| Literature DB >> 28373862 |
Shuqing Li1, Lina Song2, Xiang Gao2, Yaguo Jin2, Shuwei Liu1, Qirong Shen3, Jianwen Zou1.
Abstract
Manure composting is a significant source of atmospheric methane (CH4) and nitrous oxide (N2O) that are two potent greenhouse gases. The CH4 and N2O fluxes are mediated by methanogens and methanotrophs, nitrifying and denitrifying bacteria in composting manure, respectively, while these specific bacterial functional groups may interplay in CH4 and N2O emissions during manure composting. To test the hypothesis that bacterial functional gene abundances regulate greenhouse gas fluxes in windrow composting systems, CH4 and N2O fluxes were simultaneously measured using the chamber method, and molecular techniques were used to quantify the abundances of CH4-related functional genes (mcrA and pmoA genes) and N2O-related functional genes (amoA, narG, nirK, nirS, norB, and nosZ genes). The results indicate that changes in interacting physicochemical parameters in the pile shaped the dynamics of bacterial functional gene abundances. The CH4 and N2O fluxes were correlated with abundances of specific compositional genes in bacterial community. The stepwise regression statistics selected pile temperature, mcrA and NH4+ together as the best predictors for CH4 fluxes, and the model integrating nirK, nosZ with pmoA gene abundances can almost fully explain the dynamics of N2O fluxes over windrow composting. The simulated models were tested against measurements in paddy rice cropping systems, indicating that the models can also be applicable to predicting the response of CH4 and N2O fluxes to elevated atmospheric CO2 concentration and rising temperature. Microbial abundances could be included as indicators in the current carbon and nitrogen biogeochemical models.Entities:
Keywords: CH4; N2O; bacterial gene abundance; carbon and nitrogen biogeochemistry; greenhouse gas; statistical model
Year: 2017 PMID: 28373862 PMCID: PMC5357657 DOI: 10.3389/fmicb.2017.00409
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
The primers used for quantitative PCR in this study.
| Gene | Name | Sequence | Thermal profile | No. cycles | Product size | Reference |
|---|---|---|---|---|---|---|
| mlas | GGTGGTGTMGGDTTCACMCARTA | 30 s-95°C, 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 509 bp | ||
| CGTTCATBGCGTAGTTVGGRTAGT | 95°C-5 s, 60°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | ||||
| GGNGACTGGGACTTCTGG | 30 s-95°C, 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 472 bp | |||
| mb661-r | CCGGMGCAACGTCYTTACC | 95°C-5 s, 60°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | |||
| GGGGTTTCTACTGGTGGT | 30 s-95°C,95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 491 bp | |||
| CCCCTCKGSAAAGCCTTCTTC | 95°C-5 s, 55°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | ||||
| TAYGTSGGGCAGGARAAACTG | 30 s-95°C, 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 110 bp | |||
| CGTAGAAGAAGCTGGTGCTGTT | 95°C-5 s, 60°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | ||||
| TACCACCCSGARCCGCGCGT | 30 s-95°C,95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 425 bp | |||
| GCCGCCGTCRTGVAGGAA | 95°C-5 s, 58°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | ||||
| ATCATGGTSCTGCCGCG | 30 s-95°C, 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 473 bp | |||
| GCCTCGATCAGRTTGTGGTT | 95°C-5 s, 58°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | ||||
| qnorB2F | GGNCAYCARGGNTAYGA | 30 s-95°C, 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 262 bp | ||
| qnorB5R | ACCCANAGRTGNACNACCCACCA | 95°C-5 s, 60°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 | |||
| AGAACGACCAGCTGATCGACA | 30 s-95°C, 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 1 | 300 bp | |||
| TCCATGGTGACGCCGTGGTTG | 95°C-5 s, 60°C-34 s, 72°C-15 s 95°C-15 s, 55°C-30 s,72°C-30 s, 80°C-30 s | 40 |
Changes of physicochemical parameters (mean ± SE, n = 3) during windrow dairy manure composting.
