| Literature DB >> 28335091 |
Joo Hee Seo1,2, Jun Heon Lee3, Hong Sik Kong1.
Abstract
OBJECTIVE: This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC) and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers.Entities:
Keywords: Genetic Diversity; Korean Native Chicken; Microsatellite Marker; Phylogenetic Relationships; Polymorphism
Year: 2017 PMID: 28335091 PMCID: PMC5582319 DOI: 10.5713/ajas.16.0514
Source DB: PubMed Journal: Asian-Australas J Anim Sci ISSN: 1011-2367 Impact factor: 2.509
Description and distribution of chicken breeds used in the study
| Code | Breed | No. of chickens |
|---|---|---|
| HH | Hanhyup (Commercial line) | 181 |
| NC | Korean Native Chicken | 120 |
| LH | Leghorn | 48 |
| CS | Cornish | 48 |
| RIR | Rhode Island Red | 48 |
| Total | 445 |
Primer information for 20 selected microsatellite markers in the study
| No | Markers | Chr | Primer | Size | Dye | |
|---|---|---|---|---|---|---|
| 1 | ADL0259 | 9 | F | CTCATTGCAGAGGAAGTTCT | 107–147 | VIC |
| R | GTAATGGAGGATGCTCAGGT | |||||
| 2 | ADL0268 | 1 | F | CTCCACCCCTCTCAGAACTA | 105–117 | PET |
| R | CAACTTCCCATCTACCTACT | |||||
| 3 | ADL0292 | 5 | F | CCAAATCAGGCAAAACTTCT | 110–140 | FAM |
| R | AAATGGCCTAAGGATGAGGA | |||||
| 4 | ADL0293 | 17 | F | GTAATCTAGAAACCCCATCT | 107–127 | PET |
| R | ACATACCGCAGTCTTTGTTC | |||||
| 5 | ADL0304 | 18 | F | GGGGAGGAACTCTGGAAATG | 138–162 | FAM |
| R | CCTCATGCTTCGTGCTTTTT | |||||
| 6 | ADL0317 | 4 | F | AGTTGGTTTCAGCCATCCAT | 178–204 | FAM |
| R | CCCAGAGCACACTGTCACTG | |||||
| 7 | GCT0016 | 9 | F | TCCAAGGTTCTCCAGTTC | 108–168 | NED |
| R | GGCATAAGGATAGCAACAG | |||||
| 8 | LEI0074 | 26 | F | GACCTGGTCCTGACATGGGTG | 132–244 | VIC |
| R | GTTTGCTGATTAGCCATCGCG | |||||
| 9 | LEI0094 | 4 | F | GATCTCACCAGTATGAGCTGC | 232–282 | FAM |
| R | TCTCACACTGTAACACAGTGC | |||||
| 10 | LEI0141 | 2 | F | CGCATTTGATGCATAACACATG | 218–244 | FAM |
| R | AAGGCAAACTCAGCTGGAACG | |||||
| 11 | MCW0029 | 5 | F | GTGGACACCCATTTGTACCCTATG | 131–187 | VIC |
| R | CATGCAATTCAGGACCGTGCA | |||||
| 12 | MCW0063 | 2 | F | GGCTCCAAAAGCTTGTTCTTAGCT | 128–150 | FAM |
| R | GAAAACCAGTAAAGCTTCTTAC | |||||
| 13 | MCW0087 | 2 | F | ATTTCTGCAGCCAACTTGGAG | 265–289 | NED |
| R | CTCAGGCAGTTCTCAAGAACA | |||||
| 14 | MCW0104 | 13 | F | TAGCACAACTCAAGCTGTGAG | 192–232 | PET |
| R | AGACTTGCACAGCTGTGTACC | |||||
