LncRNA-AF113014 promotes the expression of Egr2 by interaction with miR-20a to inhibit proliferation of hepatocellular carcinoma cells.

Long non-coding RNAs (lncRNAs), tentatively identified as non-protein coding RNA, are transcripts more than 200nt in length and accounting for 98% of the whole genome of human being. Accumulating evidence showed aberrant expressions of lncRNAs are strongly correlated to the development of cancers. In this study, AF113014 is a new lncRNA identified from Microarray. We found AF113014 is differentially expressed between HCC cell lines and normal hepatocytes. Functionally, AF113014 inhibited proliferation of HCC cells both in vitro and in vivo, whereas the opposite effect was observed when AF113014 knockdown. Moreover, we identified that Egr2, a tumor suppressor gene, was a downstream target gene of AF113014. Furthermore, we discovered that AF113014 up-regulated Egr2 expression through interacting with miR-20a by using dual-luciferase reporter assay, qRT-PCR and Western blotting analysis. Our data provides a new insight for understanding the mechanisms of HCC.

Introduction

Hepatocellular carcinoma (HCC), the third cause of death, is one of the most common malignant tumors worldwide. Although the medical technology of diagnosis and treatment has been improved yearly, the mortality of HCC is still growing [1, 2]. Biomarkers not only help to diagnose the early stages of tumors rapidly, but also to implement effective individualized treatment and to assess the prognosis of patients [3-5]. However, the current research on HCC related biomarkers is still limited. It is important to find novel therapeutic targets for more accurate diagnosis and effective treatments.

In recent years, researchers found that only 2% of the whole genome of human being are protein coding genes, and the rest 98% are transcribed to non-coding RNAs (ncRNAs). Among them, long non-coding RNA (lncRNA) is of great interest as it could regulate and control the activity of protein coding gene directly or indirectly [6-9]. lncRNAs, tentatively identified as non-protein coding RNA, transcripts more than 200nt in length and accounting for about 80% of the ncRNA, usually have polyA tail structure [10].

Previously, lncRNA was considered as “junk gene” of none biological function and by-products transcribed from RNA polymerase II. Now, lncRNA not only participates in normal physiological activity of cells, but also closely relates to the pathological mechanism, disease development and prognosis of many tumors possibly through ways such as chromosome modification, cutting and splicing, transcriptional activation, mRNA degradation and translational control [11-15]. For example, H19 is a maternal characterization of non-coding RNA with the biphasic effect of tumor promoter and suppressor. H19 suppressed metastasis in HCC through activating miR-200 family. H19 alsocould be activated by c-MYC in breast cancer and down-regulated by p53 in hepatocellular carcinoma. In contrast, H19 locus clearly displays a tumor suppressor effect in mice [16-18]. lncRNA-HEIH, as a proto-oncogene, is significantly associated with tumor recurrence and prognosis in HBV related-HCC [19]. HOTAIR increased cancer invasiveness and metastasis dependent on PRC2 [20]. Although there are increasing researches on lncRNAs, few of these functional mechanisms have clear understanding. At present, the mechanism of lncRNA function mainly through the following ways: lncRNA combines with specific protein partners to influence their activity and localization; lncRNA competitively combines with miRNA to regulate its target mRNA; lncRNA may have an enhancer effect on certain coding genes l; lncRNA can also affect the expression of its neighboring genes, in other words, by changing its physical location to the target genes [21-24].

Recently, Braconi et al. [25] showed that AF113014 was differentially expressed between HCC cell lines and the normal hepatocytes based on microarray analysis. AF113014 is a newly identified lncRNA whose role in the development of cancer has not been reported yet. In this study, we detected the expression and function of AF113014 in tumor growth in vitro and in vivo. Our study further found that AF113014 can up-regulate anti-oncogene Egr2 expression by interaction with miR-20a. We explained how AF113014 could inhibit proliferation of hepatocellular carcinoma cells. Our work provided a new perspective in comprehending the connection between lncRNA and HCC, and suggested that AF113014 was a tumor suppressor in HCC and might be a novel potential target for therapy of HCC.

Materials and methods

Cell lines

Human immortalized normal hepatocytes (L02) and human HCC lines SMMC7721, HepG2, SK-Hep1 and Huh7 were preserved in our lab and cultured in Dulbecco's modified Eagle's medium (DMEM) (Hyclone, China), supplemented with 10% fetal bovine serum (Gibco, USA), 100U/ml penicillin and 100ug/ml streptomycin. Cells were maintained in a humidified incubator with 5% CO2 at 37°C.

