Literature DB >> 28567057

Molecular Study of Acinetobacter baumannii Isolates for Metallo-β-Lactamases and Extended-Spectrum-β-Lactamases Genes in Intensive Care Unit, Mansoura University Hospital, Egypt.

Nashwa M Alkasaby1, Maysaa El Sayed Zaki2.   

Abstract

Acinetobacter baumannii (A. baumannii) has been known as a causative pathogen of hospital acquired infections. The aim of this study is to examine the presence of A. baumannii among clinical isolates from intensive care unit (ICU) in Mansoura University Hospital (MUH), its antibiotic resistance pattern, and prevalence of antibiotic resistance genes metallo-β-lactamases (MBLs) and extended-spectrum-β-lactamases (ESBLs) among A. baumannii isolates. A. baumannii was identified by colony morphology, API 20E, and confirmed by detecting the bla OXA-51-like carbapenemase gene by PCR. Phenotypic expression of MBLs resistance was demonstrated by Combined Disk Test (CDT) in 273 isolates (97.5%) and of ESBLs was demonstrated by double disc synergy method (DDST) in 6 isolates (2.1%). MBLs genes were positive in 266 isolates (95%) and ESBLs genes were positive in 8 isolates (2.9%). The most frequent genes of MBLs studied genes were IMP (95.7%) followed by SIM and GIM (47.1% and 42.9%; resp.). For ESBL genes, the most frequent gene was TEM (2.9%). From this study, we conclude that multidrug resistant (MDR) A. baumannii with MBLs activity was the most common isolate. Careful monitoring for the presence of MDR A. baumannii among hospitalized patients is recommended to avoid wide dissemination of antibiotic resistance.

Entities:  

Year:  2017        PMID: 28567057      PMCID: PMC5439075          DOI: 10.1155/2017/3925868

Source DB:  PubMed          Journal:  Int J Microbiol


1. Introduction

Acinetobacter baumannii (A. baumannii) is a Gram-negative coccobacilli nonglucose fermentative opportunistic pathogen [1]. A. baumannii is one of the most important nosocomial pathogens because of its longevity in the hospital environment and ability to resist various antimicrobial agents and to colonize susceptible patients treated with broad-spectrum antibiotic [2]. It has been related to various sites of infections like urinary tract, skin and soft tissue infections, pneumonia, and bacteremia especially in immunosuppressed patients [3-5]. Multidrug resistant A. baumannii (MDR A. baumannii), defined as an A. baumannii strain resistant to at least three different groups, penicillins and cephalosporins (including inhibitor combinations), fluoroquinolones, and aminoglycosides, has emerged and has been reported worldwide to significantly increase the morbidity, mortality, and cost of treatment [6]. The incidence of MDR A. baumannii is increasing worldwide, including Europe, North America, Latin America, and Asia [7]. Acinetobacter spp. exhibit multidrug resistance through production of β-lactamases, alterations in outer membrane proteins (OMPs) and penicillin-binding proteins (PBPs), and increased activity of efflux pumps [8]. Resistance to β-lactams appears to be primarily caused by production of β-lactamases which include extended-spectrum-β-lactamases (ESBLs), metallo-β-lactamases (MBLs), and oxacillinases [3]. MBLs are classes of powerful enzymes called carbapenemases responsible for antibiotic resistance. Four groups of these enzymes have been described in A. baumannii, including IMP-like, SIM-1, NDM-type, and VIM-like carbapenemases. MBLs-encoding genes are located on integrons that can be transmitted from one bacterial species to another [9, 10]. Extended-spectrum-β-lactamases (ESBLs) are encoded by TEM-type, SHV-type, and CTX-M-type genes; they are resistance to penicillins and third-generation cephalosporins [11]. The drug of choice to treat nosocomial infection caused by MDR A. baumannii is the carbapenems. However, there is an increasing rate of carbapenem-resistant A. baumannii around the world [12]. There are limited data about the prevalence of A. baumannii among clinical isolates from Egypt and its pattern of antibiotics resistance. Therefore, we have performed this study to examine the presence of A. baumannii among clinical isolate in intensive care units (ICU) from one Egyptian tertiary care hospital, its antibiotic resistance pattern, and the prevalence of antibiotic resistance genes MBLs and ESBLs.

