Literature DB >> 28330839

Evolutionary insights into T-type Ca2+ channel structure, function, and ion selectivity from the Trichoplax adhaerens homologue.

Carolyn L Smith1, Salsabil Abdallah2, Yuen Yan Wong2, Phuong Le2, Alicia N Harracksingh2, Liana Artinian3, Arianna N Tamvacakis3, Vincent Rehder3, Thomas S Reese1, Adriano Senatore4.   

Abstract

Four-domain voltage-gated Ca2+ (Cav) channels play fundamental roles in the nervous system, but little is known about when or how their unique properties and cellular roles evolved. Of the three types of metazoan Cav channels, Cav1 (L-type), Cav2 (P/Q-, N- and R-type) and Cav3 (T-type), Cav3 channels are optimized for regulating cellular excitability because of their fast kinetics and low activation voltages. These same properties permit Cav3 channels to drive low-threshold exocytosis in select neurons and neurosecretory cells. Here, we characterize the single T-type calcium channel from Trichoplax adhaerens (TCav3), an early diverging animal that lacks muscle, neurons, and synapses. Co-immunolocalization using antibodies against TCav3 and neurosecretory cell marker complexin labeled gland cells, which are hypothesized to play roles in paracrine signaling. Cloning and in vitro expression of TCav3 reveals that, despite roughly 600 million years of divergence from other T-type channels, it bears the defining structural and biophysical features of the Cav3 family. We also characterize the channel's cation permeation properties and find that its pore is less selective for Ca2+ over Na+ compared with the human homologue Cav3.1, yet it exhibits a similar potent block of inward Na+ current by low external Ca2+ concentrations (i.e., the Ca2+ block effect). A comparison of the permeability features of TCav3 with other cloned channels suggests that Ca2+ block is a locus of evolutionary change in T-type channel cation permeation properties and that mammalian channels distinguish themselves from invertebrate ones by bearing both stronger Ca2+ block and higher Ca2+ selectivity. TCav3 is the most divergent metazoan T-type calcium channel and thus provides an evolutionary perspective on Cav3 channel structure-function properties, ion selectivity, and cellular physiology.
© 2017 Smith et al.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28330839      PMCID: PMC5379919          DOI: 10.1085/jgp.201611683

Source DB:  PubMed          Journal:  J Gen Physiol        ISSN: 0022-1295            Impact factor:   4.086


Introduction

Voltage-gated calcium (Cav) channels play fundamental roles in the physiology of neurons and muscle, by coupling electrical signals carried largely by voltage-gated sodium (Nav) and potassium (Kv) channels, with intracellular Ca2+-dependent processes (Clapham, 2007). Of the three classes of Cav channels, L-type/Cav1 channels are central for excitation-contraction coupling in muscle and excitation-transcription coupling in neurons and muscle, whereas N- and P-/Q-type (i.e., Cav2) channels are central for fast presynaptic excitation-secretion coupling (Catterall, 2011). T-type/Cav3 channels serve less obvious functions (Perez-Reyes, 2003; Senatore et al., 2012), but one clear contribution is their role in regulating cellular excitability, where their low voltages of activation and fast kinetics permit rapid depolarizing Ca2+ currents below the action potential threshold. T-type channels also play roles in driving low threshold exocytosis in both vertebrates and invertebrates, and in mammals have been shown to directly interact with presynaptic components of the vesicular SNARE complex (Weiss et al., 2012; Weiss and Zamponi, 2013). Notably, recent genomic studies indicate that T-type channels, and in fact the majority of genes with important roles in the nervous system, are present in primitive animals that lack nervous systems and single-celled organisms that predate animals (King et al., 2008; Srivastava et al., 2008, 2010; Steinmetz et al., 2012; Moran et al., 2015; Moroz and Kohn, 2015). We know little, however, about the function and properties of these extant gene homologues or about the functional or proteomic adaptations that were required to incorporate their primordial counterparts into nervous system function. One very intriguing early diverging animal is Trichoplax adhaerens (phylum Placozoa), which has only six cell types and lacks synaptically connected neurons and muscle (Schierwater, 2005; Smith et al., 2014). Despite these absences, Trichoplax is able to coordinate motile behavior such as feeding (Smith et al., 2015), chemotaxis, and phototaxis (Heyland et al., 2014), indicative of trans-cellular signaling and communication independent of both chemical and electrical synapses. Given that Cav channels play crucial roles in both intra- and intercellular signaling, it is intriguing that the Trichoplax genome bears a full complement of Cav channel genes: Cav1, Cav2, and Cav3 (Srivastava et al., 2008). Here, we sought to characterize the molecular properties of the most basal metazoan homologue of T-type channels from T. adhaerens. Co-immunolocalization of the channel, named TCav3, with neurosecretory cell marker complexin labeled gland cells, shown previously to resemble neurosecretory cells in their expression of SNARE proteins and the presence of membrane-apposed vesicles (Syed and Schierwater, 2002; Smith et al., 2014). We cloned and in vitro expressed TCav3, finding that despite its ancient divergence, it bears the hallmark structural and biophysical features of T-type channels, including a low voltage of activation, rapid and transient kinetics, and an apparent Ca2+ window current near resting membrane potential. We also characterized the permeation properties of TCav3, finding that the channel conducts moderately mixed inward Ca2+-Na+ currents, with a majority of current carried by Ca2+, similar to mammalian homologues (Shcheglovitov et al., 2007). Paradoxically, measuring Ca2+ over Na+ selectivity using bi-ionic reversal potential analysis (i.e., where inward Ca2+ ions compete with outward Na+ for permeation), revealed poor Ca2+ versus Na+ selectivity compared with human Cav3.1, similar to the cloned T-type channel from invertebrate snail Lymnaea stagnalis (Senatore and Spafford, 2010; Senatore et al., 2014). We attribute the relatively low Na+ permeation through TCav3, in spite of its poor Ca2+ over Na+ selectivity, to retention of a potent Ca2+ block. Based on comparative data, we suggest that Ca2+ block is more crucial for determining the degree of Na+ that permeates alongside Ca2+ compared with pore selectivity and is a locus for evolutionary change in T-type channel cation permeability.

Materials and methods

Cloning of the TCav3 channel cDNA

Two cDNA libraries were made from Trichoplax whole-animal total RNA, one with an anchored oligo-dT18 primer, for PCR amplification and cloning of the C-terminal half of TCav3, and the other with a primer targeting a central region of the TCav3 coding sequence, for cloning the N terminus (Table 1). The TCav3 N- and C-terminal coding sequences were then independently amplified three times from the cDNA, via nested PCR using Pfu Turbo DNA polymerase (Agilent Technologies), with nested N- and C-terminal primer pairs containing NheI–XhoI and XhoI–XmaI sites, respectively. The nested NT primer (TCav3 NT 5′2) also contained a mammalian Kozak translation initiation site (Kozak, 1986; i.e., 5′-GCCACC-3′; Table 1) for effective expression of the TCav3 channel protein in mammalian cells. PCR-amplified DNA fragments were subcloned into pIRES2-IR–enhanced green fluorescent protein (EGFP), sequenced, and compared with each other plus the Trichoplax genome (JGI Genome Portal, Grell-BS-1999 v1.0, scaffold_2:6781672-6793175) to generate a consensus coding sequence. The full-length TCav3 clone was then prepared by inserting the XhoI–XmaI C-terminal subclone into the pIRES2 vector bearing the N-terminal TCav3 fragment, producing pTCav3-IR-EGFP. The full-length consensus coding sequence of TCav3 was submitted to GenBank (accession no. KJ466205).
Table 1.

Sequence of primers used for cloning TCav3 cDNA and semiquantitative RT-PCR

PrimerSequence (5′ to 3′)
TCav3 NT cDNACTTTAGGTAGTATGAGCAAGGAATG
TCav3 CT cDNATTTTTTTTTTTTTTTTTTVN
TCav3 NT 5′1TGATGTTTTATTCAAGTCATGC
TCav3 NT 5′2TACTTAGCTAGCCGCGGGAGCCACCATGGATATTTCGTTCGCTATCAT
TCav3 NT 3′1CATCAGGCGTCTTAACTTTGC
TCav3 NT 3′2TGCTCTGTGGTGGATCTCGAG
TCav3 CT 3′1CTTGATATTGATTAAATTTATCCAGATG
TCav3 CT 3′2ACTCATCCCGGGTTATACTAATGTTTGAATCAT
TCav3 CT 5′1AAATCTGGTAGATCCTAATGAAGTC
TCav3 CT 5′2TCGCGTTCCAATTGGTCCTCGAG
TCav1_FAGTCTTTACCGATTTGGCTCTTCTTTG
TCav1_RCAATTATACGACTGACACTCTTTCAAAGC
TCav2_FCGTTTACAAAAGTCTGGATCAAGTTGCG
TCav2_RCTGCTGTACATTTTGATATGTTAGTAAGATCATCTG
TCav3_FGTAGAAGATCAGATGGAATTAACGGCTTCC
TCav3_RTACTAATGTTTGAATCATTTTTCGAGGTAATGTGACC
TCavβ_FAGTAATAAATTCTCAGGATTAGTGGAAGTGTCC
TCavβ_RAACATCATTACGTTTTATTACTAGAGGATCTTG
TCavα2δ-a_FCTCAAGCAGTGGACTAACTAAACTTTACC
TCavα2δ-a_RCATAGCTGGTTATATGTCACAAATTCCTCTC
TCavα2δ-b_FTTTACCACATCCTTCTTCAGCTTCTTGAC
TCavα2δ-b_RAGCATACACTGATAGCTTTACATAGCG
TCavα2δ-c_FGATATTCGAAATTTCGAATGATACCCTTTGC
TCavα2δ-c-RCAACGCGAGAAGTAGAAGTGTCCG

Translation start and stop codons are in bold, and the Kozak sequences and restriction enzyme sites used for cloning are underlined.

Translation start and stop codons are in bold, and the Kozak sequences and restriction enzyme sites used for cloning are underlined.

Reverse transcription (RT)–PCR amplification of Trichoplax Cav channel and accessory subunit mRNAs

The Trichoplax genome encodes single gene homologues for each of the three metazoan Cav channel types (Cav1, Cav2, and Cav3; NCBI accession nos. XM_002108894.1, XM_002109739.1, and KJ466205, respectively), as well as a single Cavβ accessory subunit gene (XM_002110305.1) and three Cavα2δ Cav1/Cav2 accessory subunit genes (Cavα2δa, Cavα2δb, and Cavα2δc; NCBI accession nos. XM_002112625.1, XM_002112621.1, and XM_002111347.1). Primers were designed to amplify ∼500-bp cDNA fragments of each of these genes by RT–PCR (Table 1), using a cDNA library prepared by RT (SuperScript III Reverse Transcription; Thermo Fisher Scientific) with an anchored oligo-dT18 primer (Table 1) and whole-animal total RNA. PCR amplification was achieved in 25-µl reactions each containing 1.25 µl of 10 µM forward and reverse primers (Table 1); 0.125 µl of Taq DNA polymerase and 2.5 µl of corresponding 10× buffer (New England Biolabs, Inc.); 1 µl of 25 mM MgCl2; 0.5 µl of 10 mM dNTP mix (New England Biolabs, Inc.); and 0.5 µl of cDNA template. Thermocycling conditions were 95°C for 2 min, 30 cycles of 94°C for 1 min, 59°C for 45 s, and 72°C for 1 min, and a final 10-min extension at 72°C.