RNA extraction and quantitative real-time PCR (qRT-PCR)

Total RNAs from cell lines were extracted with TRIzol reagent (Invitrogen, CA) and the first-strand cDNA was generated using the PrimeScript RT reagent kit with gDNA Eraser (Takara, Japan) or miRNA cDNA Kit (CWBio, China) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using UltraSYBR mixture (Cwbio, China) and conducted using the CFX Connet TM real-time PCR system (Bio-Rad, USA). The quantification analysis was analyzed by the 2-ΔΔCT method [26]. GAPDH and U6 mRNA were used for normalization. All the primers are listed in Table 1.

Table 1

Primer sequences used for PCR or plasmids construction and siRNA sequence.

Real-time PCR primer	Sequence (5′-3′)
GAPDH-F	CGACCACTTTGTCAAGCTCA
GAPDH-R	AGGGGTCTACATGGCAACTG
AF113014-F	TCCAGTCATTGCTAAGTGTCCC
AF113014-R	ATCAGGCAGGTCTGGAAAATAG
Egr2-F	GCCGTAGACAAAATCCCAG
Egr2-R	CCACTCCGTTCATCTGGTC
miR-20a	TAAAGTGCTTATAGTGCAGGTAG
snRNA U6-F	AGAGCCTGTGGTGTCCG
snRNA U6-R	CATCTTCAAAGCACTTCCCT
AF113014 over-expression primer	Sequence (5′-3′)
Ad-AF113014-F	CGGGATCCGATGCCTCTACCTATCAGATGTTG
Ad-AF113014-R	CCAAGCTTTGGGCCCACATTTTTACTCTTGTC
pGL3-control-Egr2-3’UTR-F	AGCTCTAGATTGACTAGGTTTTGCTAC
pGL3-control-Egr2-3’UTR-R	AGCTCTAGAACTAGATATGCTCTGATTC
siRNA sequences	Sequence (5′-3′)
siRNA NC	UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT
siAF113014	CCUUAACUCCCUCAGUUAUTTAUAACUGAGGGAGUUAAGGTT
siEgr2	CUCUCUACAAUCCGUAACUdTdTAGUUACGGAUUGUAGAGAGdTdT

Vector construction and transfection

All sequences of cloning primers are shown in Table 1. The full-length AF113014 was PCR-amplified from the genomic DNA of L02 cells and cloned into BamH I and Hind III sites of pAdTrace-TO4 shuttle vector (preserved in our lab). CDS region of Egr2 was cloned into BamH I and Hind III sites of pAdTrace-TO4 shuttle vector. After generating recombinant adenoviruses in HEK-293 packaging cells, we got virus lysate named Ad-AF113014 and Ad-Egr2, which could over-expression AF113014 and Egr2. The relative negative control adenovirus (Ad-GFP) was preserved in our lab. In the present study, adenovirus infection efficiency is nearly to 100% (S1 Fig). The 3'-UTR of human EGR2 containing miR-20a binding site was PCR-amplified and cloned into the Xba I site of pGL3-control dual-luciferase miRNA target expression vector (Promega, USA). siAF113014, siEgr2 and its negative control (siRNA NC) were purchased from Invitrogen (Shanghai, China), their sequences are listed in Table 1. Cells were transfected with a Lipofectamine 2000 kit (Invitrogen, CA) according to the manufacturer’s instructions. All constructed vectors were confirmed by DNA sequencing.

MTS assay

The mock and infected cells (3,900 cells/well) were seeded into 96-well plates after 24h transfection. Three wells of each group were detected at different time points (12, 24, 48, and 72h) using the MTS kit (Promega, USA), followed the manufacturer’s protocol. Then the absorbance was measured at 490nm. All experiments were repeated 3 times.

Colony formation assay

The mock and infected cells (1 × 105 cells/well) were seeded into 6-well plates after 24h transfection and cultured for 7 days. Clones were fixed with 4% paraformaldehyde for 30 min and stained with a crystal violet cell colony staining kit (GenMed Scientifics, USA) according to the manufacturer’s instructions.