2. Material and Method

This cross-sectional study was carried out in the main microbiology laboratory at Mansoura University Hospital, Egypt, between January 2014 and January 2016. The study was approved by Mansoura Faculty of Medicine ethical committee. Clinical samples were obtained from patients admitted to ICU including blood, urine, sputum endotracheal secretion, wound swabs, pus, and CSF.

2.1. Culture and Identification

The specimens were inoculated on blood agar, chocolate agar, and MacConkey agar medium and incubated for 24 h at 37C. Culture growth was identified to be A. baumannii growth by colony morphology and API 20 E confirmed by detecting bla OXA-51 carbapenemase gene using PCR [13]. Antibiotics susceptibility tests were done followed by multiplex PCR for detection of MBLs genes and ESBLs genes.

2.2. Antimicrobial Susceptibility

2.2.1. Standard Disc Diffusion Technique

A. baumannii isolates were tested for the susceptibility to ceftazidime (30 μg), cefepime (30 μg), imipenem (10 μg), meropenem (10 μg), gentamicin (10 μg), amikacin (30 μg), ciprofloxacin (5 μg), levofloxacin (5 μg), sulfamethoxazole/trimethoprim (1.25/23.75 μg), and piperacillin/tazobactam (100 μg/10 μg). These analyses were performed by standard disc diffusion technique and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines [16].

2.2.2. E-Test (MIC Determination)

The E-test was used to determine antimicrobial susceptibility and the minimum inhibitory concentration (MIC) for tigecycline and colistin susceptibility according to the CLSI guidelines. Minimum inhibitory concentration (MIC) breakpoints for colistin were resistance, ≥4 mg/L, and susceptibility, ≤2 mg/L, and for tigecycline were resistance, ≥8 mg/L, and susceptibility, ≤2 mg/L. E. coli ATCC 35218 and Pseudomonas aeruginosa ATCC 27853 were used in all tests as control strain [16].

2.3. Phenotypic Detection of MBLs Activity

2.3.1. Imipenem-EDTA Combined Disc Test (CDT)

Isolates resistant to imipenem were selected for detection of MBLs enzymes by imipenem-EDTA combined disk method. The test isolates (opacity adjusted to 0.5 McFarland opacity standard) were cultured on Mueller-Hinton agar plate as recommended by CLSI. After drying, two 10 μg imipenem discs were placed on the culture plate with 20 mm distance from center to center of the discs. 10 μl of 0.5 M EDTA was added to one of the imipenem discs and incubated overnight. Isolates showing ≥7 mm increase in the inhibition zone size of imipenem-EDTA disc compared to the imipenem disc alone were considered as MBLs producers [17].

2.4. Phenotypic Identification of ESBL Producing Isolates

2.4.1. Double Disc Synergy Test (DDST)

Isolates resistant to third-generation cephalosporins were tested for ESBLs production by CLSI double disc synergy method (DDST). Antibiotic disks containing ceftazidime (30 μg), cefotaxime (30 μg), ceftazidime (30 μg) + clavulanic acid (10 μg), and cefotaxime (30 μg) + clavulanic (10 μg) were used. Pairs of disks (ceftazidime with ceftazidime/clavulanic acid and cefotaxime with cefotaxime/clavulanic) were placed on Muller-Hinton agar medium with 20 mm space between them. According to the CLSI criteria and manufacturer instruction, the ≥5 mm inhibition zone of growth in ceftazidime/clavulanic acid and cefotaxime/clavulanic compared to ceftazidime and cefotaxime was regarded as an ESBLs producing isolate [18].

2.5. Multiplex PCR

2.5.1. DNA Extraction

Pure colonies of A. baumannii were used for DNA extraction by Qiagen kit according to the manufacturer recommendations and kept at −70°C till amplification reactions.