Phylogenetic inference

Maximum likelihood (ML) phylogeny of various Cav channels was inferred from a MUSCLE-alignment of select channel protein sequences (Edgar, 2004), generated with the program MEGA7 (Kumar et al., 2016). Alignments were timed with trimAl (Capella-Gutiérrez et al., 2009), followed by some minor manual trimming to remove highly heterogeneous regions (raw sequences and the trimmed alignment are provided in FASTA format as Supplementary Files 1 and 2, respectively). ML model selection was achieved with MEGA7, revealing that the LG+G model was most suitable under both the corrected Akaike’s information criterion (AICc) and the Bayesian information criterion (BIC). The ML phylogenetic tree presented in Fig. 1 B was thus inferred from the trimmed alignment using the LG+G model, with 1,000 bootstrap replicates to generate node support values. Protein accession numbers used in the analysis are as follows: Amphimedon Cav1/Cav2, Aqu2.38198_001 from published transcriptome (Fernandez-Valverde et al., 2015); Salpingoeca Cav1/Cav2, XP_004989719.1; Salpingoeca Cav3, XP_004995501.1; Trichoplax Cav1 and Cav2, unpublished transcriptome; Trichoplax Cav3, KJ466205; Nematostella Cav1, XP_001639054.1; Nematostella Cav2a, Cav2b, and Cav2c, NVE4667, NVE18768, and NVE1263, respectively, from published transcriptome (Fredman et al., 2013); Nematostella Cav3a and Cav3b, NVE5017 and NVE7616, respectively, from published transcriptome (Fredman et al., 2013); Caenorhabditis elegans Cav1 (egl-19), NP_001023079.1; C. elegans Cav2 (unc-2), NP_001123176.1; C. elegans Cav3 (cca-1), CCD68017.1; Drosophila Cav1 (α1-D), AAF53504.1; Drosophila Cav2 (cacophony), AFH07350.1; Drosophila Cav3 (Ca-α1T), ABW09342.1; Lymnaea Cav1, AAO83839.1; Lymnaea Cav2, AAO83841.1; Lymnaea Cav3, AAO83843.2; human Cav1.1, NP_000060.2; human Cav1.2, Q13936.4; human Cav1.3, NP_001122312.1; human Cav1.4, NP_005174.2; human Cav2.1, O00555.2; human Cav2.2, NP_000709.1; human Cav2.3, NP_001192222.1; human Cav3.1, NP_061496.2; human Cav3.2, NP_066921.2; human Cav3.3, NP_066919.2; Mnemiopsis Cav2, fragmented transcriptome sequences manually pieced together from published transcriptome (Ryan et al., 2013); Hormiphora Cav2, sequence extracted from a de novo assembly of RNA-Seq data (SRR1992642; Francis et al., 2015); Chlamydomonas CAV2, XP_001701475.1; Schizosaccharomyces pombe CCH1, NP_593894.1; and Saccharomyces cerevisiae CCH1, NP_011733.3.
Figure 1.

Hydropathy profile of TCa (A) The in silico–translated protein sequence of TCav3 produces hydrophobic peaks on a Kyte–Doolittle hydrophobicity plot corresponding to six transmembrane helices (S1–S6) present in each of four homologous domains (I–IV), conforming to the characteristic structure of four-domain channels. The vertical green bar illustrates the location of the peptide epitope used to generate polyclonal anti-TCav3 antibodies. (B) Protein phylogeny of various Cav channels, inferred by ML using the LG+G model. Node support values resulting from 1,000 bootstrap replicates are indicated, and the scale bar indicates the number of amino acid substitutions per site.

Immunostaining and confocal microscopy

Trichoplax were frozen and freeze-substituted as described previously (Smith et al., 2014) with the following modifications. Coverslips (22 mm square, #1.5 thickness; ZEISS) were cleaned in nitric acid and treated with 3-aminopropyltriethoxysilane (#A3648; Sigma-Aldrich) to produce a positively charged surface. Trichoplax were transferred to a 500-µl drop of artificial seawater (ASW) placed in the center of the coverslips and left to adhere for 1–2 h. 300 µl of the ASW was removed and replaced with 500 µl of a 1:1 mixture of ASW and 1 M mannitol. After ∼5 min, the liquid was removed, and the coverslips were plunged into tetrahydrofuran at −80°C on dry ice and kept overnight. The coverslips were transferred to methanol with 1.6% paraformaldehyde on dry ice and then held at −20°C for 2–3 h and room temperature for 2 h. The specimens were rinsed in 100% ethanol (EtOH) and rehydrated gradually with 90%, 70%, and 50% EtOH (diluted with PBS) and PBS each for ∼10 min and blocking buffer (BB: 3% normal goat serum, 2% horse serum, 1% BSA in PBS) for 15 min. Then specimens were incubated in custom (Thermo Fisher Scientific) antiserum against the epitope ESRVNGNAKFTSDDQRLDR corresponding to the middle of the TCav3 I–II cytoplasmic linker (Fig. 1 A) or, to control for specificity, serum from the same rabbit before immunization both diluted 1:400 in BB overnight at 4°C. A custom (New England Peptide) chicken antibody against the epitope EATAPKKDSSKSNFSSR, found in the Trichoplax complexin protein, was added in some experiments to mark neurosecretory cells. After washing in PBS, the coverslips were incubated with Atto 488 goat anti–rabbit IgG (62197; Sigma-Aldrich) with/without Alexa Fluor 647 goat anti–chicken IgY (A-21449; Thermo Fisher Scientific) diluted 1:500 in BB for 2 h at room temperature. Nuclei were stained with Hoechst. Images of immunostaining in Trichoplax were captured on an LSM 880 confocal microscope (ZEISS) with a 63× 1.4-N.A. PlanApo objective and 488-nm illumination for Atto 488 and 405-nm for Hoechst. Overview image stacks (17 images, 0.7-µm interval) were captured with a Quasar spectral detector with emission windows at 415–480 nm (blue) and 490–588 nm (green). Enhanced resolution image stacks (36 images, 0.185-µm interval) were collected with an Airyscan detector and 420–480- and 495–550-nm filters. Image stacks were displayed as maximum-intensity projections.

Immunodetection of TCav3 on Western blots

Trichoplax whole-animal protein lysates were prepared from ∼30 specimens and lysed directly in 200 µl of reducing sample buffer preheated to 95°C (50 mM dithiothreitol, 1% wt/vol SDS, 7.5% glycerol, 0.003% bromophenol blue, and 40 mM Tris pH 6.8). Protein lysates from ectopically expressed TCav3 channels in HEK-293T cells were prepared as follows. The entire coding sequence of TCav3 was excised from the pTCav3-IR-EGFP vector with restriction enzymes SacII and XmaI and cloned into pEGFP-C1 with the same sites (Takara Bio Inc.). The resulting plasmid pEGFP-TCav3, pTCav3-IR-EGFP, or the empty fusion vector pEGFP-C1 was cotransfected into HEK cells with rat Cavβ1b and Cavα2δ1 subunits (as outlined in the culturing and transfection section of the Materials and methods below), and cells were incubated at 28°C for 4–5 d and then briefly washed with warm PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, pH 7.4). Cells were then lysed with 600 µl of sample buffer (50 mM dithiothreitol, 1% wt/vol SDS, 7.5% glycerol, 0.003% bromophenol blue, and 40 mM Tris, pH 6.8). Equal volumes for each lysate were loaded on either freshly prepared 7.5% polyacrylamide gels or precast 4–20% polyacrylamide gradient gels (Invitrogen), and electrophoresis was performed in Invitrogen MES buffer using an XCell SureLock Mini-Cell Electrophoresis System (Invitrogen). For each experiment, paired gels were run: one was subjected to Coomassie staining to confirm equal protein content among samples, whereas the other was transferred to a nitrocellulose membrane using a Tris-glycine transfer buffer (25 mM Tris, 192 mM glycine, 20% vol/vol methanol, and 0.5% SDS, pH 8.3). Western blots performed using custom anti-TCav3 antibodies (rabbit polyclonal; Thermo Fisher Scientific) were done using (a) unpurified antibodies (terminal bleed serum, 1:1,000 dilution); (b) preimmune serum (1:1,000 dilution); or (c) affinity-purified antibodies (isolated by the manufacturer using a conjugated antigen peptide, 1:500 dilution). Western blots against EGFP epitopes (as an N-terminal fusion with TCav3 or alone) were performed using a rabbit polyclonal anti-GFP antibody (Sigma-Aldrich) at 1:5,000 dilution. Primary antibody incubations were performed overnight at 4°C, and secondary antibody incubations, washing, and detection were performed using standard chemiluminescent methods.

Culturing and transfection of HEK-293T cells with TCav3 cDNAs

The detailed methods used for culture and CaPO4 transfection of cloned Cav3 channels into HEK-293T cells, as well as techniques for whole-cell patch-clamp electrophysiology, have been previously documented in detail (Senatore et al., 2011, 2014; Senatore and Spafford, 2012). In brief, for electrophysiological experiments of in vitro–expressed TCav3, 6 µg of the pTCav3-IR-EGFP construct was transfected into HEK cells in 6-ml flasks, along with 3 µg of high voltage–activated calcium channel rat Cavβ1b and Cavα2δ1 subunit cDNAs cloned into mammalian expression vector pMT2 (Tomlinson et al., 1993). These Cav1/Cav2 subunits have been shown to not interact with or alter the biophysical properties of heterologously expressed mammalian and invertebrate T-type channels (Dubel et al., 2004; Dawson et al., 2014), but nevertheless boost membrane expression by some unknown mechanism (Dubel et al., 2004). CaPO4 transfections were done overnight at 37°C, after which cells were washed and transferred to 28°C for 2–3 d before recording. On the day of recording, cells were trypsinized (Sigma-Aldrich) and plated onto glass coverslips, which were then transferred into 2-ml culture dishes with appropriate extracellular recoding solutions. For experiments involving the quantification of EGFP fluorescence in transfected HEK cells, transfections were performed in quadruplicate, with 6 µg pTCav3-IR-EGFP, pEGFP-TCav3, or pEGFP-C1 cotransfected with 3-µg combinations of rat Cavβ1b and Cavα2δ1 subunits or the empty mammalian expression vector pCDNA 3.1. After incubation at 28°C for 3 d, the cells were imaged with transmitted and fluorescent light at 100 magnification, using a ZEISS AxioCam MRm Rev3 camera mounted on an AxioObserver A1 inverted microscope. All flasks were imaged with the same exposure settings, ensuring that the brightest cells did not saturate the pixels during acquisition with ZEN Lite software (ZEISS). Integrated density of the acquired fluorescence images was measured using the ImageJ software (Schneider et al., 2012), and values were normalized against the highest value for each replicate set, averaged, and plotted.

Patch-clamp electrophysiology

We used previously documented electrophysiological recording solutions to characterize the biophysical properties of TCav3 in 2 mM Ca2+ saline (Figs. 7 and 8; Senatore and Spafford, 2012), assess the Ni2+ block (Fig. 9; Senatore and Spafford, 2010), compare Ca2+ versus Ba2+ conductance (Fig. 10, C and D; Senatore and Spafford, 2012), and assess divalent versus monovalent cation selectivity and permeability features (Fig. 10, A, B, E, and F; Figs. 11 and 12; and Fig. S3; Senatore et al., 2014). Whole-cell patch voltage clamp recordings were performed using an Axopatch 200B amplifier and a Digidata 1440A digitizer controlled with pCLAMP 10 software (Molecular Devices). Pipettes were pulled using a Sutter P-97 micropipette puller and heat polished such that pipette resistance in the bath ranged from 2 to 5 MΩ, with access resistance after membrane breakthrough between 4 and 10 MΩ. Series resistance was not compensated for because we only kept data with minimal access resistance and tight capacitive transients upon voltage step. Only recordings in which leak current was <10% of the peak inward current were used, and offline leak subtraction was done using Clampfit software (Molecular Devices). Methods for Boltzmann transformation and curve fitting of electrophysiological data are described in previous publications (Senatore and Spafford, 2010, 2012). Relative permeabilities under bi-ionic conditions for TCav3 (i.e., PCa/PX, where X = Li+, Na+, K+, or Cs+) were calculated using the bi-ionic Nernst equation (Hille, 2001) as described previously (Senatore et al., 2014). Statistical analyses comparing electrophysiology data for TCav3 with data from other in vitro–expressed channels were done using one-way analysis of variance (ANOVA); p-values are presented in Table 2, where we provide citations for data from other studies.
Figure 7.

Activation and inactivation properties of TCa (A) Sample traces of recorded Ca2+ currents conducted by the TCav3 channel ectopically expressed in HEK-293T cells, in response to depolarizing voltage steps from −110 mV to between −90 and 40 mV. The scale base below the current traces reflects time in milliseconds and current amplitude in picoamperes. (B) Plot of mean peak current for different depolarizing voltages, relative to the maximal peak inward current (i.e., an IV plot), reveals a maximal peak inward current at −45 mV, indicating a low voltage of activation for TCav3. (C) Plot of mean voltage dependence for channel activation (filled black squares, conductance G/Gmax) and steady-state inactivation (white circles, I/Imax) reveals the presence of a window current for TCav3 (red fill). The inset shows the voltage protocol used to measure steady-state inactivation and sample elicited currents. (D) Mean τ values for mono-exponential curves fitted over the activation and inactivation phases of TCav3 macroscopic current waveforms reveals acceleration of channel kinetics upon stronger depolarization, measured as τact and τinact, respectively. (E) TCav3 is at the lower end of the scale with respect to acceleration of kinetics from −50 to −10 mV, with less pronounced fold decreases in τact and τinact compared with other in vitro–expressed channels, indicative of attenuated voltage dependency for activation and inactivation kinetics. Error bars indicate SE.

