Literature DB >> 28336940

Genetic Analysis of the IncX4 Plasmids: Implications for a Unique Pattern in the mcr-1 Acquisition.

Jian Sun1,2, Liang-Xing Fang1,2, Zuowei Wu3, Hui Deng1,2, Run-Shi Yang1,2, Xing-Ping Li1,2, Shu-Min Li1,2, Xiao-Ping Liao1,2, Youjun Feng4,5, Ya-Hong Liu6,7.   

Abstract

IncX4 plasmids are associated with the dissemination of the mcr-1 genes in Enterobacteriaceae. We screened IncX4 plasmids among 2,470 isolates of Enterobacteriaceae and determined the mcr-1 positive isolates. Forty-three isolates were observed to carry IncX4 type plasmid, among which 13 were identified to carry mcr-1 gene. Three representative mcr-1-positive IncX4 plasmids were selected for high-throughput sequencing. Comparative genomics showed that the mcr-1-carrying IncX4 plasmids exhibit remarkable similarity in the backbone, and the major distinction lies in the region containing mcr-1. The major variable regions of all the IncX4 plasmids were fully characterized by PCR-RFLP. The results revealed that the mcr-1 was located on the Variable Region I of IncX4 plasmids in 11 E. coli isolates. Among them, nine E. coli strains possess an epidemic pCSZ4-like IncX4 plasmid containing mcr-1. ISApl1 was presumably involved in the transposition of the mcr-1 cassette and then was lost. Similar genetic contexts were found in different plasmids, even the E. coli chromosome, implying the acquisition of mcr-1 by a unique common mechanism.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28336940      PMCID: PMC5428312          DOI: 10.1038/s41598-017-00095-x

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Plasmid-mediated gene horizontal transfer plays an important role in the dissemination of antibiotic resistance determinants in Gram-negative bacteria[1]. IncX plasmid is a narrow-host range plasmid of Enterobacteriaceae, and exists as a resident plasmid since the pre-antibiotic era[2]. Plasmid relaxase gene typing (PRaseT), suggested that IncX plasmids can be grouped into six members (from IncX1, IncX2, …, IncX6), which are frequently relevant to the spread of the antibiotic resistance genes like fluoroquinolone and β-lactam resistance[3, 4]. Among them, IncX4 is one of the most prevalent plasmid type in E. coli (7.6% to 34.0%)[3, 5]. Also, IncX4 plasmids are found in other species of Enterobacteriaceae[3-6]. IncX4 plasmid is self-transferable at high frequencies (~10−1–~10−4), which is much higher (102–105 -fold) than the epidemic IncFII plasmids[5, 7]. In particular, the dissemination of the gene bla CTX-M-14b by the IncX4 type plasmid pSAM7[8] was observed amongst the following three species (E. coli, Enterobacter cloacae, and Salmonella enterica). It suggested that IncX4 plasmids also can be transferred between different species of Enterobacteriaceae. Since its first discovery in China, in the later of 2015[9], the mcr-1 colistin resistance gene has been reported worldwide encompassing all continents except Oceania and Antarctica[10, 11]. Diversified plasmids act as major vectors for the dissemination of the mcr-1 gene in Enterobacteriaceae[12, 13]. So far, the mcr-1-harbouring plasmids can be grouped into eight types, including IncI2, IncX4, IncHI1, IncHI2, IncF, IncFI, IncFII, and IncP[9, 14–21]. As a prevalent type, IncX4 plasmid is widespread in various species (E. coli, Salmonella enteric, and Klebsiella pneumonia) of diversified origins ranging from human, animals, to animal products in many countries, like China, Denmark, United Kingdom, etc.[15–17, 22–29]. Of being noteworthy, the mcr-1-carring IncX4 plasmids can occur in extended-spectrum β-lactamase (ESBL) - and carbapenemase- producing Enterobacteriaceae[22, 23], posing severe threat to public health. Generally, the mcr-1 gene is present within the approximately 2,600 bp long fragment designed as the mcr-1 cassette in which the mcr-1 gene is followed by a hypothetical protein annotated with the phosphoesterase[29]. ISApl1 upstream of the mcr-1 gene, presumably accounts for the mobilization of the mcr-1 gene[30]. Occasionally, the mcr-1 gene exists in a composite transposon having the boundaries with two copies of ISApl1 [21]. Recently, a model for transposition of mcr-1 by ISApl1 has been illustrated[31]. But, until now, no insert sequence including ISApl1 was found to involve in spread of mcr-1 among all of the mcr-1-harbouring IncX4 plasmids. Thus, our aim is to explore the mechanism whereby the mcr-1 gene is integrated into IncX4 plasmids. In this work, we detect the presence of IncX4 plasmids among 2,470 Enterobacteriaceae isolates and concentrated on the mcr-1-positive IncX4 plasmids. Three representative IncX4 plasmids were subjected to high-throughput sequencing. We discussed the possible mode/pattern for the integration of mcr-1 into IncX4 plasmids.

