| Literature DB >> 28421058 |
Shuai Wang1, Qiangyi Wang1, Ence Yang1, Ling Yan1, Tong Li1, Hui Zhuang1.
Abstract
The female vaginal environment contains diverse microorganisms, and their interactions play significant roles in health and disease. Lactobacillus species are the predominant vaginal microorganisms in healthy women and relevant as a barrier to defense against pathogens, including Candida albicans. The yeast-to-hyphae transition is believed to be a determinant of C. albicans pathogenesis. In this study, we investigated the effects of vaginal isolates of L. crispatus (seven strains), L. gasseri (six strains), and L. jensenii (five strains) on growth, hyphal formation and virulence-related genes expression of C. albicans ATCC 10231. We found that the L. crispatus showed the most significant antimicrobial activities in microplate-based liquid medium assay (P < 0.05). All seven cell-free supernatants (CFS) from L. crispatus strains reduced the growth of C. albicans by >60%. The effects might be due to their productions of some secretory antimicrobial compounds in addition to H2O2 and organic acids. Furthermore, each of the CFS of Lactobacillus strains was found to significantly suppress the yeast-to-hyphae transition of C. albicans under hyphae-inducing conditions (RPMI 1640 medium supplemented with 10% fetal bovine serum). The hyphae inhibition rates of C. albicans treated by CFS from L. crispatus, L. gasseri, and L. jensenii were 88.3 ± 3.02%, 84.9 ± 6.0%, and 81.9 ± 6.2%, respectively. Moreover, the expression of hyphae-specific genes (ALS3, HWP1, ECE1, EAP1, and SAP5) and transcriptional regulatory genes (EFG1, TEC1, and NRG1) were analyzed using quantitative real-time PCR. The results demonstrated that L. crispatus CFS significantly down-regulated the expression of hyphae-specific genes ALS3 (0.140-fold)), HWP1 (0.075-fold), and ECE1 (0.045-fold), while up-regulated the expression of the negative transcriptional regulator gene NRG1 with 1.911-fold. The antimicrobial compounds from L. crispatus B145 against Candida growth were heat stable and protease resistance, but those against hyphal formation were partially sensitive to the same treatments. Our novel findings suggest that L. crispatus, a dominant Lactobacillus species associated with a healthy vagina, could strongly inhibit C. albicans growth and hyphal formation. L. crispatus might repress the expression of hyphae-specific genes (ALS3, HWP1, and ECE1) in a NRG1-dependent manner. Besides, L. crispatus B145 is highly worthwhile for probiotic investigation.Entities:
Keywords: Candida albicans; Lactobacillus; antimicrobial activity; microbiota; vulvovaginal candidiasis; yeast-tohyphae
Year: 2017 PMID: 28421058 PMCID: PMC5378977 DOI: 10.3389/fmicb.2017.00564
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
List of primers used for qRT-PCR experiments.
| Gene | Function | Primer sequence (5′–3′) |
|---|---|---|
| GTP-binding protein (Reference gene) | F: TGAAGTCCATCCATTAGGAT | |
| R: ATCTCTATGCCAGTTTGGAA | ||
| Negative transcriptional regulator | F: CACCTCACTTGCAACCCC | |
| R: GCCCTGGAGATGGTCTGA | ||
| Conserved filamentation activator | F: AGGTTCCCTGGTTTAAGTG | |
| R: ACTGGTATGTGTGGGTGAT | ||
| Filamentous growth protein | F: TATGCCCCAGCAAACAACTG | |
| R: TTGTTGTCCTGCTGTCTGTC | ||
| Extracellular adherence protein | F: CTGCTCACTCAACTTCAATTGTCG | |
| R: GAACACATCCACCTTCGGGA | ||
| Secreted aspartyl proteinase | F: CAGAATTTCCCGTCGATGAGA | |
| R: CATTGTGCAAAGTAACTGCAACAG | ||
| Agglutinin-like protein | F: CTAATGCTGCTACGTATAATT | |
| R: CCTGAAATTGACATGTAGCA | ||
| Hyphal cell wall protein | F: TGGTGCTATTACTATTCCGG | |
| R: CAATAATAGCAGCACCGAAG | ||
| Extent of cell elongation protein | F: GCTGGTATCATTGCTGATAT | |
| R: TTCGATGGATTGTTGAACAC |
Characteristics of 18 vaginal Lactobacillus strains.
| Strain | pH of CFS | H2O2 producing abilitya | GIAb |
|---|---|---|---|
| A014 | 3.91 | ++ | +++ |
| A055 | 3.95 | ++ | ++ |
| B125 | 3.93 | +++ | ++ |
| B135 | 3.94 | +++ | +++ |
| B145 | 3.93 | +++ | +++ |
| B422 | 3.93 | ++ | +++ |
| B535 | 3.93 | +++ | ++ |
| A054 | 3.92 | - | ++ |
| B062 | 3.86 | + | + |
| B351 | 3.93 | +++ | +++ |
| B451 | 3.95 | - | ++ |
| B542 | 3.97 | - | ++ |
| B554 | 3.93 | - | +++ |
| A083 | 4.09 | +++ | - |
| B021 | 4.09 | +++ | - |
| B101 | 4.02 | +++ | +++ |
| B161 | 3.96 | ++ | - |
| B511 | 4.16 | +++ | +++ |