Literature DB >> 28508570

A new transcript in the TCRB locus unveils the human ortholog of the mouse pre-Dß1 promoter.

Bernard Lethé1,2, Sylvia Snauwaert3, Orian Bricard2, David Schröder2, Tiphanie Gomard2, Gérald Hames2, Catherine Muller2, Christophe Lurquin1,2, Emilie Gauthy2, Ahmed Essaghir2, Bart Vandekerckhove3, Pierre G Coulie2.   

Abstract

INTRODUCTION: While most transcripts arising from the human T Cell Receptor locus reflect fully rearranged genes, several germline transcripts have been identified. We describe a new germline transcript arising from the human TCRB locus.
METHODS: cDNA sequencing, promoter, and gene expression analyses were used to characterize the new transcript.
RESULTS: The new germline transcript encoded by the human TCRB locus consists of a new exon of 103 bp, which we named TRBX1 (X1), spliced with the first exon of gene segments Cß1 or Cß2. X1 is located upstream of gene segment Dß1 and is therefore deleted from a V-DJ rearranged TCRB locus. The X1-Cß transcripts do not appear to code for a protein. We define their transcription start and minimal promoter. These transcripts are found in populations of mature T lymphocytes from blood or tissues and in T cell clones with a monoallelic TCRB rearrangement. In immature thymocytes, they are already detectable in CD1a- CD34+ CD4- CD8- cells, therefore before completion of the TCRB rearrangements.
CONCLUSIONS: The X1 promoter appears to be the ortholog of the mouse pre-Dß1 promoter (PDß1). Like PDß1, its activation is regulated by Eß in T cells and might facilitate the TCRB rearrangement process by contributing to the accessibility of the Dß1 locus.
© 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

Entities:  

Keywords:  Allelic inclusion; PDß1 germline transcripts; T cells; TCRB transcripts; human TCRB locus; locus accessibility; thymocytes

Mesh:

Substances:

Year:  2017        PMID: 28508570      PMCID: PMC5569374          DOI: 10.1002/iid3.172

Source DB:  PubMed          Journal:  Immun Inflamm Dis        ISSN: 2050-4527


Introduction

T cell receptor (TCR) gene rearrangements are complex multistep processes occurring at different stages of thymocyte maturation. They involve double‐strand DNA breaks at the recombination signal sequences that border the V(D)J gene segments and that are recognized by the RAG1/RAG2 recombinases 1. The process is tightly controlled, with the TCRB locus being rearranged before TCRA. For TCRB it occurs in two steps. First, at the CD4−CD8− double negative stage a Dß gene segment recombines with a Jß segment yielding a Dß.Jß partially rearranged genomic DNA. These early rearrangements occur at the CD1+CD34+ stage. In a second step, ending before the CD4+CD8+ double positive (DP) stage, a Vß gene segment recombines with Dß.Jß 2. If this rearrangement leads to the production of a complete TCRB chain, the latter dimerizes with the pre‐TCRA chain and initiates ß‐selection. During ß‐selection, the pre‐TCR signaling suppresses RAG1/2 expression, induces several rounds of division and differentiation toward CD4+CD8+ DP thymocytes. At the DP stage, reexpression of RAG1/2 enables TCRA rearrangements to produce TCR‐positive DP cells 3. Our previous work on T lymphocytes infiltrating human melanoma tumors led us to construct TCRB cDNA libraries 4. Starting from tumoral RNA, we first used a SMART‐PCR on cDNA extended from a Cß primer, and cloned the amplified products. Sequencing these products provided information on frequencies of tumor‐specific cytolytic T cell clones present in the tumor 4. A significant proportion of the sequences corresponded to a new TCRB germline transcript that we describe here.

Materials and Methods

Construction of TCRB‐targeted cDNA libraries

These libraries 4 were built up from RNA reverse‐transcribed with an antisense Cß primer [nt 63–47 of exon 1] in the presence of SMART II (Clontech®, Mountain View, CA, USA) 5, an oligonucleotide engineered to be copied at the 3′‐end of the growing cDNA during reversion, ought to an intrinsic Terminal deoxynucleotidyl Transferase (TdT) activity of the RT. A RNaseH− RT‐enzyme in an appropriate buffer is needed for this 3′‐extension of the cDNA. With a primer consisting in the core of the SMART primer (5′‐gcagtggtaacaacgcagagta) and a Cß primer (primer 2 of Table 1) located near the 5′ end of Cß, the cDNA was amplified by PCR for a limited number of cycles with an annealing step at 60°C. Products shorter than 150 bp were removed by a Sepharose CL‐6B size‐exclusion column (Pharmacia‐Amersham). Under these conditions, the products derived from full length TCRB (TRB‐LVDJC) transcripts are in the range of 480 bp with 33 nucleotides coming from the primed region of Cß. Using a small fraction of the extracted RNA, in order to obtain the “smarted” cDNA from 0.5–1% of the TCRB transcripts, allows to estimate the frequency of the most prevalent clonotypes present in that sample, assuming a copy number of 200 productive TRB‐LVDJC transcripts/T cell. The method also allows to readily define the 5′‐ends of the TCRB transcripts, as an alternate 5′‐RACE approach, since many of the isolated clones represent full length cDNA.
Table 1