Figure 8.

Recovery from inactivation and deactivation properties of TCa (A) Illustration of the voltage protocol (top) used to measure recovery from inactivation for TCav3. A 1-s inactivating voltage pulse from −110 to −35 mV was followed by increasing interpulse interval durations of hyperpolarization at −110 mV to remove inactivation, followed by a short test pulse to −35 mV to record recovered peak inward Ca2+ current (sample traces, bottom). (B) Mean recovery from inactivation for TCav3 Ca2+ currents in HEK-293T cells, measured relative to the maximal peak inward current (I/Imax). A mono-exponential curve fitted over the data produces a τ time constant for recovered current (τrecov) of 1,275 ± 54 ms. (C) Sample traces of TCav3 deactivation currents resulting from rapid membrane repolarization to different deactivating potentials while channels are fully open. The inset illustrates the voltage protocol used for deactivation. (D) τ values (τdeact) for mono-exponential curve fitted over decaying inward currents at different deactivating voltages. Scale bars indicate time (milliseconds) and current amplitude (picoamperes). Plotted values in B and D represent mean ± SE.

Figure 9.

Ni (A) Alignment of the domain I S3–S4 extracellular loop of various T-type channels, showing the presence of a key histidine residue in vertebrate (human) Cav3.2 associated with high sensitivity to Ni2+ block (His-191). Drosophila Ca-α1T is also highly Ni2+ sensitive and contains a histidine residue in this same loop 2 aa upstream of Cav3.2 His-191. (B) Sample peak Ca2+ currents through TCav3 resulting from increased concentrations of externally perfused Ni2+. Applied Ni2+ concentrations, micromolar, are depicted on the left of the current waveforms. (C) Plot of sequential peak current responses of TCav3 as depicted in B resulting from the application of increasing concentrations of Ni2+ (mean ± SE; n = 9). Note the rapid washout of Ni2+ current inhibition and a transient augmented peak current the first few steps after washout. (D) Cumulative dose–response curve of TCav3 Ni2+ block, revealing an IC50 value of 335.0 ± 6.5 µM and a Hill coefficient of 1.18 ± 0.03.

Figure 10.

TCa (A) Replacing 135 mM impermeant external cation NMDG+ with Na+, in the presence of invariant 2 mM Ca2+ produces a 42% increase in peak inward current through TCav3 elicited by a voltage step from −110 to −45 mV (black and red current traces, respectively), indicative of a moderate mixing of inward Ca2+ and Na+ ions in macroscopic currents. (B) Mean percent increase in peak inward current at −45 mV (±SE), upon replacement of 135 mM external NMDG+ with equimolar Na+ in the presence of 2 mM external Ca2+, for TCav3 compared with previously published data for other cloned Cav3 channels (Senatore et al., 2014; Stephens et al., 2015). (C) Macroscopic currents for TCav3 are larger in the presence of 2 mM external Ca2+ versus Ba2 (inset), where mono-exponential curves fitted over activation and inactivation phases of the current waveforms (τinact and τinact, respectively) reveal statistically indistinguishable kinetics under one-way ANOVA. Plotted values represent mean ± SE. (D) Corresponding IV plots for mean peak Ca2+ versus Ba2+ currents (±SE) reveal a 2.29-fold increase in maximal peak inward current when Ca2+ is present in the extracellular solution instead of Ba2+. (E) Replacing 100 mM impermeant external cation NMDG+ with Na+, in the presence of invariant 2 mM external Ba2+, produces a 51% increase in peak inward current through TCav3 elicited by a voltage ramp from −110 to 100 mV (black and red current traces, respectively), indicative of a moderate mixing of Ba2+ and Na+ ions in macroscopic currents. (F) Mean percent increase in peak inward current using the voltage ramp protocol (±SE), upon replacement of 135 mM external NMDG+ with equimolar Na+ in the presence of 2 mM external Ba2+, for TCav3 compared with previously published data for other cloned Cav3 channels (Stephens et al., 2015). Asterisks depict statistical significance (p-values) for comparisons of means for increased inward current with Na+ relative to TCav3 (generated by one-way ANOVA; *, P ≤ 0.05; ***, P ≤ 0.0005).

Figure 11.

Ca (A) Ca2+ block of Na+ currents for TCav3 compared with previously published data for human Cav3.1 and the two exon 12 splice variants of the Lymnaea channel, LCav3-12a and LCav3-12b (Senatore et al., 2014). Increasing external [Ca2+] from 1 nM to 10 mM, in the presence of invariant external [Na+] of 60 mM, blocks Na+ currents through TCav3 with similar affinity as human Cav3.1, where at 10 µM external Ca2+ (i.e., 10−5 [Ca2+]out), mean peak inward currents (±SE) for Cav3.1and TCav3, elicited by voltage steps from −110 to −35 mV, show substantial attenuation from maximum (I/Imax). Instead, exon 12 variants of LCav3 show a reduced Ca2+ block, most dramatically for LCav3-12a. (B) Mean percent block of inward Na+ currents (±SE) for the various Cav3 channels at 10 and 0.1 µM [Ca2+]out. Asterisks depict statistical significance (p-values) for comparisons of means for percent block relative to TCav3 (generated by one-way ANOVA; *, P ≤ 0.05; **, P ≤ 0.005; ***, P ≤ 0.0005). (C) Mean fold increase/decrease in I/Imax for the various cloned channels (±SE) as [Ca2+]out is increased from 10 µM to 10 mM. Asterisks depict statistical significance (p-values) for comparisons of means for fold change in current relative to TCav3 (generated by one-way ANOVA; *, P ≤ 0.05; ***, P ≤ 0.0005).

Figure 12.

Bi-ionic reversal potential analysis of TCa (A) Sample current traces recorded for TCav3 recorded under different bi-ionic conditions, with 4 mM [Ca2+]out and 100 mM [X+]in (X = Li, Na, K, or Cs), reveal increasing outward current amplitudes from Cs+ to K+ to Na+ to Li+, reflecting increasing permeability with decreasing ionic radius, consistent with the Eisenman model of permeability through a narrow pore (Eisenman et al., 1967; Eisenman and Horn, 1983). (B) Decreasing permeability for Ca2+ over X+, from Cs+ to Li+, is measured by zero-current reversal potentials (ERev) on IV plots, which represent voltages at which inward-flowing Ca2+ and outward-flowing X+ ions are at equilibrium. (C) Converting ERev values to relative permeabilities for Ca2+ over X+ (i.e., PCa/PX), using the bi-ionic Nernst equation, reveals that TCav3 is poorly selective for Ca2+ over X+ ions, with a Ca2+-selectivity profile that falls between the extremely Na+-permeable LCav3-12a and the moderately Na+-permeable LCav3-12b. (D) A zoomed-out view of the IV plot in B reveals three conductance states for TCav3 (i.e., the slope of current I/Imax as a function of depolarizing voltage), with an inward conductance (GIn) at voltages that favor inward Ca2+ flow, a rectifying conductance across the reversal potential (GRev) where Ca2+ and X+ ions are competing for permeation, and an outward conductance (GOut) where the voltage favors outward flow of monovalent cations. (E) Comparing the three different conductance states for TCav3 with those of the two exon 12 variants of LCav3 and the human Cav3.1 channel places TCav3 somewhere between Cav3.1 and LCav3-12b. Asterisks depict statistical significance (p-values) for differences between mean conductance relative to TCav3 (one-way ANOVA; *, P ≤ 0.05; **, P ≤ 0.005; ***, P ≤ 0.0005). All values for B–E represent mean ± SE.

Table 2.

Comparison of mean biophysical and permeability parameters of in vitro expressed Cav3 channels (±SE; n values in parentheses)

ParameterTCav3LCav3 (+8b-25c)P-valueRef.Cav3.1P-valueRef.Cav3.2P-valueRef.Cav3.3P-valueRef.
Activation
Peak of IV (mV)−45−401−352−352252
V1/2−59.32 ± 0.9 (8)−53.48 ± 0.34 (13)***1−49.3 ± 0.7 (26)***2−48.4 ± 1.2 (10)***241.5 ± 1.1 (17)***2
Slope (k, mV)4.50 ± 0.25 (8)5.46 ± 0.14 (13)**14.6 ± 0.1 (26)NS25.2 ± 0.4 (10)NS26.2 ± 0.2 (17)***2
Inactivation
V1/2−74.15 ± 0.90 (10)−70.89 ± 0.49 (16)**1−74.2 ± 1.1 (8)NS2−75.6 ± 0.7 (19)NS269.8 ± 0.9 (17)**2
Slope (k, mV)2.69 ± 0.11 (8)2.93 ± 0.08 (16)NS15.5 ± 0.3 (8)***26.2 ± 0.2 (19)***26.1 ± 0.1 (17)***2
Activation kinetics
τ (−50 mV)14.36 ± 0.31 (8)3.26 ± 0.13 (16)***18.2 ± 0.9 (8)***39.9 ± 0.4 (10)***343 ± 3 (9)***3
τ (−10 mV)3.48 ± 0.13 (8)0.74 ± 0.03 (16)***11.1 ± 0.1 (8)***31.8 ± 0.1 (10)***35.9 ± 0.5 (9)***3
Fold change4.14.47.55.57.3
Inactivation kinetics
τ (−50 mV)66.33 ± 3.39 (6)27.51 ± 1.34 (16)***162 ± 23 (8)NS328 ± 3 (10)***3126 ± 22 (9)*3
τ (−10 mV)51.36 ± 1.53 (6)15.67 ± 0.56 (16)***116 ± 1 (8)***315 ± 1 (10)***380 ± 5 (9)***3
Fold change1.31.83.91.91.6
Deactivation
−100 mV1.46 ± 0.06 (12)1.37 ± 0.05 (19)NS12.6 ± 0.2 (9)***23.6 ± 0.4 (14)***21.12 ± 0.1 (31)*2
−70 mV9.15 ± 0.66 (12)2.28 ± 0.18 (19)***16.2 ± 0.4 (9)**28.5 ± 1.1 (14)NS22.1 ± 0.1 (30)***2
Recovery
τ recovery (ms)1275.05 ± 54.43 (6)908.04 ± 27.05 (14)***1137 ± 5 (12)***2448 ± 36 (7)***2260 ± 30 (18)***2
Nickel
(IC50 µM)335.0 ± 6.5 (9)300.0 ± 29.2 (4)NS4304.8 ± 6.2 (5–6)*54.9 ± 2.0 (5–6)***5216 ± 9 (5-6)***5
Mixed Ca2+/Na+ currents
% increase in Imax (Ca2+)42.09 ± 3.19 (8)12a: 1439.75 ± 82.50 (6)***626.64 ± 9.24 (4)*31.96 ± 4.58 (11)NS45.45 ± 7.59 (6)NS
12b: 153.02 ± 9.61 (7)***6
% increase in Imax (Ba2+)51.19 ± 2.64 (4)12a: 901.29 ± 120.33 (5)***627.01 ± 3.17 (9)***636.88 ± 3.50 (7)*649.91 ± 6.23 (4)NS6
12b: 121.07 ± 4.26 (3)***6
Ca2+ vs. X+ permeability
pCa/pLi19.87 ± 1.30 (8)12a: 22.74 ± 0.41 (8)*646.67 ± 2.32 (7)***6
12b: 27.40 ± 1.13 (7)***6
pCa/pNa35.61 ± 1.52 (8)12a: 33.06 ± 1.50 (6)NS689.56 ± 8.21 (6)***680.58 ± 3.69 (4)***56.19 ± 2.99 (7)***
12b: 41.49 ± 1.98 (8)*6
pCa/pK63.99 ± 4.19 (9)12a: 50.25 ± 1.56 (12)**6140.16 ± 12.02 (5)***6
12b: 78.93 ± 4.17 (11)*6
pCa/pCs114.83 ± 10.64 (7)12a: 111.30 ± 8.57 (10)NS6154.65 ± 7.99 (5)*6
12b: 113.76 ± 7.19 (11)NS6

P-values for statistical comparisons for all channels with respect to TCav3 were generated using one-way ANOVA. *, P < 0.05; **, P < 0.005; ***, P < 0.0005; NS, not significantly different. Bold indicates the value most similar to TCav3, and bold italics indicates the value most different from TCav3. References: 1, Senatore and Spafford (2012); 2, Chemin et al. (2002); 3, Gomora et al. (2002); 4, Senatore and Spafford (2010); 5, Kang et al. (2006); 6, Senatore et al. (2014).