Results

Detection of IncX4 plasmids amongst Enterobacteriaceae

In total, forty-three of the 2,470 Enterobacteriaceae isolated from 2004 to 2013 were determined to possess IncX4 plasmids, including 23 from pigs, 12 from poultry, 3 from pets, and 3 from retail meat. The 43 IncX4-positive strains were collected from 10 different cities in Guangdong province, China. Following 16S-based identification of these IncX4-positive isolates, 41 species were assigned to E. coli, one isolate was classified into K. pneumoniae, and the remaining one was Citrobacter freundii.

Molecular typing and antimicrobial susceptibility test of mcr-1-carrying strains

The PFGE-based genotyping showed that all the 41 IncX4-positive E. coli strains exhibited 31 different PFGE profiles, suggesting unexpected diversity amongst the E. coli host (Fig. S1). Among them, 13 were found to carry the mcr-1 gene (Table 1). The 13 E. coli isolates are from pigs (n = 11) and pork (n = 2) between the years of 2007 and 2013. Of note, the two isolates (FEC46-4 and CEC49-3) possessed the identical PFGE profile and the other 11 isolates exhibited their own unique PFGE profiles, indicating that the 13 mcr-1-carrying E. coli isolates are epidemiologically unrelated (Fig. S1). Antimicrobial susceptibility tests revealed that all the mcr-1-positive E. coli isolates have higher MICs (4–8 μg/mL) in relative to E. coli 25922 (0.25 μg/mL). Furthermore, all of them were multidrug-resistant to ampicillin, nalidixic acid, olaquindox, tetracycline, florfenicol and sulfamethoxazole/trimethoprim. In addition, five of them were also resistant to extended-spectrum cephalosporins (ceftiofur and cefotaxime) (Table 1).
Table 1

Characteristics of the 13 mcr-positive E. coli isolates harbouring IncX4 plasmids.

StrainPFGEMIC (ug/ml)Other resistance profilea Resistance genesRFLP pattern of variable regionSize of mcr-1-positive plasmid (kb) mcr-positive plasmid transferPBRTGenetic contextTypec
colistinIIIIIIWild strainsb conjugants
FS1Z2SX8AMP, CTX, CIF, CAZ, FOX, STR, GEN, KAN, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB AAA~33/90/320+ X4, FIIX4I
FS4Z2GVIII8AMP, STR, GEN, KAN, AMK, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, rmtB, qepA AAA~33/80+ X4, FIB, FIIX4I
FS2Z5CXVII8AMP, KAN, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB AAA~33+ X4 X4I
FS11Z5CVII8AMP, STR, GEN, KAN, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB AAA~33+ X4, FIB, FIIX4I
FZQ15-4-1XXIV8AMP, FOX, GEN, KAN, NAL, CIP, OLA, FFL, TET, S*T mcr-1 AAA~33+ X4 X4I
CEC49-3XX4AMP, CTX, CIF, STR, NAL, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, qnrS1, bla CTX-M-55, AAA~33 X4, FIB, FIII
FEC46-4XX4AMP, CTX, CIF, STR, NAL, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, qnrS1, bla CTX-M-55 AAA~33 X4, FIB, FIII
CSZ4XXVIII8KAN, NAL, OLA, FFL, TET, DOX, S*T, CS mcr-1, oqxAB, qnrS1 AAA~33+ X4 X4I
QOC7-1XI8AMP, STR, GEN, KAN, NAL, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, bla CTX-M-130, AAA~33+ X4, I2, FIIX4I
PY1XIV8AMP, NAL, FFL, TET, DOX, S*T mcr-1 BBA~33+ X4 X4II
FS170GXXV8AMP, CTX, CIF, CAZ, FOX, STR, GEN, KAN, AMK, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, aac(6′)-Ib-cr, rmtB CAA~33+ X4, HI2, FIBX4III
S135XVI8AMP, GEN, KAN, AMK, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, rmtB DBB~60+ X4, I2I2ND
FS13Z2SXXII8AMP, CTX, CIF, STR, KAN, NAL, CIP, OLA, FFL, TET, DOX, S*T mcr-1, oqxAB, qnrS1, blaCTX-M−55 ECC~240/chromosome+ X4, HI2HI2ND

aAMP, Ampicillin; CTX, cefotaxime; CIF, ceftiofur; FOX, cefoxitin; STR, streptomycin AMK, amikacin; GEN, gentamicin; KAN, kanamycin; NAL, nalidixic acid; CIP, ciprofloxacin; OLA, olaquindox; FLF, florfenicol; TET, tetracycline; DOX, doxycycline; S*T, sulfamethoxazole/trimethoprim; CS, Colistin; b“−”, transfer of mcr-1 was failure in strains CEC49-3 and CEC49-3; c“ND”, not detected.