Primers used for X1‐Cß transcripts quantification

SequenceTargetPosition
5′‐GCTCAAAACATCCTGAGGACA (#1 in Fig. 2A) X1 sense73–93 a
5′‐CGACCTCGGGTGGG (#2 in Fig. 2A) Cß antisense33–16 b
5′‐TGCTCCTTGAGGGGCTGCG (#3 in Fig. 2A) Cß antisense196–178 b
5′‐FAM‐TTCAGGTCCTCTCCAGGCACTG‐TAMRA (P in Fig. 2A) X1Cß probe, antisensestraddling X1 and Cß
5′‐ATTGCCGACAGGATGCAGAA ACTB sense998–1017 c
5′‐GCTGGAAGGTGGACAGCGA ACTB antisense1133–1115 c
5′‐TGCTCCTTGAGGGGCTGCG ACTB probe1053–1078 c
5′‐GGAGGCTATCCAGCGTACT B2M sense114–132 c
5′‐GACCAGTCCTTGCTGAAAGACA B2M antisense302–281 c
5′‐CGGATGGATGAAACCCAGACACATAGC B2M probe220–194 c
5′‐GCTTCACTGCTCAGGTGAT EEF1A1 sense1079–1097 c
5′‐GCCGTGTGGCAATCCAAT EEF1A1 antisense1160–1143 c
5′‐AAATAAGCGCCGGCTATGCCCCTG EEF1A1 probe1118–1141 c
5′‐GGTGTGAACCATGAGAAGTATGA GAPDH sense502–524 c
5′‐GATGGCATGGACTGTGGTCA GAPDH antisense645–626 c
5′‐CCTCAAGATCATCAGCAATGCCTCCTG GAPDH probe531–557 c

To exclude genomic signals, in each amplicon either one primer or the probe straddles two exons. Double dye probes obtained from Eurogentec (Liège, Belgium) are 6‐FAM marked in 5′ and quenched in 3′ with TAMRA. All qPCR amplifications were performed on the same dT‐primed cDNA templates with sense primers located at similar distances from the poly‐A tail (785, 796, 874, 669, and 809 nt for X1‐Cß, ACTB, B2M, EEF1A1, and GAPDH, respectively).

Positions are relative to the TSS of exon X1.

Positions given from the 5′‐end of exon 1 of Cß1 and Cß2

Positions given according to the reference mRNAs: NM_001101.2 for ACTB; NM_004048 for B2M; NM_001402 for EEF1A1; NM_002046.3 for GAPDH.

Primers used for X1‐Cß transcripts quantification To exclude genomic signals, in each amplicon either one primer or the probe straddles two exons. Double dye probes obtained from Eurogentec (Liège, Belgium) are 6‐FAM marked in 5′ and quenched in 3′ with TAMRA. All qPCR amplifications were performed on the same dT‐primed cDNA templates with sense primers located at similar distances from the poly‐A tail (785, 796, 874, 669, and 809 nt for X1‐Cß, ACTB, B2M, EEF1A1, and GAPDH, respectively). Positions are relative to the TSS of exon X1. Positions given from the 5′‐end of exon 1 of Cß1 and Cß2 Positions given according to the reference mRNAs: NM_001101.2 for ACTB; NM_004048 for B2M; NM_001402 for EEF1A1; NM_002046.3 for GAPDH.