2.5.2. Polymerase Chain Reaction (PCR)

(a) PCR for the Detection of blaOXA-51-Like Gene. Polymerase chain reaction (PCR) assay was performed for the detection of blaOXA-51-like gene, a 353-base-pair (bp) amplicon, as an internal gene for molecular confirmation of A. baumannii isolates at the species level primer sequence: F/5′-TAA TGC TTT GAT CGG CCT TG-3′, R/5′-TGG ATT GCA CTT CAT CTT GG-3′ [13]. (b) Multiplex PCR. Multiplex PCR was used to screen for the following resistance genes as previously described [14, 15]. Metallo-β-lactamases are blaIMP, blaVIM, blaGIM, bla SPM, and blaSIM-1 and class A beta-lactamases are blaTEM, blaSHV, and blaCTX-M. Primers used in this study are listed in Table 1. For the amplification procedures we used 3 microns of the extracted DNA applied over 25 microns of ready to use master mix with 0.2 microns of Taq polymerase 5 U/μl (Qiagen) with l μl of each primer (10 pmol/ml) from each reverse and forward primer.
Table 1

Primers used for PCR amplification of the studied genes.

GeneSequencebpReference
CTX-MF: ATGTGCAGTACCAGTAAGCGTCATGGCR: TGGGTAAAATATGTCACCAGAACCAG593[14]
SHVF: ATGCGTTATATTCGCCTGTR: TGCTTTGTTATTCGGGCCAA747[14]
TEMF: CGC CGC ATA CAC TAT TCT CAG AAT GAR: ACG CTC ACC GGC TCC AGA TTT AT445[14]
VIMF: GATGGTGTTTGGTCGCATAR: CGA ATGCGCAGCACCAG390[15]
IMPF: GGAATAGAGTGGCTTAAYTCTCR: CCA AACYACTASGTTATCT188[15]
SPM-1F: AAAATCTGGGTACGCAAACGR: ACATTATCCGCTGGAACAGG271[15]
SIM-1F: TAC AAGGGATTCGGCATCGR: TAATGGCCTGTTCCCATGTG570[15]
GIM-1 F: TCG ACACACCTTGGTCTGAA R: TCG ACACACCTTGGTCTGAA477[15]
For PCR detection of amplified genes, agarose gel electrophoresis of the amplified DNA product with 100 bp size marker was carried out in a 2% agarose gel for 2 h at 80 V and stained with ethidium bromide and visualized under UV transillumination [19].

3. Results

This study included 280 of A. baumannii isolated from different clinical samples from intensive care unit, Mansoura University Hospitals during 24 months. A. baumannii was confirmed by detecting bla OXA-51 gene in all isolates. A. baumannii isolates were most frequently recovered from endotracheal secretion (39.3%) followed by sputum (23.8%), pus/wound swab (14.3%), blood (11.8%), urine (10.7%), and cerebrospinal fluid (0.4%), Table 2.
Table 2

Acinetobacter baumannii distribution according to the site of infection.

SampleNumber %
Endotracheal secretion11039.3
Sputum6623.8
Pus/wound swab4014.3
Blood3311.8
Urine3010.7
CSF10.4
A. baumannii isolates were highly resistant to imipenem, meropenem, ceftazidime, and cefepime with resistance rate of 95.7%, 95.7%, 96.4%, and 97.1%, respectively, Table 3. Also, the isolates showed high frequency of resistance to ciprofloxacin, gentamicin, sulfamethoxazole/trimethoprim, piperacillin/tazobactam, and amikacin (93%, 85%, 89%, and 95%, resp.).
Table 3

Antibiotics resistant patterns in Acinetobacter baumannii isolates.

AntibioticsNumber%
Ceftazidime27096.4
Cefepime27297.1
Imipenem26895.7
Meropenem26895.7
Ciprofloxacin26092.9
Gentamicin26092.9
Sulfamethoxazole/trimethoprim21877.9
Piperacillin/tazobactam25089.2
Amikacin25089.2
Colistin93.2
Tigecycline51.8
Regarding colistin and tigecycline sensitivity, lower resistance was reported for these antibiotics (3% and 1.5%, resp.). The phenotypic expression of MBLs resistance was demonstrated by CDT in 273 isolates (97.5%) and of ESBLs was demonstrated in 6 isolates by DDST (2.1%). Genotypes detection for the studied genes for MBLs was positive in 266 isolates (95%) and for ESBLs was positive in 8 isolates (2.9%). Totally 280 A. baumannii isolates have been examined for 5 MBLs and 3 ESBLs encoding genes. For MBLs genes, the most frequent genes were IMP (95.7%), followed by SIM and GIM (47.1% and 42.9%, resp.), Table 4. The most frequent genes from ESBL studied genes were TEM (2.9%), SHF (2.1%), and CTX-M in 1.8%, Table 5. Some of the isolates had more than one gene.
Table 4

MBLs genes detected in Acinetobacter baumannii isolates.