Characteristics of the 13 mcr-positive E. coli isolates harbouring IncX4 plasmids. aAMP, Ampicillin; CTX, cefotaxime; CIF, ceftiofur; FOX, cefoxitin; STR, streptomycin AMK, amikacin; GEN, gentamicin; KAN, kanamycin; NAL, nalidixic acid; CIP, ciprofloxacin; OLA, olaquindox; FLF, florfenicol; TET, tetracycline; DOX, doxycycline; S*T, sulfamethoxazole/trimethoprim; CS, Colistin; b“−”, transfer of mcr-1 was failure in strains CEC49-3 and CEC49-3; c“ND”, not detected.

Location and transferability of mcr-1

Thirteen E. coli isolates that both carried mcr-1 and IncX4 plasmid were analyzed by S1-PFGE. The results showed that multiple plasmids, besides IncX4, were present in all of the 13 isolates (Fig. S2a). Southern blotting revealed that all the mcr-1 harbouring isolates carried IncX4 plasmids of ~33 kb (Fig. S2b). The mcr-1 gene was located on IncX4 plasmids in 11 isolates, or on a ~60 kb IncI2 plasmid and a ~240 kb IncHI2 plasmid in strain S135 and FS13Z2S, respectively (Table 1 and Fig. S2c). Of note, in strain FS1Z2S and FS4Z2G, besides IncX4 plasmid, the mcr-1 gene was also observed on the other plasmid with ~90 kb and ~320 kb, as well as ~80 kb, respectively. In strain FS13Z2S, besides the copy on the non-IncX4 plasmid, a second copy of mcr-1 was also found in the chromosome. The results indicate that multiple copies of mcr-1 could exist in one isolate (Table 1 and Fig. S2c). Conjugation assay showed that mcr-1 was successfully transferred in 11 out of the 13 isolates except CEC49-3 and FEC46-4. All the transconjugants showed 32- or 64-fold increases in the MICs of colistin, when compared with the recipient E. coli C600 (0.125 mg/L). However, the other antibiotic-resistant phenotypes did not co-transfer with colistin except for strain FS13Z2ST that was not only resistant to colistin but also to multi-drugs including ampicillin, nalidixic acids, tetracycline, florfenicol, cefotaxime, ceftiofur (Table 1).

Aanalysis of mcr-1-harbouring IncX4 plasmids and Sequencing

We compared the regions surrounding mcr-1 occurred between the pir and hns genes in all of the 11 isolates harbouring mcr-1-IncX4 plasmids, three different genetic contexts were found (Fig. S3). Three representative mcr-1-harbouring IncX4 plasmids pCSZ4, pFS170G and pPY1 were obtained and submitted to be sequenced. They were 33.309 kb, 34.924 kb, and 34.99 kb in length with GC content of 41.85%, 41.56%, and 42.48%, respectively. Three plasmids are nearly identical, only having subtle differences within the resistance region. All of them belong to IncX4 type plasmids and have typical plasmid backbones set that are responsible for plasmid replication, maintenance, and transfer. The phylogenetic tree revealed two distinct clusters: I and II (Fig. 1a). All the mcr-1-harbouring IncX4 plasmids belonged to the cluster I, which had a pir-type replicon. In the previous studies, the pir-type plasmids carrying bla CTX-M were identified in E. coli from the United Kingdom[8] and Australia[32] (Fig. 1a). Further comparative analysis indicated that plasmid pCSZ4 was nearly identical to IncX4 mcr-1-harbouring E. coli plasmids pECJP-B65-33 (Accession no.: KX084392) isolated from China, pICBEC72Hmcr (Accession no.: CP015977) from Brazil, pESTMCR (Accession no.: KU743383) from Estonia, and K. pneumoniae plasmids pMCR1_Incx4 (Accession no.: KU761327) from China and pMCR1.2-IT (Accession no.: KX236309) identified in Italy (Fig. 1b and Table S1).
Figure 1

Phylogenetic tree and linear comparison of the 21 IncX4 plasmids. A total of 29 plasmids were collected by July 18, 2016, but only one was chosed for analysis in the highly similar plasmids. These plasmids included 3 found in this study and 18 downloaded from the GenBank (Table S1). (a) The trees are generated using MEGA (version 6) based on the complete sequence of IncX4 plasmids. (b) Boxed arrows represent the position and transcriptional direction of ORFs. Regions of >99% identity are marked by grey shading. Genes associated with the tra and pil loci are colored light blue, replication associated genes are colored dark blue, antibiotic resistance genes are colored red, insertion sequences are colored green, and other genes are colored gray. The Variable Region I, II, and III, as well as the primers used were marked.