Detection of X1‐Cß transcripts by RT‐PCR

For the detection of X1‐Cß transcripts in T cell clones, Epstein‐Barr virus‐transformed B cell lines, tumor lines or fresh PBMC, RNA was extracted without DNAse pretreatment, by the TRIPure method (Roche®) and cDNA was readily obtained by reverse‐transcription of 1 μg of total RNA for 1 h at 42°C with 100 UI SmartScribe® RT of Clontech, the SMART II primer (1 μM) and an anchored‐dT21 primer (2.5 μM) in a volume of 10 μl. After an inactivation step at 70°C for 15 min, the cDNAs were diluted with water to 50 μl and stored at −20°C. PCR products of 227 bp were obtained from 2.5 μl of cDNA (derived from 50 ng RNA or 2500–10,000 cells) with primers 1 (X1 sense), and 3 (Cß antisense, Fig. 2A and C and Table 1) and 0.625 UI of conventional Taq DNA polymerase (Takara) in a final volume of 25 μl, with 35 cycles (annealing at 60°C). These products were analyzed by gel electrophoresis and sequenced. To quantify the expression levels of X1‐Cß, amplified products of 64 bp were obtained from the same amounts of cDNA with primers 1 and 2 (Table 1 and Fig. 2A), Hot Start Taq DNA Polymerase (Eurogentec, Liège, Belgium), annealing and extension at 62°C on a StepOnePlus thermocycler (ABI), and quantified with a FAM‐TAMRA Double Dye probe (Eurogentec) straddling X1 and Cß exon 1. Expression levels were normalized with ACTB and expressed as X1‐Cß/ACTB ratios obtained from ΔCq at identical thresholds, with verified amplification yields of 95% for both qPCR. We compared the levels of expression of the housekeeping genes ACTB, GAPDH, EEF1A1, and B2M in our samples 6 with the probe and primers indicated in Table 1, and observed the best correlations between the numbers of cells and ACTB expression levels.
Figure 2

Expression of X1‐Cß. (A) Schematic representation of the primers used in quantitative (B) and conventional (C) X1‐Cß RT‐PCR assays. Arrows and bar indicate primers and probe listed in Table 1. (B) Levels of X1‐Cß expression were measured by RT‐qPCR using primers 1, 2, and probe P on cDNA obtained from T cell clones, freshly isolated T cells, Phytohemagglutinin‐A stimulated blood lymphocytes, acute T cell leukemias, Epstein‐Barr virus‐transformed B cells, fibroblasts, and CD34+ cord blood cells, tumor lines (7 melanomas and 1 sarcoma) and thymocytes at various maturation stages: CD4+CD8+ double positive (DP), immature CD4+ single positive (iSP4), CD4−CD8− double negative (DN) CD1a+ or CD1a−. Results are presented as X1‐Cß/ ACTB ratios calculated as indicated in Materials and Methods. (C) Gel analysis of amplified products obtained with a conventional PCR using primers 1 and 3 on cDNA obtained from 5 T cell clones. RNA integrity was assessed by amplifying GAPDH and ACTB cDNAs in a parallel duplex PCR for 22 cycles. Lane 6 is a 1 kb ladder (Invitrogen).

X1 promoter cloning

Gene segments of 1125, 943, 242, 95, and 48 bp located upstream of the major Transcription Start Site (TSS) of exon X1 were obtained by PCR and cloned in Firefly luciferase vector pGL4.15 (Promega, Fitchburg, WI, USA), using Q5 (New England Biolabs) or the high fidelity DNA polymerase Pfu (Stratagene, La Jolla, CA, USA) mixed with Takara Taq. In the same experiments, we used a 187 bp sequence upstream of the TRBV7.2 TSS, as a control promoter. In addition, a 400 bp fragment of the Enhancer ß (Eß) comprising the Eß‐core 7 was cloned in the unique BamH I site of pGL4.15 vectors containing the 943 bp fragment of the X1 promoter or the 187 bp‐long Vß7.2 promoter. The constructs were co‐transfected in triplicates in either HEK293T or Jurkat E6.1 cells with pGL4.75, a plasmid expressing the Renilla luciferase driven by a CMV promoter, as a transfection efficiency control. We used Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and TransIT®Jurkat (Mirus Bio LLC) to transfect HEK293T and Jurkat cells, respectively. Luciferase activities were measured after 24–40 h using the Dual‐Glo® Luciferase Assay System (Promega) and a Glomax Discover plate reader (Promega). The Firefly luciferase activity was normalized to that of the Renilla luciferase and the results compared to those obtained with a promoterless vector, providing the ratios shown in Figure 3A.
Figure 3

Characterization of the X1 promoter region. (A) Genomic DNA fragments of indicated sizes, immediately preceding the TSS of exon X1, were cloned in front of the Firefly luciferase gene in vector pGL4.15, with or without Eß as indicated. The constructs were co‐transfected in HEK293T cells or Jurkat cells with vector pGL4.75 containing the Renilla luciferase sequence. Control constructs included pGL4.15 without promoter, with a X1 promoter sequence cloned antisense (as) and with a Vß7.2 promoter sequence. One day after transfection, both luciferase activities were measured. The results, means of 2–9 independent assays, are expressed relatively to those obtained with the pGL4.15 promoterless construct. Sequence of the 1125 bp promoter fragment: ENA LT601551. (B) Sequence homologies between the human and murine pre‐Dß1 regions. Promoter and transcribed sequences are shown as closed and open boxes, respectively. The PDB1 sequence proposed here is shorter at its 3′‐end than in the original description by Sikes 12, taking into account the longest germline transcripts reported by Doty 13 or present in Genbank (EST CB598216, and BB587363). The indicated DNase I hypersensitivity region straddling the TSS of X1 is described for human T cells by the ENCODE project.