GenesNumber %
IMP26895.7
SIM13247.1
GIM12042.9
VIM00
SPM00
Table 5

ESBLs genes detected in Acinetobacter baumannii isolates.

GenesNumber %
TEM82.9
SHV62.1
CTX-M51.8

4. Discussion

Multidrug resistant (MDR) A. baumannii that are present in the ICU and in the hospital environment represent therapeutic problem because of resistance to most antimicrobial agents [1]. In the present study, A. baumannii was isolated most commonly from the respiratory tract specimen followed by wounds and blood. This is consistent with data presented by other studies where the major source of A. baumannii isolates was respiratory specimens followed by wounds [20, 21]. Antibiotic resistance rate was high for most antibiotic except for colistin and tigecycline. The resistance of A. baumannii isolates to cephalosporins in the present study was in accordance with another study conducted by Safari et al., 2013 [5]. Ciprofloxacin resistance rate (92.9%) was similar to studies conducted in Egypt and India which showed resistance rate of 85% and 99%, respectively [22, 23]. Regarding aminoglycoside, resistant rate is 90%; this is in accordance with other studies [24]. This finding is a warrant index to the possibility of coexistence of genes responsible for aminoglycoside and carbapenem resistance on the same genetic elements that may explain high resistance level to the tested aminoglycosides in the present study [7]. Carbapenems are generally the last resort in the treatment of life-threatening infections caused by MDR A. baumannii. A. baumannii strains isolated in the present study had high frequency resistance to imipenem, meropenem. The presence of high resistance to carbapenem has been reported previously in Egypt [22, 25, 26] and Turkey [20]. This finding can be explained by inadequate adherence to infection control guideline in addition to inappropriate use of carbapenem [26]. The preliminary resistance pattern of the isolated A. baumannii directs the attention to the presence of MBLs that was proven by phenotypic study by Combined Disk Test (CDT) for MBLs with a high frequency of MBLs gene (95%). Previous reports stated that MBLs production among A. baumannii range from 49% up to 99% [27-29]. In the present study the presence of phenotypic ESBLs was detected in 2.1% of the isolates. On the contrary, higher results were reported in previous studies for ESBL producers bacteria with range from 20% up to 85% [29-31]. Treatment of patients infected with MBLs producers is challenging due to the currently limited options. Colistin and tigecycline are currently the only treatment choice for these MDR A. baumannii. Fortunately our finding in the present study showed that resistance rate to colistin and tigecycline is low (3% and 1.5%) and was in accordance with other studies [32, 33]. In our study, all isolated A. baumannii strains carried bla OX-51 gene and were confirmed as A. baumannii. This gene is considered as a natural component of the species and may be associated with resistance to carbapenems [34]. Genotypes detection of the studied genes for MBLs was positive in 266 isolates (95%) and for ESBLs was positive in 8 isolates (2.9%). Among MBLs, IMP gene was the most detected gene as reported previously in other studies [35, 36]. IPM and VIM genes have been reported from different countries with different prevalence rate [37-39]. On the contrary, IPM and VIM genes were not detected in study conducted in Egypt by Fatouh and El-din 2014 [40]. SPM gene was not detected in the present study; this is in accordance with another study conducted in Iran by Moghadam et al. 2016 [41]. Among ESBLs, TEM gene was positive in 2.9% of A. baumannii isolates; higher result was reported (13.15%) by Rezaee et al., 2013 [35].

5. Conclusion

MDR A. baumannii isolates with metallo-β-lactamases activities represent therapeutic problem in ICU. The main gene encoding for these metallo-β-lactamases in our study was IMP. MDR A. baumannii showed high resistance rate to most of the available antimicrobial agents, except for tigecycline and colistin. Careful monitoring for the presence of MDR A. baumannii among hospitalized patients is recommended to avoid wide dissemination of antibiotics resistance and to limit the indiscriminative use of cephalosporins and carbapenems in the hospital. Antibiotics Stewardship Program and infection control measures environment should be applied to minimize the emergence of multiple drug resistant bacteria. Physician should treat infection and not colonization based on clinical signs and laboratory parameters indicating systemic inflammatory response/sepsis.
  35 in total

1.  Drug-resistant genes carried by Acinetobacter baumanii isolated from patients with lower respiratory tract infection.