Phylogenetic tree and linear comparison of the 21 IncX4 plasmids. A total of 29 plasmids were collected by July 18, 2016, but only one was chosed for analysis in the highly similar plasmids. These plasmids included 3 found in this study and 18 downloaded from the GenBank (Table S1). (a) The trees are generated using MEGA (version 6) based on the complete sequence of IncX4 plasmids. (b) Boxed arrows represent the position and transcriptional direction of ORFs. Regions of >99% identity are marked by grey shading. Genes associated with the tra and pil loci are colored light blue, replication associated genes are colored dark blue, antibiotic resistance genes are colored red, insertion sequences are colored green, and other genes are colored gray. The Variable Region I, II, and III, as well as the primers used were marked. Based on the sequence comparison of the 29 IncX4 plasmids deposited in Genbank database, three major variable regions of these IncX4 plasmids were identified (Fig. 1b). Three pairs of specific primers were designed for the variable regions and used to type the regions in the plasmid IncX4 and mcr-1 positive E. coli isolates by PCR-RFLP (Fig. S4). Five (designated A–E), three (designated A–C), and three (designated A–C) patterns (each with 100% similarity) were identified in the Variable Region I, II and III, respectively. Five different profiles for IncX4 plasmids were found by combination of the PCR-RFLP band patterns of the three major variable regions in the 13 isolates, and one profile (designated A-A-A) was predominant (9 out of 13) (Table 1). The PCR products of each variable region were randomly selected for sequence determination to represent all the distinct patterns in every region. Interestingly, the analyses of these sequences showed that the mcr-1 gene located on the Variable Region I (represented by patterns A, B and C) of 11 isolates (Table 1), and no other resistance genes were found in the three variable regions.

Comparison of the region containing mcr-1 on IncX4 plasmids

In comparison with pCSZ4, another two mcr-1-harbouring IncX4 plasmids pFS170G and pPY1 are different in the mcr-1-harbouring variable region. Like other mcr-1-harbouring IncX4 plasmids, in pCSZ4, only a typical mcr-1 cassette encompassing the mcr-1 gene and a hypothetical protein (hp1) was identified. In pFS170G, the mcr-1 genetic contexts were identical to that in pCSZ4 except the flanked hp was truncated by IS1294. As for pPY1, the whole mcr-1 cassette was inverted and ISApl1 was inserted directly downstream of the hp. Of note, in all the IncX4 plasmids, the insertion sequence ISApl1 was absent in front of the mcr-1. However, a proposed IRR (IRR2, TTTTTAAGAAGGGTGAACAAGTTTAAT) was consistently present on the 3′-region of hp (Fig. 2b). Moreover, 2 or 3 bases (CG or CGG) adjacent to the IRR2 were recognized as DRs which were characterized as the classic direct repeat sequence at the target insertion site along with the transposition of the ISApl1. Intriguingly, compared to pSH146_32 without carrying mcr-1, nearly identical inserted site of the mcr-hp transposition unit was found in all mcr-1-located IncX4 plasmids except for pPY1, in which the inserted location appeared on 3 bases downstream of the stationary inserted site, as well as the transposition unit was completed inverted. Through further comparative analysis of the genetic environments of mcr-1, an identical IRR2 and DR were also found within IncHI1 plasmid (pEC2-4 and pH226B), IncHI2 plasmid (pS38 and pHNSHP45-2), F18:A−:B+ plasmid (pMR0516mcr) or E. coli chromosomes (E. coli RL465, E. coli BJ10 and E. coli EC590) (Fig. 2b).
Figure 2

Contexts of mcr-1 on IncX4 plasmids and relevant the other plasmids and E. coli chromosomes. Resistance genes are indicated by red arrows, while accessory genes are indicated by gray arrows. Insertion sequences are highlighted in green arrows labelled with their name or number. DRs are represented by the filled circles. The short black arrow show the 187 bp spacer between ISApl1 and mcr-1. Vertical black bars represent the transposon IR of ISApl1, while the dotted lines indicate possible deletion and insertion events. DR, direct repeats. IRL, terminal inverted repeats of left. IRR, terminal inverted repeats of right. Underlined nucleotides in the alternate IRR elements are identical to those of the perfect IRR. The underlined bases is the backbone of pSH146-32. The big brace is the mcr-1 cassette. The bases in the box are IRRs, while the green bases are DRs. (a) Genetic environment of mcr-1 on IncX4 plasmids and relevant the other plasmids and E. coli chromosomes. (b) Alignment of the mcr-1 gene and its adjacent squence.

Contexts of mcr-1 on IncX4 plasmids and relevant the other plasmids and E. coli chromosomes. Resistance genes are indicated by red arrows, while accessory genes are indicated by gray arrows. Insertion sequences are highlighted in green arrows labelled with their name or number. DRs are represented by the filled circles. The short black arrow show the 187 bp spacer between ISApl1 and mcr-1. Vertical black bars represent the transposon IR of ISApl1, while the dotted lines indicate possible deletion and insertion events. DR, direct repeats. IRL, terminal inverted repeats of left. IRR, terminal inverted repeats of right. Underlined nucleotides in the alternate IRR elements are identical to those of the perfect IRR. The underlined bases is the backbone of pSH146-32. The big brace is the mcr-1 cassette. The bases in the box are IRRs, while the green bases are DRs. (a) Genetic environment of mcr-1 on IncX4 plasmids and relevant the other plasmids and E. coli chromosomes. (b) Alignment of the mcr-1 gene and its adjacent squence.