Isolation of human thymocytes

Postnatal thymuses were obtained from 0‐ to 12‐year‐old children that underwent cardiac surgery. Cord blood was obtained from the Navelstrengbloedbank UZ Gent. All human material was used following guidelines of the Medical Ethical Committee of the Ghent University Hospital (Belgium). Informed consent was obtained in accordance with the Declaration of Helsinki. A thymocyte suspension was made within 24 h after surgery. Cord blood mononuclear cells were obtained after density centrifugation. CD34+ cells were enriched by anti‐CD34 magnetic activated cell sorting (MACS Miltenyi Biotec) to a purity of >90% and subsequently labeled and sorted in CD34+CD1−CD3−CD45+ and CD34+CD1+CD3−CD45+. CD4iSP (CD1+CD45+CD4+CD3−CD8−) and DP (CD3+ CD4+CD8+) cells were sorted without pre‐enrichment procedures. Anti‐CD45, −CD34, −CD1, −CD3, −CD4, and −CD8a antibodies used for sorting were obtained from Miltenyi Biotech. The cells were sorted on a FACSAria II to a purity of >99%. RNA and cDNA were obtained as described above.

Sequence analyses

To identify potential target sites of transcription factors within the X1 promoter, we used the JASPAR databank 2016, with a 0.85 threshold score (http://jaspar.genereg.net/cgi-bin/jaspar_db.pl?rm=browse&db=core&tax_group=vertebrates). DNase I Hypersensitive sites were predicted with the ENCODE project at http://www.genome.ucsc.edu/.

Results

A new germline TCRB transcript contains a previously undescribed exon

Starting from RNA extracted from eight melanomas that were infiltrated by T lymphocytes, we produced eight TCRB cDNA libraries using a TCR‐Cß reverse primer and the SMART oligonucleotide (Clontech). We sequenced about 1900 cDNA clones from these libraries. About 75% of the sequences corresponded to TCRB sequences: ±65% were in‐frame rearranged TCRB sequences with a median length of 420 bp, ±15% were J‐C sequences apparently initiated in front of Jß2.3 (ENA LT626065) and other Jß gene segments, ±10% were very short J‐C products, and 5–10% were sequences of ±140 nucleotides, containing a Cß1 (60%) or Cß2 (40%) sequence preceded by 103 nucleotides not reported to be present in TCRB transcripts. In the human TCRB locus, this 103 bp sequence ends 174 nucleotides upstream of the Dß1 gene segment. It is preceded by a potential TATA box and followed by a predicted 8 donor site of splicing (Fig. 1). These results suggested that this 103 nt sequence was the first exon, which we named TRBX1 (X1), of a new germline TCRB transcript that contained X1 and Cß sequences.
Figure 1

Exon X1 within the human TCRB locus. Representation of the 3′ end of the unrearranged TCRB locus with the location of exon X1. The structure of the two most abundant germline X1‐Cß transcripts is indicated. The complete sequence of X1 (103 bp) is boxed. A TATA box and a donor site of splicing (DS) are indicated. Primer 1 in X1 was used in PCR amplifications. Sequences are accessible at European Nucleotide Archive: Exon X1 (LT601549) and X1‐Cß1 transcript (LT601550).