P-values for statistical comparisons for all channels with respect to TCav3 were generated using one-way ANOVA. *, P < 0.05; **, P < 0.005; ***, P < 0.0005; NS, not significantly different. Bold indicates the value most similar to TCav3, and bold italics indicates the value most different from TCav3. References: 1, Senatore and Spafford (2012); 2, Chemin et al. (2002); 3, Gomora et al. (2002); 4, Senatore and Spafford (2010); 5, Kang et al. (2006); 6, Senatore et al. (2014).

Online supplemental material

Fig. S1 shows the percentage minimum–maximum plot of the TCav3 channel protein coding sequence compared with the three human Cav3 channels (hCav3.1, hCav3.2, and hCav3.3). Fig. S2 is an alignment of the domain II P-loop of T-type channels corresponding to the exon 12 region. Fig. S3 shows superimposed current–voltage plots of various Cav3 channel homologues under different bi-ionic conditions. The Cav channel protein sequences used to generate the phylogenetic tree depicted in Fig. 1 B are provided in supplemental text file 1 (untrimmed, unaligned sequences) and supplemental text file 2 (trimmed, MUSCLE-aligned sequences), both in FASTA format.

Results

Identification and sequencing of a Cav3 channel homologue from T. adhaerens

Various Cav3 channel protein sequences were blasted against the T. adhaerens genome (Srivastava et al., 2008; JGI Genome Portal), identifying a predicted Trichoplax T-type/Cav3 channel homologue (T. adhaerens Grell-BS-1999 v1.0, scaffold_2:6781672-6793175). The predicted coding sequence served as a reference for RT-PCR amplification and sequencing of the Trichoplax Cav3 (TCav3) cDNA, amplified in two large fragments, with primers listed in Table 1. To build a consensus, every nucleotide along the 6,192-bp coding sequence of TCav3 was validated with a minimum of three independently amplified sequences. The resulting full-length open reading frame (submitted to GenBank with accession no. KJ466205) predicts a channel protein of 2,063 aa, a molecular mass of ∼238 kD, and a Kyte–Doolittle hydrophobicity profile with hydrophobic peaks corresponding to transmembrane helices (i.e., segments 1 to 6 or S1–S6) within each of IV repeat domains, conserved for all four-domain channels (Fig. 1 A). An inferred ML phylogeny of various Cav channel proteins places TCav3 basal to the two cnidarian T-type channels from Nematostella vectensis (Cav3a and Cav3b), as well as bilaterian protostome homologues C. elegans cca-1, Drosophila Ca-α1T, and Lymnaea LCav3, and chordate deuterostome homologues (human Cav3 isotypes Cav3.1-Cav3.3; Fig. 1 B). Recent phylogenomic studies have placed Trichoplax and its phylum (Placozoa) as a sister clade to the bilaterians and cnidarians, and sponges (phylum Porifera) and comb jellies (phylum Ctenophora) as the most early diverging animals (Srivastava et al., 2008, 2010; Ryan et al., 2013; Moroz et al., 2014; Pisani et al., 2015). Based on this phylogeny, Trichoplax is the earliest diverging animal to possess all three types of bilaterian/cnidarian Cav channels (i.e., Cav1, Cav2, and Cav3). Instead, the marine sponge/poriferan Amphimedon queenslandica and the two ctenophores Mnemiopsis leidyi and Hormiphora californiensis have only single Cav channel genes, forming either a clade with Cav2 types (i.e., ctenophores) or a sister clade with Cav1 and Cav2 types (i.e., Amphimedon, hence dubbed Cav1/Cav2-like; Moran and Zakon, 2014; Senatore et al., 2016). Interestingly, recent genome sequencing of choanoflagellate Salpingoeca rosetta revealed the presence of a T-type channel, indicating that Cav3 types likely predate Metazoa (Fig. 1 B; Fairclough et al., 2013; Moran and Zakon, 2014), and hence were lost in Porifera and Ctenophora. Thus, TCav3 is the most divergent homologue of vertebrate/human T-type channels identified to date in animals. Hydropathy profile of TCa (A) The in silico–translated protein sequence of TCav3 produces hydrophobic peaks on a Kyte–Doolittle hydrophobicity plot corresponding to six transmembrane helices (S1–S6) present in each of four homologous domains (I–IV), conforming to the characteristic structure of four-domain channels. The vertical green bar illustrates the location of the peptide epitope used to generate polyclonal anti-TCav3 antibodies. (B) Protein phylogeny of various Cav channels, inferred by ML using the LG+G model. Node support values resulting from 1,000 bootstrap replicates are indicated, and the scale bar indicates the number of amino acid substitutions per site. Of select Cav3 channels with validated mRNA sequences (i.e., TCav3, C. elegans Cav3 channel cca-1, human Cav3.1 to Cav3.3 isotypes, L. stagnalis Cav3, and Drosophila melanogaster Ca-α1T), the Trichoplax channel protein is among the smallest, with shorter cytoplasmic N- and C-terminal regions, as well as linkers between domains I–IV (Fig. 2 A). Instead, transmembrane regions (S1–S6 helices and corresponding linkers) are much more similar in length (Fig. 2 B), and indeed carry most of the protein sequence homology between different channels, whereas the cytoplasmic linkers and N/C termini exhibit much more divergence (Senatore and Spafford, 2010). The distant TCav3 bears what are perhaps the most distinguishing features of T-type channels: (a) a “selectivity filter” motif of EEDD, made up of negatively charged glutamate (E) and aspartate (D) residues that project into the pore to govern ion selectivity (Talavera and Nilius, 2006), distinct from the more calcium-selective EEEE selectivity filters of Cav1 and Cav2 channels (Figs. 1 A and 2 C); and (b) a predicted helix-loop-helix motif in the cytoplasmic linker between domains I and II, dubbed the “gating brake,” which serves to prevent channel opening at hyperpolarized membrane voltages (Perez-Reyes, 2010a) and where mutations in human Cav3.2 are associated with childhood absence epilepsy (Figs. 1 A and 2 D; Arias-Olguín et al., 2008).
Figure 2.

Structural features of the TCa (A) TCav3 has short N and C termini, as well as cytoplasmic linkers joining the four domains similar to the channel from C. elegans and much smaller, with the largest known T-type channels from Lymnaea and Drosophila. (B) Length of transmembrane regions and loops between segments 1 and 6 of each domain (D1–D4) are highly conserved for T-type channels, with domain I being the longest in amino acid length and domain II the shortest. Depicted values for the three human Cav3 channels (hCav3.1–hCav3.3) represent mean ± SE. (C) Alignment of Cav channel selectivity filter and flanking amino acids, showing the conserved EEDD motif common to all Cav3 channels and distinct from the EEEE selectivity filters of high voltage–activated channels Cav1.2 and Cav2.2. (D) Prediction of secondary protein structure with PSIPRED (McGuffin et al., 2000) reveals a conserved helix-loop-helix gating brake motif in all T-type channels (green and yellow underlines depict predicted helices and regions where the prediction dropped below threshold, respectively) in the cytoplasmic I–II linker just proximal to the S6 pore-forming helix of domain I.

Structural features of the TCa (A) TCav3 has short N and C termini, as well as cytoplasmic linkers joining the four domains similar to the channel from C. elegans and much smaller, with the largest known T-type channels from Lymnaea and Drosophila. (B) Length of transmembrane regions and loops between segments 1 and 6 of each domain (D1–D4) are highly conserved for T-type channels, with domain I being the longest in amino acid length and domain II the shortest. Depicted values for the three human Cav3 channels (hCav3.1hCav3.3) represent mean ± SE. (C) Alignment of Cav channel selectivity filter and flanking amino acids, showing the conserved EEDD motif common to all Cav3 channels and distinct from the EEEE selectivity filters of high voltage–activated channels Cav1.2 and Cav2.2. (D) Prediction of secondary protein structure with PSIPRED (McGuffin et al., 2000) reveals a conserved helix-loop-helix gating brake motif in all T-type channels (green and yellow underlines depict predicted helices and regions where the prediction dropped below threshold, respectively) in the cytoplasmic I–II linker just proximal to the S6 pore-forming helix of domain I.

Reduced genomic complexity and absence of alternative splicing of the TCav3 gene

Most of the ∼11,500 genes in the Trichoplax genome bear genomic architectures similar to orthologous genes in other animals (Srivastava et al., 2008). Accordingly, of the 28 exons/27 introns that make up the TCav3 channel gene, 26 splice junctions have counterparts in the Cav3.1 channel gene from mouse (MusCav3.1), whose mRNA transcript sequence is encoded by 38 exons/37 introns (Fig. 3). The Trichoplax Cav3 channel gene is ∼10-fold shorter than MusCav3.1, attributable to much smaller intron sizes here and across the entire Trichoplax genome (Srivastava et al., 2008). To summarize major structural differences between the Trichoplax and mouse Cav3 genes (Fig. 3): (a) TCav3 lacks an intron separating exons 2 and 3, in the coding region for the domain I S1-S2 linker (Fig. 1 A), but retains N-terminal introns separating exons 1 and 2, as well as exons 3–4, 4–5, and 5–6, which are conserved in all metazoan four-domain channels including Cav and Nav channels (Spafford et al., 1999); (b) TCav3 also lacks an intron separating exons 11 and 12 encoding the domain II extracellular P-loop between S5 and S6, which is found in all Cav3 channels stemming from basal bilaterians (Senatore et al., 2014); (c) TCav3 lacks alternative donor splice sites at the 3′ ends of exons 8 and 25, which in snail LCav3 and MusCav3.1 create optional exons 8b and 25c that regulate channel surface expression and gating, respectively (Chemin et al., 2001; Emerick et al., 2006; Shcheglovitov et al., 2008; Senatore and Spafford, 2012); (d) TCav3 lacks exon 26 found in all mammalian Cav3.1 and Cav3.2 channel genes, as well as C. elegans cca-1, which produces similar but more slight gating effects compared with exon 25c (Chemin et al., 2001; Ohkubo et al., 2005; Steger et al., 2005; Zhong et al., 2006; Senatore and Spafford, 2012); and (e) TCa is missing four introns between exons 33 and 38 of MusCav3.1, corresponding to the channel C-terminal region. An overall reduction in genomic complexity for TCav3, especially in regions associated with alternative splicing, is consistent with reports that genes from basal metazoans generally undergo less alternative splicing (Pan et al., 2008; Wang et al., 2008; Gerstein et al., 2010; Graveley et al., 2011; Ramani et al., 2011). This was certainly evident during the sequencing and cloning of the TCav3 cDNA, in which we failed to identify a single alternatively spliced isoform, as well in an ongoing transcriptome analysis of Trichoplax whole-animal mRNAs (Senatore et al., 2016).
Figure 3.

Analysis of Ca (Ca (TCa (TCa (mouse; Ca Exons bearing start to stop codons are depicted by boxes, and introns are depicted by thin lines, with corresponding scale bars on the right indicating length in base pairs. Homologous protein sequences corresponding to mouse exons 1–38 are depicted by alternating blue and red background fills, with expanded mouse exons 14–17 colored in green and C-terminal exons 33–38 colored in gray. The TCav3 channel gene has a similar genomic structure as MusCav3.1; however, it is shorter in length (i.e., scale bars of 1,000 bp for TCav3 vs. 10,000 bp), and lacks nine introns (red arrowheads), resulting in 10 fewer exons (fused TCav3 exons are shown in red). TCav3 also lacks alternative splicing identified in channels from mammals and protostome invertebrates, including optional exons 8b, 25c, and 26, and mutually exclusive exons 12a and 12b (white arrow) found only in protostomes (red portions of the MusCav3.1 exons). Asterisks depict introns that are conserved among all metazoan four-domain channels.