Discussion

Previous evidence revealed that IncX4 plasmids played a significant role in the spread of the mcr-1 gene among Enterobacteriaceae[15, 26, 27]. In this study, mcr-1 located on IncX4 plasmids in 11 of the 13 mcr-1-positive isolates. Moreover, nine among them belong to an epidemic pCSZ4-like IncX4 plasmid. Interestingly, the predominant mcr-1-carrying IncX4 plasmids were detected in the E. coli isolates from five different cities in South China between 2012 and 2013, but the isolates were epidemiologically unrelated (Fig. S1). Conjugation assay showed that most of IncX4 plasmids carrying mcr-1 (9/11) were transferable (Table 1). The genetic analysis revealed that the Variable Region I in the pCSZ4-like plasmids was almost identical to that in the IncX4 plasmids of Enterobacteriaceae isolates (E. coli and K. pneumoniae) from countries of several continents (Fig. 1), suggesting that the predominant mcr-1-harbouring IncX4 plasmids have circulated in Enterobacteriaceae worldwide. Multiple replicons such as IncHI2 and IncI2 were observed to co-exist with IncX4 in the mcr-1-carrying isolates. In FS1Z2S and FS4Z2G, mcr-1 has two copies and separately located on two types of plasmids (Table 1). In addition, the mcr-1 is also detected on an IncX4 plasmid and its chromosome in strain FS13Z2S. It is interesting that multiple copies of mcr-1 are carried by co-resident plasmids or chromosome in one strain (Fig. S2). However, whether the emergence of two copies of mcr-1 in a single strain is due to transposition of mcr-1 cassette between plasmids and/or chromosome is still unknown. Generally, the ISApl1 insertion sequence is detected upstream of mcr-1 and it is proposed to involve in the mobilization of the mcr-1 cassette[30]. Recent reports provided evidence that mcr-1 was mobilized primarily as a composite transposon composed of copies of ISApl1 or through formation of a circular intermediate[31, 33]. But we noticed that many sequences franked with only one or no ISApl1, and the 3′ end of mcr-1-hp1 unit was flexible. Snesrud et al. explained that it lost one or both copies of ISApl1 after composite transposon[31]. They attributed the differences at the 3′ end of mcr-1-hp1 unit to ISApl1 partially or completely removed by a process that generated mismatches and deletion[31]. We thought the above model for transposition of the mcr-1 gene could not fully explain the phenomenon. ISApl1 is a member of the IS30 family, which may format circular intermediates during transposition by recognizing its own IRL and the closest downstream sequence that resembles its IRR[34]. Further analyses of the sequences carrying mcr-1, we found that the 3′ end of mcr-1-hp1 could match with the perfect IRR of ISApl1 “coincidently”, which was named as IRR2 in this study (Fig. 2). Here, a new potential linked transposition model was proposed in mcr-1-harbouring sequences that initiated at the 27 bp IRL sequence of ISApl1, but ended at a fixed position downstream of the mcr-1 by recognizing the related IRR. Insertion of an ISApl1 results in the duplication at the target insertion site of two or three base pairs[35], which could be recognized as a “relic” to track an insertion event. Although the ISApl1 is lost in front of mcr-1 on all the mcr-1-harbouring IncX4 plasmids, several evidences supported the new mode we proposed above: (1) a 187 bp inter-genic region between IRR of ISApl1 and replication initiator of mcr-1 is consistently remained except that 6 bp is deleted in three plasmids including the mcr-1.2-harbouring plasmid, pMCR1.2-IT. (2) a flexible IRR-like sequence (IRR2, TTTTTAAGAAGGGTGAACAAGTTTAAT), sharing 11/27 bp similarity with the perfect IRR, is steadfastly identified on the 3′region of hp. (3) a suspected DR exactly emerges neighboring the IRR2 (Fig. 2). These evidences show that in IncX4 plasmid the ISApl1 is probably linked with the transposition of the mcr-1 cassette like which in the paradigm mcr-1-containing plasmid pHNSHP45, and it is subsequently lost due to some unknown event. Loss of ISApl1 seems to be conducive to maintaining of mcr-1 on IncX4 plasmids. Whether it is more beneficial to the host bacteria to adapt to changed environments, especially a conversion from the pressure of antimicrobial agents to a pressure-free environment, thereby avoiding the resistance region lost need to be evaluated in future studies[36]. Of note, the other plasmids such as IncHI1, IncHI2, IncF18:A−:B+, as well as E. coli chromosomes share the same IRR2 and DR with that in IncX4 plasmids (Fig. 2b), implying they may have a common ancestor. In conclusion, genetic analyses revealed that an epidemic mcr-1-harbouring IncX4 plasmid might circulate in Enterobacteriaceae of diverse origins worldwide. ISApl1-mediated transposition by recognizing different related IRRs probably involved in mobilization of the mcr-1-hp1 unit into the IncX4 plasmids. Our findings also demonstrate that most of the IncX4 plasmids along with the other IncHI1, IncHI2, IncF18:A−:B+ plasmids and even E. coli chromosomes may have acquired mcr-1 genes by a common mechanism.