Exon X1 within the human TCRB locus. Representation of the 3′ end of the unrearranged TCRB locus with the location of exon X1. The structure of the two most abundant germline X1‐Cß transcripts is indicated. The complete sequence of X1 (103 bp) is boxed. A TATA box and a donor site of splicing (DS) are indicated. Primer 1 in X1 was used in PCR amplifications. Sequences are accessible at European Nucleotide Archive: Exon X1 (LT601549) and X1‐Cß1 transcript (LT601550). To identify the 3′ end of these X1‐containing transcripts, RNA was extracted from 3 T cell clones and reverse‐transcribed with an anchored oligo‐dT primer. The resulting cDNA was used as a template for a PCR amplification with the anchor and primer 1 in exon X1 (Fig. 1) and the amplified products were sequenced. The sequences were about 860 bp long and corresponded to X1 spliced either with the first exon of Cß1 followed by Cß1 exons 2–4, or with the first exon of Cß2 followed by Cß2 exons 2–4. All sequences had a 3′ polyA tail. The structure of the X1‐Cß transcripts is shown in Figure 1. X1‐Cß gene products can only be transcribed from TCRB loci that have not undergone a V‐DJ rearrangement, as the latter deletes X1 (Fig. 1). We surmised that X1‐Cß1 transcripts originated from TCRB loci either in germline configuration or with Dß1‐Jß1 rearrangements. Indeed, the first good acceptor site of splicing downstream of X1 is that of Cß1 exon 1. In case of Dß1‐Jß2 rearrangements, Cß1 is deleted and the next good acceptor site is that of Cß2 exon 1. We confirmed this hypothesis by establishing the TCRB genomic structure and Cß usage of the X1‐Cß transcripts on a set of 12 T cell clones with a single V‐DJ rearrangement. As expected, no X1‐Cß transcripts were detected in the three clones with two V‐DJ rearrangements (data not shown). Exon X1 contains no ATG initiation codon and is therefore not expected to be translated. Translation of a protein from the Cß segment of X1‐Cß appears unlikely. The largest ORF is 141 nt long and ends 53 nt upstream of the exon 3/exon 4 junction. It is preceded by very short ORFs, a feature that disfavors its translation. In addition, translation ending in the second last exon at a distance greater than 50–55 nt from the last exon‐exon junction complex precludes the ribosome from removing the complex which then recruits RNAses and ubiquitin 9. We provisionally conclude that the X1‐Cß transcripts are sterile. We conclude to the presence in human T lymphocytes of previously undescribed TCRB mRNAs that contain ±860 nt and consist of a new exon, X1, followed by Cß1 or Cß2 exons.

Expression of X1‐Cß transcripts

We screened various cell types using a RT‐qPCR amplification with primers 1 and 2 located in X1 and Cß, respectively, and a probe straddling the X1‐Cß junction (Fig. 2A and Table 1). From a set of 44 T cell clones previously established in our laboratory, only 24 (55%) expressed X1‐Cß transcripts (Fig. 2B). This proportion was expected: X1 is lost during the V‐DJ recombination process and X1‐Cß transcripts are therefore absent from T cells that have undergone bi‐allelic TCRB rearrangements. In murine lymph node‐derived T cells, the proportion of cells with a single rearranged TCRB locus was estimated at 57% 10. X1‐Cß transcripts could also be detected in about 50% of T cell clones using a conventional RT‐PCR yielding a larger amplicon whose sequence could be verified (Fig. 2C). In cultured T cell clones, we estimated the levels of expression of X1‐Cß and complete TCRB transcripts at 2–10 and 100–300 mRNA molecules per cell, respectively 11 and data not shown). Thus in mature T cells the number of X1‐Cß transcripts is considerably lower than that of the TCRB‐encoding mRNAs. Expression of X1‐Cß. (A) Schematic representation of the primers used in quantitative (B) and conventional (C) X1‐Cß RT‐PCR assays. Arrows and bar indicate primers and probe listed in Table 1. (B) Levels of X1‐Cß expression were measured by RT‐qPCR using primers 1, 2, and probe P on cDNA obtained from T cell clones, freshly isolated T cells, Phytohemagglutinin‐A stimulated blood lymphocytes, acute T cell leukemias, Epstein‐Barr virus‐transformed B cells, fibroblasts, and CD34+ cord blood cells, tumor lines (7 melanomas and 1 sarcoma) and thymocytes at various maturation stages: CD4+CD8+ double positive (DP), immature CD4+ single positive (iSP4), CD4−CD8− double negative (DN) CD1a+ or CD1a−. Results are presented as X1‐Cß/ ACTB ratios calculated as indicated in Materials and Methods. (C) Gel analysis of amplified products obtained with a conventional PCR using primers 1 and 3 on cDNA obtained from 5 T cell clones. RNA integrity was assessed by amplifying GAPDH and ACTB cDNAs in a parallel duplex PCR for 22 cycles. Lane 6 is a 1 kb ladder (Invitrogen). We detected X1‐Cß expression in freshly isolated blood CD4 or CD8 T cells, in Phytohemagglutinin‐A activated blood T cells and in leukemic T cells including Jurkat E6.1. No expression was detected in non‐T cells such as fibroblasts, keratinocytes, monocytes, CD34+ cord blood cells, Epstein‐Barr virus‐transformed B cells and 35 tumor lines from various non‐T histological types (Fig. 2B and data not shown). In sorted sub‐populations of thymocytes, X1‐Cß expression increased concurrent with ß‐selection: expression was low in pre‐ß selection CD34+CD1a− and CD34+CD1a+ double negative (DN) cells (Fig. 2B) and 10‐times higher in post‐ß selection CD3−CD4+ (immature single positive cells: iSP4) and CD3+CD4+CD8+ DP populations (Fig. 2B). We conclude that X1‐Cß transcripts are T cell‐specific and appear when TCRB gene rearrangements are initiated. They are absent from T cells with biallelic V‐DJ rearrangements.

