinqi Luo; Yujie Luo; Hanhai Zeng; Cesar Reis; Sheng Chen
Journal:  Cell Mol Neurobiol       Date:  2018-10-25       Impact factor: 5.046

Review 3.  Germinal Matrix-Intraventricular Hemorrhage: A Tale of Preterm Infants.

Authors:  Walufu Ivan Egesa; Simon Odoch; Richard Justin Odong; Gloria Nakalema; Daniel Asiimwe; Eddymond Ekuk; Sabinah Twesigemukama; Munanura Turyasiima; Rachel Kwambele Lokengama; William Mugowa Waibi; Said Abdirashid; Dickson Kajoba; Patrick Kumbowi Kumbakulu
Journal:  Int J Pediatr       Date:  2021-03-16

4.  Role of Fibronectin-1 polymorphism genes with the pathogenesis of intraventricular hemorrhage in preterm infants.

Authors:  Dawid Szpecht; Salwan R Al-Saad; Lukasz M Karbowski; Katarzyna Kosik; Grażyna Kurzawińska; Marta Szymankiewicz; Krzysztof Drews; Agnieszka Seremak-Mrozikiewicz
Journal:  Childs Nerv Syst       Date:  2020-04-13       Impact factor: 1.475

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.