Western blot analysis

Total protein was extracted from tissues or cells using RIPA buffer (Beyotime, China), supplementing with 1 mmol/L PMSF. Then the protein concentration was measured by the BCA Assay Kit (Beyotime, China). 50 μg of proteins were separated by 10% SDS-PAGE and transferred to a PVDF membrane. Proteins were probed with Egr2 primary antibody (Cat # 13491-1-AP, 1:750, Proteintech) and GAPDH (Cat # 10494-1-AP, 1:5000, Proteintech), respectively. The blots were incubated with a goat anti-rabbit HRP secondary antibody (Cat #SA00001-2, 1:5000, Proteintech). Finally, the integrated density of the band was detected using an ECL Detection Reagent (Millipore, MA) and quantified by Image Lab software (Bio-Rad, USA).

Luciferase reporter gene assays

SMMC7721 cells were seeded into 24-well plates at a density of 50% and allowed to settle for 12h. Cells were co-transfected with Ad-AF113014 or Ad-GFP, 300ng pTARGET-miR-20a or pTARGET vector (both preserved in our lab), 200ng pGL3-control-Egr2-3’UTR or pGL3-control and 25ng of the control Renilla plasmid pRL-TK (Promega, USA) using Lipofectamine2000. Luciferase and renilla signals were measured 48h after transfection using the Dual-Luciferase Reporter Assay System (Promega, USA). All experiments were performed in triplicate and repeated 3 times.

Tumor xenograft implantation in nude mice

Four-week-old female BALB/C nude mice were purchased from the Laboratory Animal Services Center of Chongqing Medical University (Chongqing, China). Animal handling and experimental procedures were approved by the Animal Experimental Ethics Committee of Chongqing Medical University. The mice were divided into two groups randomly: control group (Ad-GFP), AF-113014 group (Ad-AF113014). Adenovirus infected SMMC7721 cells respectively for 48h before cells were collected. 1×106 cells were subcutaneously injected in the hip back of nude mice. Tumor volume was measured every five days and calculated using the equation: volume (mm3) = length×width2/2. 4 weeks later, mice were sacrificed and tumors were dissected.

Immunohistochemistry

Paraformaldehyde-fixed, paraffin-embedded tissues of transplanted tumors were sectioned at 4.5μm thickness. They were detected by an antibody Ki-67 (BS1454, 1:100, Bioworld) and Egr2 (Cat#13491-1-AP, 1:50, Proteintech), as well as the slides of cells. Visualization was achieved using 3, 3′-diaminobenzidine substrate and sections stained with PBS were regarded as the negative staining control.

Human tissue samples

Human liver cancer tissues and paired pericarcinomatous tissues were collected from the 1st or 2nd Affiliated Hospitals of Chongqing Medical University between 2010 and 2012. The tissues were from patients who had surgery for HCC without radiotherapy and chemotherapy. The human subject protocol was approved by the Clinical Research Ethics Committee of Chongqing Medical University. Written consent was obtained from each patient.

Statistical analysis

Data are expressed as the means and standard deviations. Statistical analysis was performed by X2 analysis and Student’s t test. P < 0.05 was considered statistically significant.

Results

Expression of AF113014 was down-regulated in HCC cell lines

We firstly identified whether AF113014 was a lncRNA. DNAsist software analysis showed that AF113014 cannot code successive amino acids and software (http://cpc.cbi.pku.edu.cn/programs/run_cpc.jsp) also predicted AF113014 has non-coding capacity. Then we examined the AF113014 expressions in normal liver cell (L02) and a panel of HCC cell lines (SMMC7721, HepG2, SK-Hep1, Huh7) by qRT-PCR. The results showed that AF113014 were significantly lower in the HCC cell lines, compared with L02 (Fig 1).

Fig 1

Expressions of AF113014 were down-regulated in HCC cell lines.

lncRNA-AF113014 expressions in L02 and HCC cell lines. *P<0.05 vs L02.

AF113014 inhibited proliferation of HCC cell in vitro

Next, we sought to evaluate the biological functions of AF113014. Over-expression by adenovirus or suppression by siRNA was used to identify the functional role of AF113014 on tumor growth in SMMC7721 cells and Huh-7 cells by MTS and colony formation assay. The over-expressing or knockdown efficiency in SMMC7721 cells and Huh-7 cells were verified by qRT-PCR (Fig 2A). MTS and colony formation assay showed that AF113014 over-expression significantly reduced HCC cells proliferation, whereas AF113014 knockdown promoted cell proliferation (Fig 2B and 2C). Therefore, these results suggested that AF113014 could regulate cell proliferation of HCC cells.