A promoter sequence in front of X1

To examine the regulatory elements governing X1 transcription, we cloned the genomic DNA immediately upstream of X1 in a luciferase‐encoding vector and transfected the construct into HEK293T cells. We compared the promoter activities of five sequences of decreasing sizes (Fig. 3A). The highest promoter activities were observed for the two largest fragments, of 1125 and 943 bp, with similar inductions of 23‐ and 21‐fold versus that of the promoterless construct. These inductions were approximately sixfold lower than that observed with a Vß7.2 promoter (Fig. 3A). An antisense construct of 943 bp had no activity (Fig. 3A). The shortest X1 promoter fragment with a detectable activity was 95 bp long (7.5‐fold induction). Characterization of the X1 promoter region. (A) Genomic DNA fragments of indicated sizes, immediately preceding the TSS of exon X1, were cloned in front of the Firefly luciferase gene in vector pGL4.15, with or without Eß as indicated. The constructs were co‐transfected in HEK293T cells or Jurkat cells with vector pGL4.75 containing the Renilla luciferase sequence. Control constructs included pGL4.15 without promoter, with a X1 promoter sequence cloned antisense (as) and with a Vß7.2 promoter sequence. One day after transfection, both luciferase activities were measured. The results, means of 2–9 independent assays, are expressed relatively to those obtained with the pGL4.15 promoterless construct. Sequence of the 1125 bp promoter fragment: ENA LT601551. (B) Sequence homologies between the human and murine pre‐Dß1 regions. Promoter and transcribed sequences are shown as closed and open boxes, respectively. The PDB1 sequence proposed here is shorter at its 3′‐end than in the original description by Sikes 12, taking into account the longest germline transcripts reported by Doty 13 or present in Genbank (EST CB598216, and BB587363). The indicated DNase I hypersensitivity region straddling the TSS of X1 is described for human T cells by the ENCODE project. We also transfected several of these constructs in the leukemic T cell clone Jurkat E6.1, with or without the 393 bp core sequence of the TCRB gene enhancer (Eß) which was shown to enhance the transcription of several TRBV genes 7. Transfection of the 943 bp long X1 promoter with Eß stimulated transcription (Fig. 3A). However, in the absence of Eß the stimulation of transcription was minimal, which was expected considering the role of Eß for TCRB transcription in T cells. We conclude that a promoter sequence is present immediately upstream to the X1 sequence. In line with this conclusion, a DNAse I hypersensitivity region straddling the TSS of X1 is observed almost exclusively in T cells, according to the ENCODE project (Fig. 3B and Materials and Methods). Moreover, in T cells the X1 promoter is controlled by Eß. The sequence of the X1 promoter followed by X1 appears to be the human ortholog of the murine Dß1 Promoter (PDß1), a 377 bp sequence located immediately upstream of the TRBD1 gene segment 12 (Fig. 3B). Actually, this 377 bp sequence appears to consist in a promoter followed by the first 200 nt of germline transcripts controlled by this promoter. Indeed, reported transcripts contain the PDß1 last 200 nt sequence followed by Dß1 usually rearranged with a Jß spliced to a Cß segment 13 (and murine EST database). The homology between the human and murine DNA sequences upstream of Dß1 is above 70% immediately 5′ to Dß1, remains at 60% for X1, and the last 135 bp of its promoter, then drops sharply to 40% for upstream sequences (Fig. 3B). Sp1 and GATA3 have been shown to contribute to PDß1 activity 12 and binding sites for these transcription factors are present also in the X1 promoter. Seven GATA3 sites are present upstream of the human and murine Dß1 sequences (Fig. 4). While a single and important Sp1 site is present in the mouse, three sites are present in the X1 promoter (Fig. 4). Interestingly, 16 nucleotides positioned 91–77 nt upstream to the TSS of X1 are perfectly conserved between human and murine sequences. They are contained in the 377 bp core PDß1 promoter reported by Sikes 12. They contain no GATA3 or Sp1 site, but a consensus AP‐1 site indicated with arrows on Figure 4. This AP‐1 site might participate together with an Sp1 site in the promoter activity present between nucleotides −48 and −95 of the human X1 promoter (Fig. 3A).
Figure 4