Analysis of Ca (Ca (TCa (TCa (mouse; Ca Exons bearing start to stop codons are depicted by boxes, and introns are depicted by thin lines, with corresponding scale bars on the right indicating length in base pairs. Homologous protein sequences corresponding to mouse exons 1–38 are depicted by alternating blue and red background fills, with expanded mouse exons 14–17 colored in green and C-terminal exons 33–38 colored in gray. The TCav3 channel gene has a similar genomic structure as MusCav3.1; however, it is shorter in length (i.e., scale bars of 1,000 bp for TCav3 vs. 10,000 bp), and lacks nine introns (red arrowheads), resulting in 10 fewer exons (fused TCav3 exons are shown in red). TCav3 also lacks alternative splicing identified in channels from mammals and protostome invertebrates, including optional exons 8b, 25c, and 26, and mutually exclusive exons 12a and 12b (white arrow) found only in protostomes (red portions of the MusCav3.1 exons). Asterisks depict introns that are conserved among all metazoan four-domain channels. Adding to the analysis, Cav3 genes from premetazoan choanoflagellate S. rosetta and cnidarian N. vectensis reveal unique patterns in intron gain/loss across these different organismal lineages (Fig. 3). In keeping with the MusCav3.1 intro/exon numbering scheme, SalpCav3 exon 8 is fused with flanking exons 7 and 9, which are conserved as separate exons in mouse and Trichoplax, and bears an additional three internal exons. Notably, this region encodes the channel I–II linker protein sequence (Fig. 1 A), which tends to be highly divergent between different Cav3 channels. In this equivalent position, NemCav3a has an additional exon compared with mouse and Trichoplax, which, interestingly, overlaps with mouse optional exon 8b, which alters channel membrane expression. SalpCav3 notably lacks numerous introns between exons 12 and 33, a region encoding the C-terminal half of the channel protein (i.e., domains III and IV). Also evident is that MusCav3.1 exons 14–17 appear to have arisen via expansion from a single exon conserved in TCav3 and NemCav3a, in a region that corresponds the III–IV linker, which interestingly serves as a hotbed for modulation of mammalian T-type channels by kinases and G-proteins (Chemin et al., 2006; Perez-Reyes, 2010b; Senatore et al., 2012). Finally, NemCav3a and MusCav3.1 bear more exons/introns in the 3′ end of the gene, perhaps indicative of intron expansion in the cytoplasmic C terminus, a region with poor sequence homology where it is difficult to infer conserved intron/exon structure.

TCav3 is expressed in neurosecretory-like gland cells

Immunostaining Trichoplax with both crude and affinity-purified custom antibodies against a I–II linker epitope of TCav3 (site depicted in Fig. 1 A) outlined cells around the rim of the animal and, less intensely marked, scattered cells further in the interior (Fig. 4 A). Enhanced imaging with the Airyscan detector (1.7-fold improvement in resolution and improved signal-to-noise relative to conventional confocal [Huff, 2015]) revealed that TCav3 staining was near the surfaces of hourglass-shaped cells and concentrated at the side facing the exterior of the animal (Fig. 4 A, inset). Staining was not evident when using preimmune serum (Fig. 4 B). The cells that labeled for TCav3 also were stained by an antibody against Trichoplax complexin (Fig. 4 C), a regulator of SNARE secretory proteins in neurons. The distribution of the cells as well as their shapes closely matched those of gland cells labeled with antibodies against the SNARE proteins syntaxin-1, synaptobrevin, and SNAP-25 (Smith et al., 2014). No signal was apparent in specimens incubated with preimmune serum and imaged with the same parameters.
Figure 4.

Immunostaining for TCa (A) Large field shows a projection of 17 optical sections extending through the dorsoventral thickness of the animal but omitting the dorsal and ventral surfaces where there is nonspecific staining. Labeled cells are concentrated around the rim but also present in the interior, although too dim to see in this unenhanced image. (Inset) Projection of 36 optical sections through cells reaching the ventral surface at the exterior of the animal. Staining is concentrated near the surfaces of hourglass-shaped cells and is most intense on the side facing the exterior. (B) Comparison of staining for TCav3 with matched preimmune control showing lack of staining for TCav3. (A and B) Nuclei are blue. (C) Cells that immunostain for TCav3 also label for complexin, a marker for neurosecretory cells. Merged view of double stain (right) shows TCav3 in green and complexin in red. The left panel shows TCav3 (green), and the middle panel shows complexin (red). A (inset) and C were collected with an enhanced detector (Airyscan). Bars: (A–C) 10 µm; (A, inset) 5 µm. The scale bar for B is shared with C.

Immunostaining for TCa (A) Large field shows a projection of 17 optical sections extending through the dorsoventral thickness of the animal but omitting the dorsal and ventral surfaces where there is nonspecific staining. Labeled cells are concentrated around the rim but also present in the interior, although too dim to see in this unenhanced image. (Inset) Projection of 36 optical sections through cells reaching the ventral surface at the exterior of the animal. Staining is concentrated near the surfaces of hourglass-shaped cells and is most intense on the side facing the exterior. (B) Comparison of staining for TCav3 with matched preimmune control showing lack of staining for TCav3. (A and B) Nuclei are blue. (C) Cells that immunostain for TCav3 also label for complexin, a marker for neurosecretory cells. Merged view of double stain (right) shows TCav3 in green and complexin in red. The left panel shows TCav3 (green), and the middle panel shows complexin (red). A (inset) and C were collected with an enhanced detector (Airyscan). Bars: (A–C) 10 µm; (A, inset) 5 µm. The scale bar for B is shared with C. We also confirmed expression of TCav3 at the mRNA level by RT-PCR, where gene-specific primers amplified an appropriate ∼500-bp fragment from cDNA reverse transcribed from whole-animal total RNA using an oligo-dT18 primer (Table 1 and Fig. 5). Similarly, primers targeting the other two Trichoplax Cav channels, Cav1 and Cav2, as well as the Cav1/Cav2 accessory subunit Cavβ and three Cavα2δ subunits (Cavα2δ-a, Cavα2δ-b, and Cavα2δ-c; Table 1), all produced expected bands of ∼500 bp, with no bands evident when the RTase enzyme was omitted from the reaction (Fig. 5). We also note that mRNA expression of these genes, as well as other genes homologous to those involved in cellular excitability (e.g., Nav2 and Kv channels, K+ leak channels), are expressed in the whole-animal transcriptome of Trichoplax (Senatore et al., 2016).
Figure 5.

RT-PCR amplification of various RT-PCR amplification of cDNA corresponding to the three Trichoplax Cav channels (TCav1, TCav2, and TCav3), the single Cavβ subunit, and the three Cavα2δ subunits (Cavα2δ-a, Cavα2δ-b, and Cavα2δ-c) from a whole-animal total RNA cDNA library prepared with an anchored oligo-dT18 primer.

RT-PCR amplification of various RT-PCR amplification of cDNA corresponding to the three Trichoplax Cav channels (TCav1, TCav2, and TCav3), the single Cavβ subunit, and the three Cavα2δ subunits (Cavα2δ-a, Cavα2δ-b, and Cavα2δ-c) from a whole-animal total RNA cDNA library prepared with an anchored oligo-dT18 primer.

Ectopic expression of TCav3 in HEK-293T cells

The TCav3 open reading frame (NCBI accession no. KJ466205) was cloned into bicistronic expression vector pIRES2-EGFP, which enables identification of positively transfected mammalian cells separately expressing TCav3 plus the fluorescent marker EGFP. Transfection of this construct (pTCav3-IR-EGFP) into HEK-293T cells produced barely detectable EGFP fluorescence (Fig. 6 A), suggesting that the TCav3 insert was somehow inhibiting expression of bicistronic EGFP because the empty pIRES2-EGFP vector normally produces robust EGFP fluorescence in these cells. Attempts to record voltage-activated Ca2+ currents from HEK cells transfected with pTCav3-IR-EGFP via whole-cell patch-clamp were unsuccessful, suggesting that the channel protein was also not expressed at high enough levels to accumulate at the cell membrane. A possible reason for the apparent poor expression of TCav3 is the prevalence of tandem rare codons in its cDNA sequence with respect to humans, which is expected to decrease efficiency of ectopic protein translation (Gustafsson et al., 2004; Kobayashi, 2015; Presnyak et al., 2015). Specifically, TCav3 exhibits a low codon adaptation index of 0.61 with respect to human preferred codons (Sharp and Li, 1987), and percentage minimum–maximum analysis reveals rare codon clustering along the entire length of the channel coding sequence (Fig. S1; Clarke and Clark, 2008).
Figure 6.

In vitro expression of TCa (A) Bicistronic EGFP fluorescence images (top) and merged EGFP/transmitted light images (bottom) of HEK-293T cells cotransfected with pTCav3-IR-EGFP (vector map on left) and pCDNA-3.1 (+pC) and/or pMT2 constructs bearing the coding sequences of rat Cavβ1b and Cavα2δ1 accessory subunits. (B) Similar to A, but cells were transfected with the pEGFP-TCav3 construct, encoding a fusion protein of TCav3 tagged with N-terminal EGFP. (C) Similar to A, but cells were transfected with the empty EGFP fusion vector pEGFP-C1. Bar, 200 µm. (D) Bar graph depicting normalized mean fluorescence of imaged HEK cells from quadruplicate transfections (±SE). The purple asterisks denote statistically significant means (***, P < 0.005) comparing the +pC condition with all others via one-way ANOVA. (E) Western blot of HEK cell protein lysates with anti-EGFP antibody, prepared by cotransfection of the pEGFP-TCav3 vector with indicated combinations of pCDNA-3.1, rat Cavβ1b, and/or Cavα2δ1. (F) Western blot of HEK cell protein lysates with anti-EGFP antibody, prepared by cotransfection of the pEGFP-C1 vector (top) or pEGFP-TCav3 (bottom) with the indicated combinations of pCDNA-3.1, rat Cavβ1b, and/or Cavα2δ1 accessory subunits. Note that the three smaller bands near 33 kD visible in E converge into one band in the lower panel because of an increase in the percentage of polyacrylamide from 7.5% to ∼20% in the gels used for Western blotting. (G) Bar graph depicting the mean increase (±SE) in integrated density of HEK cells transfected with pEGFP-TCav3 and pCDNA-3.1 upon the addition of proteasome inhibitor MG-132 to the cultured cells 12 h before imaging. The purple asterisks denote statistically significant means with ***, P < 0.005.

In vitro expression of TCa (A) Bicistronic EGFP fluorescence images (top) and merged EGFP/transmitted light images (bottom) of HEK-293T cells cotransfected with pTCav3-IR-EGFP (vector map on left) and pCDNA-3.1 (+pC) and/or pMT2 constructs bearing the coding sequences of rat Cavβ1b and Cavα2δ1 accessory subunits. (B) Similar to A, but cells were transfected with the pEGFP-TCav3 construct, encoding a fusion protein of TCav3 tagged with N-terminal EGFP. (C) Similar to A, but cells were transfected with the empty EGFP fusion vector pEGFP-C1. Bar, 200 µm. (D) Bar graph depicting normalized mean fluorescence of imaged HEK cells from quadruplicate transfections (±SE). The purple asterisks denote statistically significant means (***, P < 0.005) comparing the +pC condition with all others via one-way ANOVA. (E) Western blot of HEK cell protein lysates with anti-EGFP antibody, prepared by cotransfection of the pEGFP-TCav3 vector with indicated combinations of pCDNA-3.1, rat Cavβ1b, and/or Cavα2δ1. (F) Western blot of HEK cell protein lysates with anti-EGFP antibody, prepared by cotransfection of the pEGFP-C1 vector (top) or pEGFP-TCav3 (bottom) with the indicated combinations of pCDNA-3.1, rat Cavβ1b, and/or Cavα2δ1 accessory subunits. Note that the three smaller bands near 33 kD visible in E converge into one band in the lower panel because of an increase in the percentage of polyacrylamide from 7.5% to ∼20% in the gels used for Western blotting. (G) Bar graph depicting the mean increase (±SE) in integrated density of HEK cells transfected with pEGFP-TCav3 and pCDNA-3.1 upon the addition of proteasome inhibitor MG-132 to the cultured cells 12 h before imaging. The purple asterisks denote statistically significant means with ***, P < 0.005. Interestingly, previous research on cloned mammalian T-type channels revealed that coexpression with Cavβ and Cavα2δ accessory subunits of high voltage–activated Cav1 and Cav2 channels increases Cav3 channel expression by an indirect mechanism (Dubel et al., 2004). Thus, we sought to increase TCav3 channel expression in HEK cells by cotransfecting with rat Cavβ1b and Cavα2δ1 subunit cDNAs cloned into the mammalian expression vector pMT2 (Tomlinson et al., 1993). Strikingly, cotransfection of pTCav3-IR-EGFP with rat Cavβ1b and Cavα2δ1 subunit vectors produced an ∼217-fold increase in bicistronic EGFP fluorescence compared with cotransfection with empty mammalian expression vector pCDNA-3.1 (Fig. 6 A), quantified as relative integrated density with ImageJ software (Fig. 6 D). Cotransfection with just Cavβ1b or Cavα2δ1 separately also increased fluorescence, but more moderately, with respective increases of ∼165-fold and 148-fold (Fig. 6 D). In addition, cotransfection of pTCav3-IR-EGFP with the rat Cavβ1b and Cavα2δ1 subunits allowed us to electrophysiologically record robust TCav3 Ca2+ currents in HEK cells. Because bicistronic expression and fluorescence of EGFP from pTCav3-IR-EGFP only indirectly implies TCav3 channel protein expression, we repeated the cotransfection experiment using a construct in which the channel coding sequence was cloned in frame with that of EGFP at the channel’s N terminus, in the EGFP fusion vector pEGFP-C1. Cotransfection of the resulting pEGFP-TCav3 construct with rat Cavβ1b and Cavα2δ1 subunit vectors increased EGFP fluorescence ∼75-fold, whereas Cavβ1b and Cavα2δ1 alone increased fluorescence ∼47-fold and ∼38-fold, respectively (Fig. 6, B and D). Interestingly, the Cavβ1b and Cavα2δ1 vectors also increased fluorescence of EGFP when transfected without TCav3, from the empty vector pEGFP-C1 (Fig. 6, C and D), and this corresponded with increased EGFP protein levels apparent on Western blots of corresponding HEK cell lysates probed with anti-EGFP antibodies (Fig. 6 F). We were unable to detect the endogenous TCav3 protein in Western blots of Trichoplax whole-animal lysates or blots of protein lysates from TCav3-transfected HEK cells when using the custom anti-TCav3 antibodies. Instead, blots of HEK cells transfected with pEGFP-TCav3 plus the Cavβ1b and Cavα2δ1 vectors produced appropriate bands of ∼270 kD when probed with anti-EGFP (Fig. 6 E), consistent with the predicted molecular weight of the TCav3 channel protein (238 kD) plus EGFP (32.7 kD). In accordance with our inability to record TCav3 Ca2+ currents when pTCav3-IR-EGFP was transfected without the Cavβ1b and Cavα2δ1 subunit vectors, we were unable to detect the EGFP-TCav3 fusion protein without cotransfection of Cavβ1b and Cavα2δ1 (Fig. 6 E, left lane). Thus, the rat Cavβ1b and Cavα2δ1 subunit vectors appear to dramatically boost protein expression of TCav3, as either an EGFP fusion protein or a separate protein from the pTCav3-IR-EGFP construct. However, the effect of Cavβ1b and Cavα2δ1 subunit vectors on ectopic protein expression appears to be at least in part nonspecific because they also boost expression of coexpressed EGFP in the absence of TCav3 (Fig. 6, D and F). Finally, in lanes on Western blots in which the subunits were included and EGFP-TCav3 protein expression was evident, several additional bands could be observed with molecular weights of ∼100 kD and a triplet of intense bands near 33 kD (Fig. 6, E and F), suggesting that the channel either is being degraded in HEK cells or is incompletely translated. Application of proteasome inhibitor MG-132 to cells transfected with pEGFP-TCav3 plus pCDNA-3.1 for 12 h before fluorescence imaging caused only a 7.2-fold increase in EGFP integrated density (Fig. 6 G), still below the detection limit of Western blotting (not depicted), suggesting that proteasomal degradation only partly accounts for the poor expression of TCav3. Notable is that coexpression of EGFP-TCav3 with the Cavβ1b and Cavα2δ1 subunits does not appear to increase channel protein expression by decreasing the amount of degradation, but rather, by increasing the total amount of protein, including the complete protein, plus all of the incomplete intermediates (Fig. 6, E and F).