Materials and Methods

Bacterial isolates and detection of IncX4 plasmids

Totally, 2,470 Enterobacteriaceae isolates were screened for the presence of IncX4 plasmids by PCR with the specific primers earlier reported[3]. The isolates were obtained from food animals (n = 1,044 from pigs and n = 722 from birds), companion animals (n = 381), and retail meat (n = 323) during 2002–2013 in Guangdong province in South China. Among them, 1,766 food animal isolates were sampled from viscera or fecal samples of diseased or healthy animals from farms during 2002–2013; and 381 pet strains were randomly collected from feces, urine, pus or sneeze samples from pet hospitals during 2008–2012. Strains of animal product origins were randomly collected from fresh pork (n = 233), chicken (n = 75), beef (n = 10) and duck (n = 5) from commodities markets and supermarkets in 2012. The identities of the IncX4-positive isolates were confirmed by 16S rDNA sequencing and MALDI-TOF MS (Biomerieux, France). IncX4-positive isolates were further analyzed by PFGE using enzyme Xba I [37]. Comparison of PFGE patterns was performed by using BioNumerics software version 2.5 (Applied Maths), and clusters were defined by cutoff of 85% similarity between DNA patterns.

PCR screen for the mcr-1 gene and antimicrobial susceptibility tests

All of the IncX4-positive isolates were subjected to PCR-screen for the mcr-1 gene with the primers described previously[9]. In total, 19 antibiotics were tested here (ampicillin, cefoxitin, ceftiofur, cefotaxime, amikacin, gentamicin, kanamycin, streptomycin, florfenicol, doxycycline, tetracycline, nalidixic acid, ciprofloxacin, olaquindox, sulfamethoxazole/trimethoprim, meropenem, colisin, fosfomycin and tigecycline). The minimum inhibitory concentration (MIC) of various antibiotics was determined by the agar dilution method following the guidelines of Clinical and Laboratory Standards institute (CLSI). The EUCAST breakpoints for E. coli were applied for colistin and tigecycline[38]. The breakpoints for other antimicrobial were used as recommended by the CLSI (M100-S25) or CLSI (Vet01-A4/Vet01-S2)[39, 40]. E. coli ATCC 25922 was used as a control.

Location of the mcr-1 gene and conjugation assay

To determine the association of the IncX4 plasmid and the mcr-1 gene, all IncX4 plasmids harbouring mcr-1 were analyzed by S1-PFGE and Southern blotting with the digoxigenin-labeled probes (Roche Diagnostics GmbH, Germany) specific for the taxC and mcr-1 genes[30, 41]. Furthermore, the transferability of the mcr-1 gene was assessed in all the mcr-1-carrying isolates by filter mating using streptomycin-resistant E. coli C600 as a recipient. Briefly, donor bacterium and recipient was grown in Luria Bertani Broth (LB) to logarithmic phase, mixed at a 1:4 ratio (vol/vol), collected in a filter, and incubated at 37 °C for 20 h. Transconjugants were selected on Eosin-methylene blue agar plates supplemented with streptomycin (2000 µg/mL) and colistin (2 µg/mL). The transconjugants acquiring the mcr-1 gene were confirmed by both PCR and antimicrobial susceptibility test. Incompatibility (Inc) groups were assigned by PBRT and the revised IncX typing procedure for the wild isolates and their transconjugants[3, 5, 42]. One pair of specific primers for amplification of the region between pir (replicon protein) and hns (DNA-binding protein) was designed to explore the genetic contexts of mcr-1 on IncX4 plasmids. Mcr-1-harbouring IncX4 plasmids with different genetic contexts were selected and then prepared from the transconjugants using the QIAGEN Plasmid Midi kit (QIAGEN) and were sequenced by Illumina MiSeq technique (Illumina, San Diego, USA). Illumina sequences were de novo assembled using SOAP de novo [43]. The gaps between the contigs were closed by PCR and respective amplicons were sequenced. Gene prediction and annotation were performed using the RAST tools[44]. To gain insights into the variations of IncX4 plasmids, sequence comparisons of the 30 completely-sequenced IncX4 plasmids (collected until July 18, 2016) were applied BLAST and Easyfig[45]. The variable regions of the other IncX4 plasmids without sequencing in this study were further analyzed by PCR-RFLP. The PCR products of the variable regions were purified and then digested with the following restriction enzymes (TaKaRa, Dalian, China): ClaI for Variable Region I, EcoRV for variable Region II, and HincII for Variable Region III. Comparison of PCR-RFLP patterns were performed with BioNumerics software version 2.5 (Applied Maths), and clusters were defined by cutoff of 100% similarity between DNA band patterns.