Transcription factor binding sites upstream of human and murine Dß1. Human and murine genomic DNA regions upstream of Dß1 are shown with predicted positions of transcription factors GATA3, SP1, and AP‐1 (scores ≥0.85 in the JASPAR data bank of target sequences for transcription factors of vertebrates, 2016). Arrow heads indicate reported starts of transcription. Vertical lines show the 5′‐ends of the X1 promoter fragments analyzed in Figure 3A. Small arrows indicate an AP‐1 site present within a 16 nt stretch that is perfectly conserved between the human and murine sequences.

Transcription factor binding sites upstream of human and murine Dß1. Human and murine genomic DNA regions upstream of Dß1 are shown with predicted positions of transcription factors GATA3, SP1, and AP‐1 (scores ≥0.85 in the JASPAR data bank of target sequences for transcription factors of vertebrates, 2016). Arrow heads indicate reported starts of transcription. Vertical lines show the 5′‐ends of the X1 promoter fragments analyzed in Figure 3A. Small arrows indicate an AP‐1 site present within a 16 nt stretch that is perfectly conserved between the human and murine sequences.

Discussion

In the mouse, several germline transcripts have been described that originate from the IG and TCR loci 14, 15, 16. They are usually expressed, when the gene segments from which they are derived are poised to rearrange 17. IG and TCR germline transcriptions have been considered as facilitating gene segment rearrangements by contributing to the accessibility of the loci to the recombinase complex 18, as deeply reviewed by Oltz and colleagues 19, 20. For the TCRB locus, the best‐studied germline transcription occurs upstream of the murine Dß1 gene segment and is controlled by a promoter named PDß1 12. The accessibility of Jß1, Dß2‐Jß2, and the proximal Vß gene segments is controlled by the enhancer Eß 14, but both Eß and PDß1 are required for Dß1‐Jß rearrangements to occur 21. Deletion of PDß1 or its displacement downstream toward Jß1 was shown to prevent Dß1‐Jß recombinations 21, 22. However, Dß1‐Jß recombinations persisted after PDß1 inversion, indicating that it is not the germline transcription through the Jß segments that is important for Dß1‐Jß recombination 22. Finally, mutations of GATA3 or Sp1 binding sites within PDß1 strongly impaired Dß1 recombinations 12, 13. Thus, like Eß, PDß1 is an accessibility control element (ACE), even though it controls a much shorter genomic interval than Eß does. The accepted model is that the interaction of PDß1 with Eß leads to the recruitment of additional factors that ultimately favor recombination by locally reorganizing the chromatin structure. One of these factors is a component of the SWI/SNF complex, which is required in murine thymocytes to open the Dß1 region prior to recombination 23. Very little is known about IG and TCR germline transcription in human cells 24, 25. We describe a new germline transcript from the human TCRB locus, with a new exon, X1, located upstream of Dß1 and spliced with the first exon of Cß1 or Cß2. X1‐Cß transcription is controlled by a promoter that appears to be the ortholog of PDß1, for two reasons. First, both are localized in front of germline transcripts initiated in the pre‐Dß1 region. Indeed in the mouse, the PDß1 sequences described by Sikes 12 and Whitehurst 21 contain more than a promoter, as their 3′ halves can be transcribed 13 (and Genbank EST database). Accordingly the core promoter in PDß1 is less than 200 bp long and starts 377 bp upstream of Dß1 (Fig. 3B). In the human TCRB locus, the shortest tested sequence with X1‐promoter activity is 95 bp long and starts 371 bp upstream of Dß1. Second, the 410 nucleotides upstream of murine and human Dß1 are homologous. The homology is maximal (77%) next to Dß1, is maintained at about 60% until the 5′ end of the core promoters, then drops sharply to 40% (Fig. 3B). In line with their role of ACEs, the murine PDß1 and the human X1 promoter are activated at the earliest stages of thymocyte maturation, that is prior to Dß rearrangements. Indeed, PDß1‐controlled transcripts have been detected in thymocytes of Rag−/− animals 13, 14, and we have detected X1‐Cß transcripts in human CD34+ CD1a− CD4− CD8− CD45+ (DN) thymocytes, which contain no proteins with a Cß1 domain 26 and very few if any Dß‐Jß recombination products 2. Our results suggest that X1‐Cß expression is 10‐times higher in late stages of thymocyte differentiation (iSP4 and DP) than in earlier stages (DN). The timeframe for V‐DJ rearrangements at the human TCRB locus extends until the DP stage 2, 3, 26, 27. Accordingly, a high level of X1‐Cß transcription at the time of V‐DJ recombination may contribute to this stochastic process by increasing the accessibility of the 5′RSS of the recombining Dß1 gene segment. Mutations in X1 promoter might cause biases in the TCR repertoire, with a higher proportion of Vß‐Dß2 rearrangements. We observed that X1‐Cß expression persisted in mature T cells without two complete TCRB rearrangements. This persistence contrasts with what has been observed for other IG or TCR germline transcripts such as J‐Ck, I‐Cμ, T early alpha (TEA), and Vß, which are expressed mainly in immature lymphocytes 18, 28, 29. X1‐Cß was also expressed in some acute B cell leukemias (data not shown). This expression is linked to an accessible TCRB locus leading to an incomplete ß‐rearrangement process 30, 31, 32. X1‐Cß is expressed at low levels in the erythroleukemia line K562, which is one of the rare non‐T cell lines with some DNase I hypersensitivity around the TSS of X1 (ENCODE project). Allelic inclusion at the TCRB locus, that is leading to the presence of two functional TCRß chains on the cell surface, has been reported to occur in about 1% of human T cell clones, suggesting that allelic exclusion at this locus is not an absolute rule 33, 34. The difficulty of these genetic analyses is to ensure that the analyzed cell populations are clonal. In this context, an RT‐PCR assay for X1‐Cß can help: in a given clone the detection of X1‐Cß transcripts excludes the presence of two complete TCRß rearrangements (except for the rare Vß30‐Dß2‐Jß2 rearrangements).