| Days | Temperature (°C) | Moisture (%) | pH | SOC (%) | TN (%) | C/N | NH4+ (g⋅kg-1 DM) | NO3- (g⋅kg-1 DM) | NO2- (mg⋅kg-1 DM) |
|---|---|---|---|---|---|---|---|---|---|
| 2 | 44.7 ± 0.1 | 60.1 ± 0.9 | 8.15 ± 0.18 | 23.7 ± 0.3 | 1.45 ± 0.11 | 16.4 ± 1.3 | 2.40 ± 0.29 | 0.37 ± 0.02 | 1.89 ± 0.10 |
| 4 | 53.8 ± 0.0 | 57.1 ± 1.3 | 8.05 ± 0.01 | 23.2 ± 0.8 | 1.52 ± 0.06 | 15.3 ± 0.2 | 2.31 ± 0.33 | 0.28 ± 0.02 | 1.13 ± 0.18 |
| 6 | 67.7 ± 0.3 | 52.1 ± 1.4 | 8.34 ± 0.03 | 21.3 ± 1.0 | 1.35 ± 0.09 | 15.7 ± 0.2 | 1.40 ± 0.09 | 0.40 ± 0.03 | 1.73 ± 0.05 |
| 10 | 68.0 ± 0.1 | 48.0 ± 1.2 | 8.10 ± 0.03 | 22.6 ± 0.3 | 1.35 ± 0.01 | 16.7 ± 0.2 | 1.34 ± 0.58 | 0.36 ± 0.01 | 1.60 ± 0.06 |
| 16 | 65.4 ± 0.3 | 48.5 ± 1.4 | 8.06 ± 0.10 | 22.2 ± 0.7 | 1.42 ± 0.05 | 15.7 ± 1.1 | 2.02 ± 0.01 | 0.32 ± 0.01 | 1.26 ± 0.08 |
| 25 | 63.7 ± 0.4 | 43.1 ± 4.7 | 7.93 ± 0.01 | 21.3 ± 0.2 | 1.53 ± 0.00 | 13.9 ± 0.2 | 1.44 ± 0.00 | 0.42 ± 0.05 | 1.54 ± 0.16 |
| 37 | 55.9 ± 0.3 | 28.4 ± 0.5 | 7.96 ± 0.03 | 20.3 ± 0.2 | 1.61 ± 0.03 | 12.7 ± 0.1 | 1.48 ± 0.07 | 0.32 ± 0.00 | 2.02 ± 0.08 |
| 46 | 55.5 ± 0.0 | 16.5 ± 0.8 | 8.11 ± 0.01 | 21.5 ± 0.2 | 1.56 ± 0.06 | 13.8 ± 0.6 | 1.49 ± 0.02 | 0.36 ± 0.00 | 1.51 ± 0.25 |
| 52 | 49.6 ± 0.1 | 21.4 ± 0.5 | 8.12 ± 0.03 | 20.8 ± 0.6 | 1.63 ± 0.01 | 12.7 ± 0.3 | 1.38 ± 0.05 | 0.38 ± 0.04 | 1.60 ± 0.23 |
| 55 | 48.1 ± 0.0 | 18.9 ± 1.7 | 8.02 ± 0.02 | 20.4 ± 0.6 | 1.63 ± 0.05 | 12.5 ± 0.1 | 0.99 ± 0.06 | 0.46 ± 0.03 | 1.49 ± 0.14 |
| 61 | 46.0 ± 0.1 | 13.5 ± 0.0 | 8.16 ± 0.02 | 21.4 ± 0.2 | 1.61 ± 0.01 | 13.3 ± 0.2 | 1.09 ± 0.21 | 0.34 ± 0.00 | 1.59 ± 0.08 |
| 65 | 45.2 ± 0.2 | 23.7 ± 0.0 | 7.99 ± 0.04 | 20.8 ± 0.0 | 1.65 ± 0.03 | 12.6 ± 0.3 | 1.27 ± 0.21 | 0.33 ± 0.02 | 2.09 ± 0.09 |
Modeling CH4 (YC) and N2O (YN) fluxes by coupling functional gene copy numbers with physicochemical parameters during windrow dairy manure composting and the model tested in rice paddies.
| Biosystems | Model | k1 | k2 | k3 | c | RMSE | MEF | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Estimate | Estimate | Estimate | Estimate | |||||||||
| Manure composting | YC1 = k1 × | 3.05 ± 0.93 | 0.01 | -1.39 ± 0.75 | 0.11 | 0.55 | 0.41 | 0.46 | ||||
| YC2 = k1× T + k2× | 0.056 ± 0.006 | <0.001 | 1.28 ± 0.13 | <0.001 | -9.06 ± 0.88 | <0.001 | 0.94 | 0.14 | 0.94 | |||
| YC3 = k1× T + k2× | 0.048 ± 0.04 | <0.001 | 1.12 ± 0.08 | <0.001 | 0.32 ± 0.08 | 0.009 | -8.18 ± 0.51 | <0.001 | 0.98 | 0.08 | 0.98 | |
| YN1 = k1× ( | 1.40 ± 0.07 | <0.001 | 0.06 ± 0.40 | 0.88 | 0.79 | 0.36 | 0.74 | |||||
| YN2 = k1× | 0.25 ± 0.04 | <0.001 | -0.87 ± 0.20 | 0.005 | 6.65 ± 1.40 | 0.003 | 0.92 | 0.23 | 0.90 | |||
| YN3 = k1× | 0.20 ± 0.04 | 0.003 | -0.77 ± 0.16 | 0.005 | 0.19 ± 0.08 | 0.07 | 4.93 ± 1.30 | 0.01 | 0.95 | 0.18 | 0.94 | |
| Rice paddy | YC3 = k1× T + k2× | 0.02 ± 0.007 | 0.005 | 0.92 ± 0.14 | <0.001 | 0.03 ± 0.01 | 0.005 | -7.70 ± 1.12 | <0.001 | 0.74 | 0.23 | 0.90 |
| YN3 = k1× | 0.39 ± 0.08 | <0.001 | -0.35 ± 0.12 | 0.004 | 0.19 ± 0.07 | 0.02 | -5.46 ± 0.99 | <0.001 | 0.66 | 0.15 | 0.95 | |