Nucleotide sequence accession numbers

The complete nucleotide sequences of pCSZ4, pFS170G and pPY1 have been deposited into GenBank database under the accession numbers KX711706, KX711707, and KX711708, respectively.

Ethics Statement

This study protocol was approved by the South China Agriculture University Animal ethics committee and carried out in accordance with relevant guidelines. The owners of the farm animals and companion animals from which faecal swabs were taken gave permission for their animals to be used in this study. Supplementary Materials
  41 in total

1.  Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae.

Authors:  Timothy J Johnson; Eliza M Bielak; Daniela Fortini; Lars Hestbjerg Hansen; Henrik Hasman; Chitrita Debroy; Lisa K Nolan; Alessandra Carattoli
Journal:  Plasmid       Date:  2012-03-26       Impact factor: 3.466

2.  Prevalence and diversity of IncX plasmids carrying fluoroquinolone and β-lactam resistance genes in Escherichia coli originating from diverse sources and geographical areas.

Authors:  Hana Dobiasova; Monika Dolejska
Journal:  J Antimicrob Chemother       Date:  2016-05-10       Impact factor: 5.790

3.  Complete sequence of pJIE143, a pir-type plasmid carrying ISEcp1-blaCTX-M-15 from an Escherichia coli ST131 isolate.

Authors:  Sally R Partridge; Justin A Ellem; Sasha G Tetu; Zhiyong Zong; Ian T Paulsen; Jonathan R Iredell
Journal:  Antimicrob Agents Chemother       Date:  2011-09-12       Impact factor: 5.191

4.  Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016.

Authors:  Basil Britto Xavier; Christine Lammens; Rohit Ruhal; Samir Kumar-Singh; Patrick Butaye; Herman Goossens; Surbhi Malhotra-Kumar
Journal:  Euro Surveill       Date:  2016-07-07

5.  Complete sequence of an IncFII plasmid harbouring the colistin resistance gene mcr-1 isolated from Belgian pig farms.

Authors:  B B Xavier; C Lammens; P Butaye; H Goossens; S Malhotra-Kumar
Journal:  J Antimicrob Chemother       Date:  2016-06-03       Impact factor: 5.790

6.  Location of colistin resistance gene mcr-1 in Enterobacteriaceae from livestock and meat.

Authors:  Kees Veldman; Alieda van Essen-Zandbergen; Michel Rapallini; Ben Wit; Raymond Heymans; Wilfrid van Pelt; Dik Mevius
Journal:  J Antimicrob Chemother       Date:  2016-05-30       Impact factor: 5.790

7.  Complete Nucleotide Sequence of an IncI2 Plasmid Coharboring blaCTX-M-55 and mcr-1.

Authors:  Jian Sun; Xing-Ping Li; Run-Shi Yang; Liang-Xing Fang; Wei Huo; Shu-Min Li; Peng Jiang; Xiao-Ping Liao; Ya-Hong Liu
Journal:  Antimicrob Agents Chemother       Date:  2016-07-22       Impact factor: 5.191

8.  A Model for Transposition of the Colistin Resistance Gene mcr-1 by ISApl1.

Authors:  Erik Snesrud; Susu He; Michael Chandler; John P Dekker; Alison B Hickman; Patrick McGann; Fred Dyda
Journal:  Antimicrob Agents Chemother       Date:  2016-10-21       Impact factor: 5.191

9.  Identification of plasmids by PCR-based replicon typing.

Authors:  Alessandra Carattoli; Alessia Bertini; Laura Villa; Vincenzo Falbo; Katie L Hopkins; E John Threlfall
Journal:  J Microbiol Methods       Date:  2005-06-02       Impact factor: 2.363

10.  SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler.

Authors:  Ruibang Luo; Binghang Liu; Yinlong Xie; Zhenyu Li; Weihua Huang; Jianying Yuan; Guangzhu He; Yanxiang Chen; Qi Pan; Yunjie Liu; Jingbo Tang; Gengxiong Wu; Hao Zhang; Yujian Shi; Yong Liu; Chang Yu; Bo Wang; Yao Lu; Changlei Han; David W Cheung; Siu-Ming Yiu; Shaoliang Peng; Zhu Xiaoqian; Guangming Liu; Xiangke Liao; Yingrui Li; Huanming Yang; Jian Wang; Tak-Wah Lam; Jun Wang
Journal:  Gigascience       Date:  2012-12-27       Impact factor: 6.524

View more
  39 in total

1.  Conjugal Transfer, Whole-Genome Sequencing, and Plasmid Analysis of Four mcr-1-Bearing Isolates from U.S. Patients.

Authors:  Wenming Zhu; Adrian Lawsin; Rebecca L Lindsey; Dhwani Batra; Kristen Knipe; Brian B Yoo; K Allison Perry; Lori A Rowe; David Lonsway; Maroya S Walters; J Kamile Rasheed; Alison Laufer Halpin
Journal:  Antimicrob Agents Chemother       Date:  2019-03-27       Impact factor: 5.191

2.  Genomic Insights into mcr-1-Positive Plasmids Carried by Colistin-Resistant Escherichia coli Isolates from Inpatients.