TCav3 conducts low voltage–activated calcium currents in vitro, characteristic of T-type channels

Whole-cell voltage clamp recording of HEK cells cotransfected with pTCav3-IR-EGFP, rat Cavβ1b, and rat Cavα2δ1 produced low voltage–activated calcium currents in 2 mM external Ca2+ in response to depolarizing voltage steps from −110 mV to between −90 and 40 mV (Fig. 7 A). A plot of peak currents versus step potential (i.e., current–voltage or IV plot) reveals a slightly hyperpolarized maximal peak inward current of −45 mV (Fig. 7 B), which is between 5 and 20 mV more negative than that of other Cav3 channels (Table 2). Boltzmann transformation of the IV plot, which removes the influence of driving force to estimate the voltage dependence for channel activation, indicates that TCav3 activation begins at very low depolarizing potentials compared with published data for other Cav3 channels derived using similar methods (i.e., compare half-maximal activation [V1/2] of −59.32 ± 0.9 mV for TCav3 vs. −53.48 ± 0.34 for Lymnaea Cav3 [Senatore and Spafford, 2012]; −49.3 ± 0.7 for human Cav3.1 [Chemin et al., 2002]; −48.4 ± 1.2 for Cav3.2 [Chemin et al., 2002]; and −41.5 ± 1.1 for human Cav3.3 [Chemin et al., 2002]), reaching maximal activation near −40 mV (Fig. 7 C and Table 2). Conversely, steady-state inactivation of TCav3, determined by measuring peak residual current after exposure to prolonged steady-state voltages (Fig. 7 C, inset), is quite similar for TCav3 with respect to other channels, especially Cav3.1 and Cav3.2 (i.e., V1/2 for inactivation is −74.15 ± 0.90 for TCav3 and −74.2 ± 1.1 for human Cav3.1 [Chemin et al., 2002] and −75.6 ± 0.7 for human Cav3.2 [Chemin et al., 2002]; Table 2). Altogether, the voltage properties of TCav3 indicate that it is likely more active at threshold voltages compared with other Cav3 channels, where the channel is subject to roughly the same amount of inactivation, but is more readily activated by depolarization. Activation and inactivation properties of TCa (A) Sample traces of recorded Ca2+ currents conducted by the TCav3 channel ectopically expressed in HEK-293T cells, in response to depolarizing voltage steps from −110 mV to between −90 and 40 mV. The scale base below the current traces reflects time in milliseconds and current amplitude in picoamperes. (B) Plot of mean peak current for different depolarizing voltages, relative to the maximal peak inward current (i.e., an IV plot), reveals a maximal peak inward current at −45 mV, indicating a low voltage of activation for TCav3. (C) Plot of mean voltage dependence for channel activation (filled black squares, conductance G/Gmax) and steady-state inactivation (white circles, I/Imax) reveals the presence of a window current for TCav3 (red fill). The inset shows the voltage protocol used to measure steady-state inactivation and sample elicited currents. (D) Mean τ values for mono-exponential curves fitted over the activation and inactivation phases of TCav3 macroscopic current waveforms reveals acceleration of channel kinetics upon stronger depolarization, measured as τact and τinact, respectively. (E) TCav3 is at the lower end of the scale with respect to acceleration of kinetics from −50 to −10 mV, with less pronounced fold decreases in τact and τinact compared with other in vitro–expressed channels, indicative of attenuated voltage dependency for activation and inactivation kinetics. Error bars indicate SE. An important and characteristic feature of T-type channels are their “window” currents, which occur at steady-state voltages near rest through a pool of constitutively open channels (Dreyfus et al., 2010), providing a constant influx of Ca2+ that depolarizes the cell membrane to alter cellular excitability (Cain and Snutch, 2010) and increases cytosolic Ca2+ to regulate cell growth and proliferation (Lory et al., 2006; Taylor et al., 2008; Senatore et al., 2012; Gackière et al., 2013). Such a window current is evident for TCav3, for which an overlap between channel activation and inactivation reveals a voltage range between −60 and −75 mV, where not all channels are inactivated and some degree of activation takes place (Fig. 7 C, red fill).

Kinetic properties of TCav3 macroscopic currents are also characteristic of T-type channels

In vitro TCav3 currents exhibit slow onset (activation) and attenuation (inactivation) at slight depolarizing voltage steps, which accelerate with stronger depolarization “tightening” current waveforms, a hallmark of Cav3 channels that produces a crossing over of inactivation curves toward peak inward current (Fig. 7 A). Such changes in current waveforms can be quantified with time constants (τ) for mono-exponential curve fits over the rise (τactivation) and decay (τinactivation) phases of channel currents, which for TCav3 results in a decrease in τ consistent with accelerating kinetics upon stronger depolarization (Fig. 7 D). The rate at which TCav3 activation accelerates through depolarization is lower compared with other in vitro–expressed channels, with only a 4.13-fold drop in τactivation from −50 to −10 mV versus 4.41-fold for Lymnaea Cav3 (Senatore and Spafford, 2010), 5.50-fold for human Cav3.2 (Gomora et al., 2002), 7.29-fold for human Cav3.3 (Gomora et al., 2002), and 7.45-fold for human Cav3.1 (Fig. 7 E and Table 2; Gomora et al., 2002). Likewise, acceleration of inactivation kinetics is slower, with only a 1.29-fold decrease in τinactivation for TCav3 versus 1.76-fold for LCav3, 1.87-fold for hCav3.2, 1.58-fold for hCav3.3, and 3.88-fold for hCav3.1 (Fig. 7 E and Table 2). From this data, it is clear that the two invertebrate channels compared here, TCav3 and the T-type channel from mollusk L. stagnalis (LCav3), have kinetics with an overall reduced voltage dependency, especially for current activation. TCav3 current kinetics are marginally slower across all negative voltages than other in vitro–expressed channels, with the exception of the slow Cav3.3 channel (Table 2). Similar to Lymnaea Cav3, and in contrast to mammalian Cav3 channels, TCav3 recovers slowly from inactivation (Fig. 8, A and B; and Table 2), indicating that prolonged hyperpolarization would be required to effectively recruit the channel from depolarized membrane voltages. TCav3 also has slow deactivation kinetics relative to mammalian channels at voltages near −70 mV (Fig. 8, C and D; and Table 2), which during action potential repolarization would result in increased inward Ca2+ influx. Overall, despite the noted differences, the voltage dependencies and kinetics of TCav3 currents are remarkably similar to those of Cav3 channels from animals that have neurons and muscle (Table 2), in particular where a low voltage of activation and rapid activation and inactivation kinetics (which allow T-type channels to contribute depolarizing currents near action potential threshold) are conserved. Recovery from inactivation and deactivation properties of TCa (A) Illustration of the voltage protocol (top) used to measure recovery from inactivation for TCav3. A 1-s inactivating voltage pulse from −110 to −35 mV was followed by increasing interpulse interval durations of hyperpolarization at −110 mV to remove inactivation, followed by a short test pulse to −35 mV to record recovered peak inward Ca2+ current (sample traces, bottom). (B) Mean recovery from inactivation for TCav3 Ca2+ currents in HEK-293T cells, measured relative to the maximal peak inward current (I/Imax). A mono-exponential curve fitted over the data produces a τ time constant for recovered current (τrecov) of 1,275 ± 54 ms. (C) Sample traces of TCav3 deactivation currents resulting from rapid membrane repolarization to different deactivating potentials while channels are fully open. The inset illustrates the voltage protocol used for deactivation. (D) τ values (τdeact) for mono-exponential curve fitted over decaying inward currents at different deactivating voltages. Scale bars indicate time (milliseconds) and current amplitude (picoamperes). Plotted values in B and D represent mean ± SE.

Ni2+ block of TCav3 Ca2+ currents

Early electrophysiological experiments revealed that the divalent cation Ni2+ could potently block low voltage–activated Ca2+ currents in some vertebrate preparations (Perez-Reyes, 2003). This high-affinity block was subsequently attributed only to the Cav3.2 channel isotype, and specifically to a unique histidine residue in its domain I S3–S4 extracellular loop (His-191) that strongly binds Ni2+ to disrupt channel gating (Fig. 9 A; Kang et al., 2006, 2010). The recently cloned T-type channel from Drosophila also bears a histidine in this loop (albeit 2 aa positions upstream of Cav3.2 His-191) and, not surprisingly, is also highly sensitive to Ni2+ (Jeong et al., 2015). Instead, TCav3, mammalian Cav3.1 and Cav3.3 channels, and Lymnaea LCav3, all lack histidines in this region (Fig. 9 A). Accordingly, all of these channels have low and remarkably similar IC50 values for Ni2+ block: 335.0 ± 6.5 µM for TCav3 (Fig. 9, B–D); 300.0 ± 29.2 for LCav3 (Senatore and Spafford, 2010); 304.8 ± 6.2 for human Cav3.1 (Kang et al., 2006); and 216 ± 9 for human Cav3.3 (Table 2; Kang et al., 2006). The similarity in IC50 values for all of these channels suggests that low-affinity Ni2+ block occurs through a common mechanism, where perhaps, as has been suggested for Cav3.1, extracellular Ni2+ ions bind two distinct regions of the pore in a cooperative manner (Obejero-Paz et al., 2008). Such a model is perhaps applicable to TCav3, where the Hill coefficient for Ni2+ block is greater than 1 (i.e., 1.18 ± 0.03; Fig. 9 D), suggesting some degree of cooperative binding. Interestingly, washout of Ni2+ is particularly fast for TCav3 compared with other T-type channels (Kang et al., 2006; Senatore and Spafford, 2010), with a transient increase in peak current amplitude (I/Imax) after perfusion of extracellular Ni2+ is replaced with Ni2+-free saline (Fig. 9 C). Ni (A) Alignment of the domain I S3–S4 extracellular loop of various T-type channels, showing the presence of a key histidine residue in vertebrate (human) Cav3.2 associated with high sensitivity to Ni2+ block (His-191). Drosophila Ca-α1T is also highly Ni2+ sensitive and contains a histidine residue in this same loop 2 aa upstream of Cav3.2 His-191. (B) Sample peak Ca2+ currents through TCav3 resulting from increased concentrations of externally perfused Ni2+. Applied Ni2+ concentrations, micromolar, are depicted on the left of the current waveforms. (C) Plot of sequential peak current responses of TCav3 as depicted in B resulting from the application of increasing concentrations of Ni2+ (mean ± SE; n = 9). Note the rapid washout of Ni2+ current inhibition and a transient augmented peak current the first few steps after washout. (D) Cumulative dose–response curve of TCav3 Ni2+ block, revealing an IC50 value of 335.0 ± 6.5 µM and a Hill coefficient of 1.18 ± 0.03.