Fig 2

AF113014 inhibited proliferation of HCC cells in vitro.

(A) Relative expressions of AF113014 in SMMC7721 and Huh-7 cells transfected with Ad-AF113014 or siAF113014. GAPDH was used as reference gene in real-time PCR. (B) Proliferations of SMMC7721 and Huh-7 cells transfected with Ad-AF113014 or siAF113014 were examined by MTS. (C) Proliferations of SMMC7721 and Huh-7 cells transfected with Ad-AF113014 or siAF113014 were examined by colony formation assay. *P<0.05, **P<0.01.

Egr2 was a target gene of AF113014

How did AF113014 affect HCC proliferation? We found that gene NRBF2 and Egr2 were located in the upstream of AF113014 position in the chromosome through bioinformatics analysis (Fig 3A). It has reported that NRBF2 mainly involved in starvation-induced autophagy [27-29]. Overexpressed or knockdown AF113014, the expressions of NRBF2 protein were no obvious change (S2 Fig). This result meant that AF113014 had no effect on NRBF2. However, Egr2 had biological functions such as cell apoptosis, differentiation and proliferation [30-36]. Base on the above finding, we supposed that Egr2 might be a target gene of AF113014.

Fig 3

Egr2 was downstream target gene of AF113014.

(A) The location of AF113014 in chromosome 10. (B, C) Relative mRNA and protein expressions of Egr2 in Ad-AF113014 or siAF113014 transfected SMMC7721 cells, respectively. GAPDH was used as an internal quantitative control. * P < 0.05, ** P<0.01.

Next, we explored the association between AF113014 and Egr2 by qRT-PCR and western blotting analysis. Our data showed that overexpression of AF113014 increased Egr2 expression in SMMC7721 cells at both mRNA and protein levels. In contrast, AF113014 knockdown decreased the expressions of Egr2(Fig 3B and 3C). Taken together, these data suggest that AF113014 could regulate Egr2 expression.

Egr2 were down-regulated in HCC cell lines

As a target gene of AF113014, what is the biological function of Egr2? Firstly, we assessed Egr2 expression in HCC cell lines by qRT-PCR(Fig 4A) and immunostaining (Fig 4B). The data showed that the expression of Egr2 were downregulated in HCC cell lines, compared with the hepatic immortal cell line L02.

Fig 4

Egr2 was down-regulated in HCC cell lines.

(A) Relative expression of Egr2 in L02 and HCC cells was analyzed by qRT-PCR. (B) Relative expression of Egr2 in L02 and HCC cells was detected by immunohistochemistry. *P<0.05, **P<0.01.

Egr2 suppressed HCC cell proliferation in vitro

To examine the function of Egr2 in HCC, adenovirus expressing Egr2 or siRNA targeting Egr2 was used. The efficiencies of Egr2 over-expression or knockdown in SMMC7721 cells were assessed by qRT-PCR anwestern blot (Fig 5A). As expected, decreased proliferation was observed when over-expressed Egr2, and increased cell proliferation was observed when Egr2 was silenced in SMMC7721 cells by MTS and colony formation assay (Fig 5B and 5C). These results showed that Egr2 could inhibit the proliferation of HCC cells.

Fig 5

Egr2 Suppressed HCC cell proliferation in vitro.

(A) Relative mRNA and protein expressions of Egr2 in Ad-Egr2 or siEgr2 transfected SMMC7721 cells. (B) Proliferations of SMMC7721 transfected with Ad-Egr2 or siEgr2 were testified by MTS. (C) Proliferations of SMMC7721 transfected with Ad-Egr2 or siEgr2 were examined by colony formation assay. *P<0.05, **P<0.01.