Authors:  Qingjing Wang; Jian Sun; Youfa Ding; Xing-Ping Li; Ya-Hong Liu; Youjun Feng
Journal:  Antimicrob Agents Chemother       Date:  2017-06-27       Impact factor: 5.191

3.  Heterogeneous Genetic Location of mcr-1 in Colistin-Resistant Escherichia coli Isolates from Humans and Retail Chicken Meat in Switzerland: Emergence of mcr-1-Carrying IncK2 Plasmids.

Authors:  Valentina Donà; Odette J Bernasconi; João Pires; Alexandra Collaud; Gudrun Overesch; Alban Ramette; Vincent Perreten; Andrea Endimiani
Journal:  Antimicrob Agents Chemother       Date:  2017-10-24       Impact factor: 5.191

4.  Promoter Variation and Gene Expression of mcr-1-Harboring Plasmids in Clinical Isolates of Escherichia coli and Klebsiella pneumoniae from a Chinese Hospital.

Authors:  Bin Huang; Yuting He; Xingyan Ma; Renxin Cai; Jianming Zeng; Yang Lu; Weizheng Zhang; Kai Lan; Sunmei E; Yi-Wei Tang; Barry N Kreiswirth; Cha Chen; Liang Chen
Journal:  Antimicrob Agents Chemother       Date:  2018-04-26       Impact factor: 5.191

5.  Genomic Characterization of Two Escherichia fergusonii Isolates Harboring mcr-1 Gene From Farm Environment.

Authors:  Ruishan Liu; Hao Xu; Xiaobing Guo; Shuxiu Liu; Jie Qiao; Haoyu Ge; Beiwen Zheng; Jianjun Gou
Journal:  Front Cell Infect Microbiol       Date:  2022-05-26       Impact factor: 6.073

6.  mcr-1-Mediated Colistin Resistance and Genomic Characterization of Antimicrobial Resistance in ESBL-Producing Salmonella Infantis Strains from a Broiler Meat Production Chain in Italy.

Authors:  Patrizia Casagrande Proietti; Laura Musa; Valentina Stefanetti; Massimiliano Orsini; Valeria Toppi; Raffaella Branciari; Francesca Blasi; Chiara Francesca Magistrali; Stefano Capomaccio; Tana Shtylla Kika; Maria Pia Franciosini
Journal:  Antibiotics (Basel)       Date:  2022-05-28

7.  Acquisition of mcr-1 and Cocarriage of Virulence Genes in Avian Pathogenic Escherichia coli Isolates from Municipal Wastewater Influents in Japan.

Authors:  Wataru Hayashi; Hayato Tanaka; Yui Taniguchi; Masaki Iimura; Eiji Soga; Ryoichi Kubo; Nao Matsuo; Kumiko Kawamura; Yoshichika Arakawa; Yukiko Nagano; Noriyuki Nagano
Journal:  Appl Environ Microbiol       Date:  2019-10-30       Impact factor: 4.792

8.  Fourteen mcr-1-Positive Salmonella enterica Isolates Recovered from Travelers Returning to the United States from the Dominican Republic.

Authors:  Hattie E Webb; Justin Y Kim; Kaitlin A Tagg; Curtis J Kapsak; Farrell Tobolowsky; Meseret G Birhane; Louise Francois Watkins; Jason P Folster
Journal:  Microbiol Resour Announc       Date:  2022-04-13

9.  Prevalence and Characteristics of mcr-1-Producing Escherichia coli in Three Kinds of Poultry in Changsha, China.

Authors:  Jufang Hu; Jie Yang; Wenxin Chen; Zhihong Liu; Qin Zhao; Hui Yang; Zhiliang Sun; Xiaojun Chen; Jiyun Li
Journal:  Front Microbiol       Date:  2022-04-07       Impact factor: 5.640

10.  Study of mcr-1 Gene-Mediated Colistin Resistance in Enterobacteriaceae Isolated from Humans and Animals in Different Countries.

Authors:  Linda Hadjadj; Toilhata Riziki; Yan Zhu; Jian Li; Seydina M Diene; Jean-Marc Rolain
Journal:  Genes (Basel)       Date:  2017-12-19       Impact factor: 4.096

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.