Ca2+ versus Na+ permeation properties of TCav3

Recently, protostome invertebrates were found to uniquely possess alternative exons 12a and 12b, encoding alternate turret and descending helices of the domain II pore-loop (P-loop). In the freshwater mollusk L. stagnalis, these exons were found to produce channels with extremely bifurcated permeability features: whereas channels with exon 12b (i.e., LCav3-12b) conduct moderately mixed Ca2+-Na+ currents under physiological conditions, LCav3-12a is extremely Na+ permeant, such that less than 10% of inward current is carried by Ca2+ (Senatore et al., 2014). Alignment of the domain II turrets of Cav3 channels from basal metazoans Trichoplax (TCav3) and N. vectensis (Cav3a) with channels from protostomes (i.e., L. stagnalis, Drosophila, and C. elegans), deuterostomes (Ciona intestinalis, human), and a premetazoan species (choanoflagellate S. rosetta) reveals that the TCav3 domain II P-loop resembles those of exon 12a–bearing channels, being smaller and containing fewer cysteines than exon 12b (Fig. S2). We sought to assess whether the exon 12a–like turret of TCav3 is associated with moderate Na+ permeability, similar to cnidarian (Lin and Spencer, 2001), mammalian (Shcheglovitov et al., 2007), and basal deuterostome (Hagiwara et al., 1975) channels, or instead associates with extreme Na+ permeability, similar to exon 12a variants of Lymnaea Cav3. For this, we assessed the degree of mixing of Ca2+ and Na+ currents through TCav3 ectopically expressed in HEK-293T cells by replacing a perfused extracellular recording solution containing 2 mM Ca2+ and 135 mM impermeant NMDG+, with one containing Na+ instead of NMDG+ (Fig. 10, A and B). Addition of Na+ resulted in a 42% increase in peak inward current elicited by stepping from −110 to −45 mV, which approximates the degree of Na+ expected to move through the channel alongside Ca2+ upon membrane depolarization (Shcheglovitov et al., 2007; Senatore et al., 2014). Comparing the current increase of TCav3 with previously published data of other cloned channels (Senatore et al., 2014; Stephens et al., 2015) reveals that the Trichoplax T-type is most similar to the least Ca2+-selective mammalian isotype Cav3.3 (i.e., 45%), whereas the exon 12b variant of LCav3 exhibits a larger increase of 153% in current amplitude and human Cav3.1 an increase of only 27%. In stark contrast, LCav3-12a undergoes a striking 1,440% increase in current amplitude upon perfusion of external Na+ (Fig. 10 B), reflecting its dramatic Na+ permeability. Thus, in the presence of Ca2+, TCav3 appears to conduct only moderately mixed Ca2+-Na+ currents, in a range similar to that of other in vitro–expressed T-type channels, with the exception of the highly Na+-permeant LCav3-12a. TCa (A) Replacing 135 mM impermeant external cation NMDG+ with Na+, in the presence of invariant 2 mM Ca2+ produces a 42% increase in peak inward current through TCav3 elicited by a voltage step from −110 to −45 mV (black and red current traces, respectively), indicative of a moderate mixing of inward Ca2+ and Na+ ions in macroscopic currents. (B) Mean percent increase in peak inward current at −45 mV (±SE), upon replacement of 135 mM external NMDG+ with equimolar Na+ in the presence of 2 mM external Ca2+, for TCav3 compared with previously published data for other cloned Cav3 channels (Senatore et al., 2014; Stephens et al., 2015). (C) Macroscopic currents for TCav3 are larger in the presence of 2 mM external Ca2+ versus Ba2 (inset), where mono-exponential curves fitted over activation and inactivation phases of the current waveforms (τinact and τinact, respectively) reveal statistically indistinguishable kinetics under one-way ANOVA. Plotted values represent mean ± SE. (D) Corresponding IV plots for mean peak Ca2+ versus Ba2+ currents (±SE) reveal a 2.29-fold increase in maximal peak inward current when Ca2+ is present in the extracellular solution instead of Ba2+. (E) Replacing 100 mM impermeant external cation NMDG+ with Na+, in the presence of invariant 2 mM external Ba2+, produces a 51% increase in peak inward current through TCav3 elicited by a voltage ramp from −110 to 100 mV (black and red current traces, respectively), indicative of a moderate mixing of Ba2+ and Na+ ions in macroscopic currents. (F) Mean percent increase in peak inward current using the voltage ramp protocol (±SE), upon replacement of 135 mM external NMDG+ with equimolar Na+ in the presence of 2 mM external Ba2+, for TCav3 compared with previously published data for other cloned Cav3 channels (Stephens et al., 2015). Asterisks depict statistical significance (p-values) for comparisons of means for increased inward current with Na+ relative to TCav3 (generated by one-way ANOVA; *, P ≤ 0.05; ***, P ≤ 0.0005).

Ca2+ versus Ba2+ permeability does not predict the amplitude of mixed divalent-monovalent cation currents through T-type channels

T-type channels are highly permeable to divalent cation Ba2+, where for reasons that are unclear, the three rat Cav3 channel isotypes have dissimilarities with respect to macroscopic Ca2+ versus Ba2+currents in vitro (Talavera and Nilius, 2006): Cav3.1 conducts larger Ca2+ currents, Cav3.2 conducts larger Ba2+ currents, and Cav3.3 conducts equal Ca2+ and Ba2+ currents (McRory et al., 2001). Here, we found TCav3 to be similar to rat Cav3.1, where replacing 2 mM external Ba2+ with equimolar Ca2+ by perfusion produced an increase in current amplitude upon membrane depolarization from −110 mV (Fig. 10 C), with a 2.29-fold increase in maximal peak inward current visible on IV plots (Fig. 10 D). It appears as though the difference in macroscopic Ca2+ versus Ba2+ current amplitude for TCav3 is not attributable to differences in activation/inactivation kinetics in the presence of either ion, as was shown for rat Cav3.1 (Khan et al., 2008), where mono-exponential curves fitted over activation and inactivation phases of macroscopic currents for Ba2+ versus Ca2+ produce statistically indistinguishable τ time constants across all depolarizing voltages (Fig. 10 C). Interestingly, the Lymnaea T-type channel, which can alter its Ca2+ versus Na+ permeation properties via alternative splicing of exons 12a and 12b, nevertheless always conducts approximately twofold larger Ba2+ than Ca2+ currents in vitro, regardless of exon 12 splicing (Senatore and Spafford, 2010; Senatore et al., 2014). Differences in Ca2+ versus Ba2+ permeation among the various in vitro–expressed T-type channels have no consequence for the pattern in fold increases in peak inward current upon addition of external Na+. Comparing the fold increase in peak macroscopic current through TCav3 elicited by ramping the voltage from −110 to 100 mV in the presence of 2 mM Ba2+ and either 100 mM Na+ or NMDG+ (Fig. 10 E) with previously published data from other in vitro–expressed channels (Senatore et al., 2014; Stephens et al., 2015) reveals a similar ranking in Na+ permeation as observed in the presence of 2 mM external Ca2+: LCav3-12a >> LCav3-12b > TCav3hCav3.3 > hCav3.2 > hCav3.1 (i.e., compare Fig. 10, B and F).

Ca2+ block of TCav3 Na+ currents indicates high-affinity pore binding of external Ca2+, similar to human Cav3.1

At extremely low concentrations of external Ca2+, all Cav channels conduct prominent Na+ currents. Titrating increasing concentrations of extracellular Ca2+ leads to a block of Na+ current, with a sensitivity that reflects the affinity of Ca2+ to binding sites located in the pore. As [Ca2+]out increases, the blocking effect reaches saturation levels, then Ca2+ itself becomes abundant enough to occupy multiple sites within the pore, leading to Ca2+ permeation (Tsien et al., 1987; Sather and McCleskey, 2003; Cheng et al., 2010; Buraei et al., 2014; Tang et al., 2014). This property, of a decrease in Na+ current amplitude and a subsequent rise in Ca2+ current as [Ca2+]out increases (known as the Ca2+ block effect), is exemplified by peak currents through human Cav3.1 elicited by repeating voltage steps from −110 to −35 mV, whereas external Ca2+ is perfused from 1 nM to 10 mM in the presence of invariant 60 mM external Na+ (Fig. 11 A; Senatore et al., 2014). Notably, the TCav3 Ca2+-block data are similar to previously published data for human Cav3.1 (Senatore et al., 2014; Stephens et al., 2015), where at 10 µM [Ca2+]out, 97.3% and 96.1% of peak Na+ current elicited by voltage steps to −35 mV were blocked, respectively (Fig. 11, A and B). Human Cav3.1 Na+ currents appear to be slightly more sensitive to Ca2+, where at 0.1 µM [Ca2+]out, 34.1% of Na+ current was blocked, whereas TCav3 and the two exon 12 variants of LCav3 only exhibit between −5.6 and 4.6% block. Beyond 10 µM [Ca2+]out, TCav3 and Cav3.1 show 13.8- and 9.4-fold increases in peak current caused by an emerging Ca2+ conductance (Fig. 11, A and C). In contrast, LCav3-12b shows a moderate reduction in Ca2+ block (82.6%), whereas the highly sodium-permeant LCav3-12a has a dramatically right-shifted dose–response for Ca2+ (Fig. 11 A), with only 44.5% of current blocked at 10 µM Ca2+ (Fig. 11 B; Senatore et al., 2014). Also noticeable is a continued decline in current amplitude beyond 10 µM [Ca2+]out for the Lymnaea channel variants (Fig. 11 A), most marked for LCav3-12a, with a sevenfold continued decrease in current from 10 µM to 10 mM external Ca2+ (Fig. 11 C), further reflecting the reduced affinity for Ca2+ in the LCav3 pore. Collectively, the Ca2+ block data indicates that TCav3 exhibits a potent, but perhaps slightly diminished Ca2+-block of Na+ currents compared with human Cav3.1. Instead, the two exon 12 variants of Lymnaea Cav3 exhibit moderately attenuated and extremely attenuated Ca2+ block, indicative of lowered binding affinity for Ca2+ along the extracellular surface of the channel pore. Ca (A) Ca2+ block of Na+ currents for TCav3 compared with previously published data for human Cav3.1 and the two exon 12 splice variants of the Lymnaea channel, LCav3-12a and LCav3-12b (Senatore et al., 2014). Increasing external [Ca2+] from 1 nM to 10 mM, in the presence of invariant external [Na+] of 60 mM, blocks Na+ currents through TCav3 with similar affinity as human Cav3.1, where at 10 µM external Ca2+ (i.e., 10−5 [Ca2+]out), mean peak inward currents (±SE) for Cav3.1and TCav3, elicited by voltage steps from −110 to −35 mV, show substantial attenuation from maximum (I/Imax). Instead, exon 12 variants of LCav3 show a reduced Ca2+ block, most dramatically for LCav3-12a. (B) Mean percent block of inward Na+ currents (±SE) for the various Cav3 channels at 10 and 0.1 µM [Ca2+]out. Asterisks depict statistical significance (p-values) for comparisons of means for percent block relative to TCav3 (generated by one-way ANOVA; *, P ≤ 0.05; **, P ≤ 0.005; ***, P ≤ 0.0005). (C) Mean fold increase/decrease in I/Imax for the various cloned channels (±SE) as [Ca2+]out is increased from 10 µM to 10 mM. Asterisks depict statistical significance (p-values) for comparisons of means for fold change in current relative to TCav3 (generated by one-way ANOVA; *, P ≤ 0.05; ***, P ≤ 0.0005).