Authors:  Ning Dai; De-zhi Li; Ji-chao Chen; Yu-sheng Chen; Rong Geng; Ying-hui Hu; Jing-ping Yang; Juan DU; Cheng-ping Hu; Wei Zhang; Jia-shu Li; Qin Yu; Huan-ying Wan; Lan Mu; Xiao-ning Zhong; Li-ping Wei; Jian-jun Ma; Qiu-yue Wang; Ke Hu; Gui-zhen Tian; Shao-xi Cai; Rui-qin Wang; Bei He; Si-qin Wang; Zhan-wei Wang; Su-rui Zhao; Zhan-cheng Gao
Journal:  Chin Med J (Engl)       Date:  2010-09       Impact factor: 2.628

2.  Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases.

Authors:  Matthew J Ellington; James Kistler; David M Livermore; Neil Woodford
Journal:  J Antimicrob Chemother       Date:  2006-12-21       Impact factor: 5.790

Review 3.  Extended-spectrum-beta-lactamase, AmpC, and Carbapenemase issues.

Authors:  Kenneth S Thomson
Journal:  J Clin Microbiol       Date:  2010-02-24       Impact factor: 5.948

4.  Three distinct clones of carbapenem-resistant Acinetobacter baumannii with high diversity of carbapenemases isolated from patients in two hospitals in Kuwait.

Authors:  N A Al-Sweih; M Al-Hubail; V O Rotimi
Journal:  J Infect Public Health       Date:  2012-01-05       Impact factor: 3.718

5.  OXA beta-lactamase-mediated carbapenem resistance in Acinetobacter baumannii.

Authors:  S M Amudhan; U Sekar; K Arunagiri; B Sekar
Journal:  Indian J Med Microbiol       Date:  2011 Jul-Sep       Impact factor: 0.985

6.  Characterisation of carbapenem-resistant Acinetobacter baumannii outbreak strains producing OXA-58 in Turkey.

Authors:  Canan Kulah; Marlies J Mooij; Fusun Comert; Elif Aktas; Guven Celebi; Nagihan Ozlu; Martine C Rijnsburger; Paul H M Savelkoul
Journal:  Int J Antimicrob Agents       Date:  2010-05-26       Impact factor: 5.283

Review 7.  Tigecycline for the treatment of multidrug-resistant (including carbapenem-resistant) Acinetobacter infections: a review of the scientific evidence.

Authors:  Drosos E Karageorgopoulos; Theodore Kelesidis; Iosif Kelesidis; Matthew E Falagas
Journal:  J Antimicrob Chemother       Date:  2008-04-24       Impact factor: 5.790

8.  Prevalence of ESBL and MBL encoding genes in Acinetobacter baumannii strains isolated from patients of intensive care units (ICU).

Authors:  Marzieh Safari; Amir Sasan Mozaffari Nejad; Abas Bahador; Rasool Jafari; Mohammad Yousef Alikhani
Journal:  Saudi J Biol Sci       Date:  2015-01-17       Impact factor: 4.219

9.  (1)H NMR-based metabolite profiling of planktonic and biofilm cells in Acinetobacter baumannii 1656-2.

Authors:  Jinki Yeom; Ji-Hyun Shin; Ji-Young Yang; Jungmin Kim; Geum-Sook Hwang
Journal:  PLoS One       Date:  2013-03-06       Impact factor: 3.240

10.  VIM- and IMP-type metallo-beta-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals.

Authors:  Kyungwon Lee; Wee Gyo Lee; Young Uh; Gyoung Yim Ha; Jihyun Cho; Yunsop Chong
Journal:  Emerg Infect Dis       Date:  2003-07       Impact factor: 6.883

View more
  16 in total

1.  The Spread of Insertion Sequences Element and Transposons in Carbapenem Resistant Acinetobacter baumannii in a Hospital Setting in Southwestern Iran.