| 15 | MCW0127 | 3 | F | GAGTTCAGCAGGAATGGGATG | 226–274 | VIC |
| R | TGCAATAAGAGAAGGTAAGGTC | |||||
| 16 | MCW0145 | 1 | F | ACTTTATTCTCCAAATTTGGCT | 178–214 | FAM |
| R | AAACACAATGGCAACGGAAAC | |||||
| 17 | MCW0228 | 10 | F | GATCTCTGCATTACAAGCATG | 220–248 | PET |
| R | TTGCTGACCTGCTCATGCAAG | |||||
| 18 | MCW0264 | 2 | F | CTTACTTTTCACGACAGAAGC | 225–243 | FAM |
| R | AGACTGAGTCACACTCGTAAG | |||||
| 19 | ROS0013 | 5 | F | TGCTGCTCCTGGRAAATTG | 220–262 | NED |
| R | GAAAAGCCATGGAGGAATCA | |||||
| 20 | ROS0083 | 13 | F | CATTACAGCTCAGTGTTGGCA | 108–130 | VIC |
| R | TTGCAAGTGCTCTCCCATC | |||||
The statistical analysis of heterozygosity (Hobs and Hexp), polymorphism information content (PIC), and F-statistics value using selected 20 microsatellite markers among 5 chicken breeds
| Locus | No. of alleles | Hobs | Hexp | PIC | |||
|---|---|---|---|---|---|---|---|
| ADL0259 | 14 | 0.675 | 0.874 | 0.862 | 0.081 | 0.223 | 0.156 |
| ADL0268 | 5 | 0.516 | 0.762 | 0.725 | 0.117 | 0.310 | 0.215 |
| ADL0292 | 11 | 0.562 | 0.751 | 0.714 | 0.152 | 0.267 | 0.137 |
| ADL0293 | 10 | 0.497 | 0.778 | 0.745 | 0.139 | 0.360 | 0.256 |
| ADL0304 | 9 | 0.488 | 0.784 | 0.753 | 0.092 | 0.375 | 0.308 |
| ADL0317 | 11 | 0.611 | 0.834 | 0.814 | 0.143 | 0.272 | 0.152 |
| GCT0016 | 12 | 0.349 | 0.806 | 0.78 | 0.182 | 0.551 | 0.442 |
| LEI0074 | 13 | 0.525 | 0.84 | 0.82 | 0.053 | 0.362 | 0.323 |
| LEI0094 | 18 | 0.597 | 0.831 | 0.81 | 0.06 | 0.283 | 0.236 |
| LEI0141 | 14 | 0.466 | 0.851 | 0.832 | 0.087 | 0.440 | 0.384 |
| MCW0029 | 15 | 0.673 | 0.857 | 0.843 | 0.111 | 0.210 | 0.111 |
| MCW0063 | 11 | 0.577 | 0.763 | 0.731 | 0.128 | 0.248 | 0.136 |
| MCW0087 | 14 | 0.555 | 0.878 | 0.865 | 0.055 | 0.365 | 0.328 |
| MCW0104 | 17 | 0.631 | 0.878 | 0.866 | 0.125 | 0.275 | 0.171 |
| MCW0127 | 20 | 0.595 | 0.863 | 0.848 | 0.093 | 0.327 | 0.259 |
| MCW0145 | 11 | 0.683 | 0.841 | 0.821 | 0.048 | 0.200 | 0.160 |
| MCW0228 | 12 | 0.585 | 0.796 | 0.769 | 0.108 | 0.273 | 0.191 |
| MCW0264 | 9 | 0.596 | 0.824 | 0.803 | 0.097 | 0.284 | 0.207 |
| ROS0013 | 16 | 0.62 | 0.837 | 0.817 | 0.075 | 0.259 | 0.197 |
| ROS0083 | 8 | 0.551 | 0.742 | 0.708 | 0.094 | 0.276 | 0.202 |
| Total/mean | 250/12.5 | 0.568 | 0.820 | 0.7963 | 0.102 | 0.308 | 0.229 |
Hobs, observed heterozygosity; Hexp, expected heterozygosity; Fst, genetic distance; Fit, total inbreeding; Fis, within inbreeding.