AF113014 up-regulated Egr2 expression by interacting with miR-20a

As a target gene of AF113014, how Egr2 was regulated by AF113014? Many studies showed that lncRNAs and microRNAs could constitute regulatory networks [Bioessays. 2016 ">37-41]. To better understand the mechanism, we carried out several experiments to identify whether AF113014 could interact with some miRNAs which regulated Egr2. First of all, we screened a series of candidate miRNAs that can interact with the 3′-untranslated regions (3′-UTRs) of Egr2. miR-20a [42, 43], miR-150, miR-137, miR-224, miR-337 were identified (S3 Fig). Interestingly, we found that there was base complementary relationship between AF113014, miRNA-20a and Egr2-3 'UTR (Fig 6A). qRT-PCR results showed that AF113014 overexpression could result in a significant down-regulation of miRNA-20a while knockdown of AF113014 increased miRNA-20a expression (Fig 6B). Moreover, the relationship of lncRNA-AF113014, miRNA-20a and Egr2 was analyzed by usingdual-luciferase reporter assay. Results showed that the luciferase activity of Egr2-3 'UTR was lower in cells expressing miR-20a comparison with its control. However, this inhibition could be partially rescued when AF113014 was overexpressed (Fig 6C). Although, the expressions of Egr2 could be downregualted by miR-20a, AF113014 could recover the inhibition of miR-20a, and increased the expressions of Egr2 in presence of miR-20a (Fig 6D and 6E). Furthermore, to explore the roles of Egr2 and miRNA-20a in the effect of AF113014 upon the cell growth, RNAi suppression of Egr2 and overexpression of miR-20a in cells transduced with AF113014 werevcarried out. As a result, AF113014 enhanced Egr2 functions in inhibition of cell growth and colony formation (Fig 7A and 7B). The expression linking of miR-20a/LncRNA-AF113014/Egr2 was checked in six human HCC tissue samples compared with adjacent non-cancerous tissues (Fig 8). These results suggested that AF113014 up-regulated Egr2 expression through interacting with miR-20a.

Fig 6

AF113014 up-regulated Egr2 expression by interacting with miR-20a.

(A) Software predicted the binding sites between AF113014, miRNA-20a and Egr2-3'UTR. (B) Relative expressions of miRNA-20a in Ad-AF113014 or siAF113014 transfected SMMC7721 cells. U6 RNA was used as control. (C) Luciferase activity assay was performed to determine the relationship between AF113014, miRNA-20a and Egr2 in SMMC7721 cells.* P < 0.05, ** P<0.01. (D) qRT-PCR were performed to analyze the expressions of Egr2 after co-transfected with Ad-AF113014 and miRNA-20a, Ad-AF113014 and miRNA-20a-in, siAF113014 and miRNA-20a, siAF113014 and miRNA-20a-in, respectively. Ad-GFP+NC was used as control. (E) Western blot were performed to analyze the expressions of Egr2 after co-transfected with Ad-AF113014 and miRNA-20a, Ad-AF113014 and miRNA-20a-in, siAF113014 and miRNA-20a, siAF113014 and miRNA-20a-in, respectively. Ad-GFP+NC was used as control.

Fig 7

Proliferation founctions of AF113014 effected on miR-20a and Egr2 in HCC cells.

(A) Proliferations of SMMC7721 cells were examined by MTS after co-transfected with Ad-AF113014, miR-20a, miR-20a-in, Ad-Egr2, si-Egr2 in groups. (B) Proliferations of SMMC7721 cells were examined by colony formation assay after co-transfected with Ad-AF113014, miR-20a, miR-20a-in, Ad-Egr2, si-Egr2 in groups. (C) Numeralization of (B).

Fig 8

The expression of miR-20a/LncRNA-AF113014/Egr2 in HCC.

The expressions of Egr2, LncRNA-AF113014 and miR-20a in HCC tissues were analyzed with qPCR.

AF113014 influences tumor growth in vivo

We next determined whether AF113014 could inhibit tumor growth in vivo. SMMC7721 cells infected with Ad-AF113014 or Ad-GFP were subcutaneously injected in the hip back of nude mice respectively. We found that AF113014 could markedly inhibited tumor growth, compared with the control group (Fig 9A). The expressions of Ki-67 and Egr2 were measured in tumor tissues via immunohistochemistry. Increased Egr2 expression and decreased Ki-67 expression were observed in the Ad-AF113014 group, compared with control (Fig 9B). Meanwhile, proteins in tumor tissues were extracted and analyzed by western blot. Our results showed that Egr2 expressions in tumor tissues derived from Ad-AF113014 group was higher than that from Ad-GFP group (Fig 9C). Taken together, we concluded that AF113014 could inhibit tumor growth and promote Egr2 expression in vivo.

Fig 9

AF113014 influenced tumor growth in vivo.