Conflict of Interest

The authors declare no commercial or financial conflict of interest.
  34 in total

1.  Germ-line transcripts of the immunoglobulin lambda J-C clusters in the mouse: characterization of the initiation sites and regulatory elements.

Authors:  H Engel; H Rühl; C J Benham; J Bode; S Weiss
Journal:  Mol Immunol       Date:  2001-08       Impact factor: 4.407

2.  Amplification of cDNA ends based on template-switching effect and step-out PCR.

Authors:  M Matz; D Shagin; E Bogdanova; O Britanova; S Lukyanov; L Diatchenko; A Chenchik
Journal:  Nucleic Acids Res       Date:  1999-03-15       Impact factor: 16.971

3.  Intra- and inter-allelic ordering of T cell receptor beta chain gene assembly.

Authors:  Bernard Khor; Barry P Sleckman
Journal:  Eur J Immunol       Date:  2005-03       Impact factor: 5.532

4.  Identification and functional characterization of the human T-cell receptor beta gene transcriptional enhancer: common nuclear proteins interact with the transcriptional regulatory elements of the T-cell receptor alpha and beta genes.

Authors:  L R Gottschalk; J M Leiden
Journal:  Mol Cell Biol       Date:  1990-10       Impact factor: 4.272

Review 5.  Accessibility and the developmental regulation of V(D)J recombination.

Authors:  M S Schlissel; P Stanhope-Baker
Journal:  Semin Immunol       Date:  1997-06       Impact factor: 11.130

6.  Deletional rearrangement in the human T-cell receptor alpha-chain locus.

Authors:  J P de Villartay; D Lewis; R Hockett; T A Waldmann; S J Korsmeyer; D I Cohen
Journal:  Proc Natl Acad Sci U S A       Date:  1987-12       Impact factor: 11.205

7.  Deletion of germline promoter PD beta 1 from the TCR beta locus causes hypermethylation that impairs D beta 1 recombination by multiple mechanisms.

Authors:  C E Whitehurst; M S Schlissel; J Chen
Journal:  Immunity       Date:  2000-11       Impact factor: 31.745

8.  Essential function for SWI-SNF chromatin-remodeling complexes in the promoter-directed assembly of Tcrb genes.

Authors:  Oleg Osipovich; Robin Milley Cobb; Kenneth J Oestreich; Steven Pierce; Pierre Ferrier; Eugene M Oltz
Journal:  Nat Immunol       Date:  2007-06-24       Impact factor: 25.606

9.  Structure and expression of human germline VH transcripts.

Authors:  J E Berman; C G Humphries; J Barth; F W Alt; P W Tucker
Journal:  J Exp Med       Date:  1991-06-01       Impact factor: 14.307

10.  Dual T cell receptor beta chain expression on human T lymphocytes.

Authors:  F Davodeau; M A Peyrat; F Romagné; A Necker; M M Hallet; H Vié; M Bonneville
Journal:  J Exp Med       Date:  1995-04-01       Impact factor: 14.307

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.