Authors:  Zahra Hashemizadeh; Gholamreza Hatam; Javad Fathi; Fatemeh Aminazadeh; Hossein Hosseini-Nave; Mahtab Hadadi; Nafiseh Hosseinzadeh Shakib; Sodeh Kholdi; Abdollah Bazargani
Journal:  Infect Chemother       Date:  2022-06-02

Review 2.  Carbapenemase-Producing Non-Glucose-Fermenting Gram-Negative Bacilli in Africa, Pseudomonas aeruginosa and Acinetobacter baumannii: A Systematic Review and Meta-Analysis.

Authors:  Mizan Kindu; Lemma Derseh; Baye Gelaw; Feleke Moges
Journal:  Int J Microbiol       Date:  2020-11-03

3.  Occurrence of blaTEM and blaCTXM Genes and Biofilm-Forming Ability among Clinical Isolates of Pseudomonas aeruginosa and Acinetobacter baumannii in Yaoundé, Cameroon.

Authors:  Estelle Longla Madaha; Hortense Kamga Gonsu; Rhoda Nsen Bughe; Marie Christine Fonkoua; Collins Njie Ateba; Wilfred Fon Mbacham
Journal:  Microorganisms       Date:  2020-05-11

4.  Investigation of multidrug-resistant ST2 Acinetobacter baumannii isolated from Saint George hospital in Lebanon.

Authors:  Tania Nawfal Dagher; Charbel Al-Bayssari; Selma Chabou; Nadine Antar; Seydina M Diene; Eid Azar; Jean-Marc Rolain
Journal:  BMC Microbiol       Date:  2019-02-02       Impact factor: 3.605

5.  Rapid detection and molecular survey of blaVIM, blaIMP and blaNDM genes among clinical isolates of Acinetobacter baumannii using new multiplex real-time PCR and melting curve analysis.

Authors:  Hossein Goudarzi; Elnaz Sadat Mirsamadi; Zohreh Ghalavand; Mojdeh Hakemi Vala; Hamed Mirjalali; Ali Hashemi
Journal:  BMC Microbiol       Date:  2019-06-10       Impact factor: 3.605

6.  Antibiogram, Prevalence of OXA Carbapenemase Encoding Genes, and RAPD-Genotyping of Multidrug-Resistant Acinetobacter baumannii Incriminated in Hidden Community-Acquired Infections.

Authors:  Waleed El-Kazzaz; Lobna Metwally; Reham Yahia; Najwa Al-Harbi; Ayat El-Taher; Helal F Hetta
Journal:  Antibiotics (Basel)       Date:  2020-09-15

7.  Landscape of Multidrug-Resistant Gram-Negative Infections in Egypt: Survey and Literature Review.

Authors:  Amani El-Kholy; Hadir A El-Mahallawy; Noha Elsharnouby; Mohamed Abdel Aziz; Ahmed Mohamed Helmy; Ramy Kotb
Journal:  Infect Drug Resist       Date:  2021-05-24       Impact factor: 4.003

Review 8.  Understanding the Epidemiology of Multi-Drug Resistant Gram-Negative Bacilli in the Middle East Using a One Health Approach.

Authors:  Iman Dandachi; Amer Chaddad; Jason Hanna; Jessika Matta; Ziad Daoud
Journal:  Front Microbiol       Date:  2019-08-23       Impact factor: 5.640

9.  Association between antimicrobial resistance among Enterobacteriaceae and burden of environmental bacteria in hospital acquired infections: analysis of clinical studies and national reports.

Authors:  Thor-Henrik Henriksen; Workeabeba Abebe; Wondwossen Amogne; Yitagesu Getachew; Harald Weedon-Fekjær; Jörn Klein; Yimtubezinash Woldeamanuel
Journal:  Heliyon       Date:  2019-07-22

10.  Study of genetic diversity, biofilm formation, and detection of Carbapenemase, MBL, ESBL, and tetracycline resistance genes in multidrug-resistant Acinetobacter baumannii isolated from burn wound infections in Iran.

Authors:  Reza Ranjbar; Abbas Farahani
Journal:  Antimicrob Resist Infect Control       Date:  2019-11-07       Impact factor: 4.887

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.