(A) Representative tumors formed in Ad-GFP and Ad-AF113014 infected SMMC7721 cells, and the tumor growth curve of each group. * P < 0.05, ** P < 0.01. (B) Transplanted tumors sections were stained with Egr2 and Ki-67. (C) Western blot analysis of Egr2 expression in transplanted tumors. GAPDH was used as control.

Discussion

HCC is a heterogeneous type of tumor with high malignancy and poor prognosis. The changes of carcinogenic-related genes may play crucial roles in the status of HCC proliferation, metastasis and invasive ability [44]. Recent studies have indicated that the dysregulation of lncRNAs, such as H19, DBH-AS1, HOTTIP, ATB, HULC, is involved in HCC pathogenesis. A growing body of literature show that the aberrant expressions of lncRNA could contribute to cancer biology [45-49]. Therefore, study on lncRNA can help us with better correct diagnosis and effective treatment of tumors.

Numerous lncRNAs have been discovered by gene chip or next-generation sequencing methods due to the rapid development of high-throughput DNA technology over the years. In this study, we have identified a novel lncRNA AF113014 through microarray, which is aberrantly expressed in human HCC cell lines, compared to normal hepatocytes. Applying gain-of-function and loss-of-function experiments, we identified that overexpressing AF113014 could inhibit proliferation of HCC cells in vitro, while the opposite effect was observed when knockdown of AF113014. These results suggest that AF113014 might act as a tumor suppressor in HCC cells. Related studies have shown that lncRNA has been reported to influence the expression of adjacent genes on chromosome to exhibit its biological function. Mechanistic study further found that Egr2 was a downstream target of AF113014. Over-expression of AF113014 promoted Egr2 expression while knockdown of AF113014 decreased the expression of Egr2 both in mRNA and protein levels.

Egr2, a transcription factor with zinc-finger structure, is a member of EGR family. The EGR family can encode immediate-early transcription factors and is composed of four members: EGR1, EGR2, EGR3 and EGR4. EGR family members have been reported to take part in apoptosis regulation. For example, EGR1 has both pro-apoptotic and pro-survival functions depending on the cell lineage [50-52]. EGR2, as a target of the p53 family, could directly affect the apoptotic pathway mediated by p53 family [53]. Plenty of document information included findings that endogenous EGR2 was significantly low expression in various cancer cell lines and primary cancers [54-57]. Egr2 can be induced by a variety of extracellular signal molecules, such as cytokines and kinase, and combine with gene promoters and affect the expression of the downstream genes [58-60]. Evidence showed that dysregulation of Egr2 was found in chronic lymphocytic leukemia and miRNA-150 promoted the proliferation of gastric cancer through negative regulating Egr2 [61, 62]. However, the function of Egr2 in HCC progression was not reported at present. In our study, Egr2 was down-expressed in HCC cell lines and tissues. Besides, over-expression of Egr2 suppressed proliferation of HCC cells both in vitro and in vivo.

The functional mechanisms of lncRNAs have the following aspects: transcriptional interference, inducing chromatin remodeling and histone modifications, hybridization of sense and antisense RNAs, binding specific protein and being small RNA precursor, etc [63]. It has been proved that lncRNAs and microRNAs could form regulatory networks in order to play their regulatory role by various studies [64-68]. To explore the underlying mechanism of AF113014-induced proliferation inhibition, we hypothesized AF113014 interacted with a certain microRNA which resulting in Egr2 expression changes in HCC. In this study, we found miR-20a could combine with Egr2-3 'UTR region and there was also a complementary base pairing relationship between AF113014 and miR20a. Dual-luciferase reporter assay showed that Egr2 was a target gene of miR-20a and AF113014 could weaken the inhibition of miR-20a to Egr2. These results suggested that AF113014 could regulate the expression of Egr2 by interaction with miR-20a.

In summary, our study revealed the functions and mechanism of AF113014, miR-20a and Egr2 in HCC. These data might provide new research ideas for HCC treatment and prognosis.

Vector construction and transfection.

The infection efficiency of Ad-GFP, Ad-AF113014 and Ad-Egr2 were observed under a fluorescence microscope.

(TIF)

Click here for additional data file.

The expressions of NRBF2 protein were analyzed with Western blot.

(TIF)

Click here for additional data file.

Website forecasted the miRNAs which can bind with Egr2-3'UTR.

(TIF)

Click here for additional data file.