Mean number of alleles (MNA), heterozygosity (Hobs and Hexp), and polymorphism information content (PIC) observed across 20 microsatellite loci for each population
| Population | MNA | Hobs | Hexp | PIC |
|---|---|---|---|---|
| HH | 9.90 | 0.612 | 0.785 | 0.755 |
| NC | 10.05 | 0.630 | 0.796 | 0.767 |
| LH | 5.35 | 0.420 | 0.586 | 0.537 |
| CS | 6.50 | 0.494 | 0.721 | 0.674 |
| RIR | 4.40 | 0.464 | 0.580 | 0.520l |
| Mean | 7.240 | 0.524 | 0.694 | 0.650 |
Hobs, observed heterozygosity; Hexp, expected heterozygosity; HH, Hanhyup (Commercial line); RIR, Rhode Island Red; LH, Leghorn; CS, Cornish; NC, Korean Native Chicken.
DA genetic distance matrix estimated from the frequencies of 20 microsatellite loci among the five chicken breeds
| Population | HH | RIR | LH | CS | NC |
|---|---|---|---|---|---|
| HH | - | ||||
| RIR | 0.301 | - | |||
| LH | 0.434 | 0.545 | - | ||
| CS | 0.190 | 0.396 | 0.421 | - | |
| NC | 0.131 | 0.337 | 0.403 | 0.203 | - |
HH, Hanhyup (Commercial line); RIR, Rhode Island Red; LH, Leghorn; CS, Cornish; NC, Korean native chicken.
Figure 1Neighbour-joining tree of genetic relationship among 5 chicken population using D genetic distance based on 20 microsatellite loci. The numbers on the nodes are percentage bootstrap in 1,000 replications. HH, Hanhyup (Commercial line); RIR, Rhode Island Red; LH, Leghorn; CS, Cornish; NC, Korean native chicken.
Figure 2Principal coordinates analysis (PCoA) of allele frequencies from 20 microsatellite markers typed in five populations using GenAlEx. HH, Hanhyup (Commercial line); RIR, Rhode Island Red; LH, Leghorn; CS, Cornish; NC, Korean native chicken.
Figure 3Correspondence analysis of allele frequencies from 20 MS markers typed in 5 populations using Genetix405 (White, Leghorn; Blue, Rhode Island Red; Pink, Korean native chicken; Yellow, Hanhyup (Commercial line); Gray, Cornish).
Proportion of membership of the studied breeds to the 5 detected clusters using the STRUCTURE program (ver. 2.3.4) (500 burn-in period/1,000 Reps)
| Population1) | 1 cluster | 2 cluster | 3 cluster | 4 cluster | 5 cluster | No. of sample |
|---|---|---|---|---|---|---|
| HH | 0.582 | 0.004 | 0.009 | 0.392 | 0.014 | 181 |
| RIR | 0.004 | 0.002 | 0.003 | 0.009 | 0.981 | 48 |
| LH | 0.003 | 0.987 | 0.003 | 0.003 | 0.004 | 48 |
| CS | 0.368 | 0.026 | 0.578 | 0.017 | 0.011 | 48 |
| NC | 0.047 | 0.015 | 0.884 | 0.038 | 0.017 | 120 |
HH, Hanhyup (Commercial line); RIR, Rhode Island Red; LH, Leghorn; CS, Cornish; NC, Korean native chicken.
The expected probability of identity values among genotypes of random individuals (PI), random half-sib (PIhalf-sibs) and random sibs (PIsibs) for discrimination of chicken lines using 10, 15 and 20 markers
| Marker | PI | PIhalf-sibs | PIsibs |
|---|---|---|---|
| Marker10 | 2.92×10−31 | 2.46×10−20 | 1.12×10−6 |
| Marker15 | 7.60×10−46 | 9.06×10−30 | 1.23×10−9 |
| Marker20 | 3.88×10−60 | 4.86×10−39 | 1.38×10−12 |