Ca2+ block, and not Ca2+ selectivity, determines the degree of Na+ permeation through T-type channels

To further understand the Na+ permeation properties of TCav3, we characterized its Ca2+ versus monovalent cation selectivity by measuring zero-current reversal potentials (ERev) under bi-ionic conditions (i.e., 4 mM Ca2+out and 100 mM Li+in, Na+in, K+in, or Cs+in). The reversal potential of peak bi-ionic currents is determined by the pore’s preference for inward-permeating Ca2+, which pulls ERev toward more positive voltages, versus outward-permeating monovalent cations (i.e., X+, where X = Li, Na, K, or Cs), which pull ERev toward more negative voltages. Depolarizing voltage steps from −90 to 70 mV under the four bi-ionic conditions (i.e., Ca2+out-Li+in, Ca2+out-Na+in, Ca2+out-K+in, and Ca2+out-Cs+in) produce markedly different outward current components for TCav3, with decreasing amplitudes from Li+ to Na+ to K+ to Cs+ (Fig. 12 A), reflecting the pore’s decreasing permeability to monovalent cation flow according to the Eisenman selectivity model (i.e., ions with smaller radii are more permeable through a narrow pore: Li+ < Na+ < K+ < Cs+ with respect to radius; Eisenman et al., 1967; Eisenman and Horn, 1983). Correspondingly, ERev values for the four bi-ionic IV plots for TCav3 have leftward shifts corresponding to increased monovalent permeation from Cs+ to Li+ (Fig. 12 B). Converting ERev values to permeability ratios PCa/PX using the bi-ionic Nernst equation (Senatore et al., 2014), which reflect the pore’s preference for Ca2+ over monovalent X+, reveals that the Trichoplax channel is poorly selective for Ca2+ over X+ monovalents compared with human Cav3.1 (Stephens et al., 2015), falling between previously published values for Lymnaea LCav3-12a and LCav3-12b variants for PCa/PNa and PCa/PK (Fig. 12 C; Senatore et al., 2014). Interestingly, TCav3 is the most Li+-permeable channel, whereas the Cs+ permeability for all non-deuterostome channels is roughly equal and significantly higher than human Cav3.1. Bi-ionic reversal potential analysis of TCa (A) Sample current traces recorded for TCav3 recorded under different bi-ionic conditions, with 4 mM [Ca2+]out and 100 mM [X+]in (X = Li, Na, K, or Cs), reveal increasing outward current amplitudes from Cs+ to K+ to Na+ to Li+, reflecting increasing permeability with decreasing ionic radius, consistent with the Eisenman model of permeability through a narrow pore (Eisenman et al., 1967; Eisenman and Horn, 1983). (B) Decreasing permeability for Ca2+ over X+, from Cs+ to Li+, is measured by zero-current reversal potentials (ERev) on IV plots, which represent voltages at which inward-flowing Ca2+ and outward-flowing X+ ions are at equilibrium. (C) Converting ERev values to relative permeabilities for Ca2+ over X+ (i.e., PCa/PX), using the bi-ionic Nernst equation, reveals that TCav3 is poorly selective for Ca2+ over X+ ions, with a Ca2+-selectivity profile that falls between the extremely Na+-permeable LCav3-12a and the moderately Na+-permeable LCav3-12b. (D) A zoomed-out view of the IV plot in B reveals three conductance states for TCav3 (i.e., the slope of current I/Imax as a function of depolarizing voltage), with an inward conductance (GIn) at voltages that favor inward Ca2+ flow, a rectifying conductance across the reversal potential (GRev) where Ca2+ and X+ ions are competing for permeation, and an outward conductance (GOut) where the voltage favors outward flow of monovalent cations. (E) Comparing the three different conductance states for TCav3 with those of the two exon 12 variants of LCav3 and the human Cav3.1 channel places TCav3 somewhere between Cav3.1 and LCav3-12b. Asterisks depict statistical significance (p-values) for differences between mean conductance relative to TCav3 (one-way ANOVA; *, P ≤ 0.05; **, P ≤ 0.005; ***, P ≤ 0.0005). All values for B–E represent mean ± SE. Ca2+ versus X+ permeability features of T-type channels are also reflected in the rectification of macroscopic bi-ionic currents, where three conductance states are evident on IV plots: (1) an inward conductance at voltages where the driving force favors inward flow of Ca2+ (GIn); (2) a conductance through ERev where a transition between inward Ca2+ and outward X+ occurs, (GRev); and (3) an outward conductance where driving force favors outward X+ flow (GOut; Fig. 12 D and Fig. S3). Comparison of the three conductance states of TCav3 with previously published data for other in vitro–expressed T-type channels (Senatore et al., 2014; Stephens et al., 2015) corroborates a low Ca2+ selectivity for the Trichoplax Cav3 channel compared with human Cav3.1. Both GRev and GOut values for TCav3, which reflect permeability to monovalent cations, are significantly larger than those of Cav3.1, regardless of monovalent cation type (Fig. 12 E). Indeed, Cav3.1 is very ineffective at conducting outward monovalent currents, even at extremely depolarized potentials >60 mV (Fig. 12 D and Fig. S3). Cav3.1 also has the largest conductance for inward Ca2+ flow (GIn), but noticeably, under the most physiological conditions with K+ present in the internal saline, the GIn Ca2+ conductance for TCav3 encroaches on that of Cav3.1 (i.e., means are not statistically different; Fig. 12 E). At the other extreme, the Lymnaea channel LCav3-12a has the lowest conductance for inward Ca2+ (GIn) and the largest monovalent conductances through ERev and outwards (GRev and GOut, respectively; Fig. 12 D and Fig. S3). Collectively, the bi-ionic reversal potential data indicate that the TCav3 channel pore is poorly selective for Ca2+ over monovalents compared with human Cav3.1, with bi-ionic selectivity properties more similar to those of highly Na+-permeant LCav3-12a and the more Ca2+-selective LCav3-12b channels (Table 2). In light of these data, it is apparent that Ca2+ block, and not Ca2+ selectivity, is the major determinant for the degree of Na+ that permeates through TCav3 and other T-type channels. Indeed, the efficiency of Ca2+ block for the various cloned T-type channels (Cav3.1 > TCav3 > LCav3-12b > LCav3-12a; Fig. 11) correlates with their degree of Na+ permeation (e.g., 21.0%, 29.6%, 60.5%, and 93.5% of total current carried by Na+, respectively; measured by dividing percentage increases in peak current shown in Fig. 10 B by that same value plus 100%).

Discussion

TCav3 is the most divergent metazoan T-type calcium channel

Cav3 channels appear to have emerged upwards of a billion years ago in a eukaryotic ancestor of choanoflagellates and metazoans (Morris, 1998), being present in the genome of S. rosetta (Fairclough et al., 2013; Moran and Zakon, 2014). We were unable to find a Cav3 channel homologue in the genome of choanoflagellate Monosiga brevicollis (King et al., 2008), indicative of either gene loss or an incomplete genome sequence. We also failed to identify Cav3 channel genes in various genomes and transcriptomes available for sponges and ctenophores (Srivastava et al., 2010; Ryan et al., 2013; Moroz et al., 2014; Fernandez-Valverde et al., 2015), suggesting that these two phyla lost Cav3 channels. Analysis of various Cav3 channel gene exon/intron structures revealed a general trend toward increased intron/exon number from choanoflagellates to vertebrates, with the Salpingoeca Cav3 gene bearing 13 exons from start codon to stop codon, Trichoplax Cav3 bearing 28 exons, Nematostella Cav3a bearing 30 exons, and mouse Cav3.1 bearing 38 exons (Fig. 3). Such an increase in intron number from premetazoans, to early diverging metazoans, to bilaterians is consistent with observed trends at the whole-genome level (King et al., 2008). Interestingly, Cav3 channel genes from bilaterians appear to have undergone the most significant changes in intron/exon structure within coding sequences for channel structures associated with modulation of function, such as optional exon 8b found in mouse Cav3.1 and Lymnaea Cav3, which regulates channel membrane expression (Senatore and Spafford, 2012); mouse exons 14–17 in the II–III linker, which serve as a hotbed for modulation by kinases and G-proteins (Chemin et al., 2006; Perez-Reyes, 2010b; Senatore et al., 2012); exons 25c and 26 in the III–IV linker, which in both vertebrates and protostome invertebrates cause alterations in channel voltage-gating and kinetics (Senatore and Spafford, 2012); the C terminus, where vertebrate Cav3 channels physically interact with other ion channel types such as Ca2+-modulated A-type K+ channels (Anderson et al., 2010); and SNARE proteins, which facilitate T-type channel involvement in low-threshold exocytosis (Weiss et al., 2012). Indeed, if a similar pattern extends to numerous other gene orthologues in the metazoan genome, it might account for some of the apparent increase in anatomical, cellular, and molecular complexity of vertebrates and bilaterians compared with more early diverging animals (Valentine et al., 1994), in spite of comparable total gene counts. Despite its comparative simplicity at the gene structure level, the TCav3 protein sequence retains all of the hallmark structural features of four-domain channels, with four homologous repeat domains, each containing extracellular turret-containing P-loops separated by pore-forming S5 and S6 helices, and voltage-sensor modules (S1 to S4 helices), with S4 helices packed with positively charged lysine (K) and arginine (R) residues critical for voltage sensing (Fig. 1 A; Catterall, 2010). In addition, TCav3 bears the three most prominent structural features that distinguish Cav3 channels from Cav1 and Cav2 types: (1) a selectivity filter motif with two aspartates (D) instead of two glutamates (E) in the P-loops of domains III and IV (i.e., EEDD vs. EEEE); (2) the absence of a calmodulin-binding isoleucine-glutamine (IQ) motif in the C terminus, which permits modulation of Cav1 and Cav2 channels by cytoplasmic Ca2+ influx (Ben-Johny et al., 2014); and (3) a predicted helix-turn-helix gating brake structure in the domain I–II intracellular linker, in an analogous region where Cav1 and Cav2 channels bind accessory Cavβ subunits via a distinct structure called the α interaction domain (AID; Perez-Reyes, 2010a).The absence of an AID in T-type channels highlights another distinguishing feature, which is a lack of dependence on Cavβ subunits. For Cav1 and Cav2 channels, Cavβ as well as Cavα2δ subunits are obligate counterparts that complex with the channels to regulate gating, trafficking, and proteolytic turnover (Arikkath and Campbell, 2003; Richards et al., 2004; Altier et al., 2011). Instead, T-type channels function as separate entities, with an autonomous gating brake serving in lieu of the AID/Cavβ subunit, which nevertheless also regulates channel gating (Perez-Reyes, 2010a). Even the most basal of all known T-type channels, from S. rosetta, bears a predicted gating brake motif in its I–II linker (Fig. 2 D). The structural distinction between AIDs of high voltage–activated Cav1/Cav2 channels and gating brakes of low voltage–activated Cav3 channels thus appears to have ancient origins predating Metazoa. However, given the similar helical arrangement that extends into the cytoplasm from the domain I S6 helix, it is conceivable that both structures evolved via divergence from a helical structure present in an ancient Cav channel ancestor of Cav1/Cav2 and Cav3 channels.

Localization of TCav3 channel in gland cells

In bilaterians, the three types of Cav channels are specialized to carry out distinct and pivotal roles in neurons and muscle, and other excitable cell types, where they translate electrical signals of Nav, Kv, and synaptic ligand-gated cation channels into cellular events by coupling with Ca2+-sensitive cytoplasmic proteins (Berridge, 2006; Rizzuto and Pozzan, 2006). Cav1 channels are most classically associated with excitation-contraction coupling in muscle, as well as excitation-transcription coupling in neurons and muscle, and Cav2 channels are associated with fast presynaptic exocytosis of neurotransmitters (excitation-secretion coupling; Catterall, 2011). Instead, Cav3 channels have long eluded such a stereotyped and ubiquitous classification, where their roles tend to vary depending on cell type, ranging from regulating cellular excitability in select neurons and other excitable cells, to driving low-threshold exocytosis in select neurons and neurosecretory cells, to regulating tone and contraction of various muscle cell types (Perez-Reyes, 2003; Senatore et al., 2012). Trichoplax is very interesting in its highly simplified cellular body plan, bearing only six cell types: ciliated dorsal and ventral epithelial cells, with ventral epithelial cells responsible for ciliary locomotion (i.e., gliding along hard surfaces); crystal cells, which bear internal birefringent crystals with unknown function (Smith et al., 2014); fiber cells, positioned between the epithelial cell layers and proposed to be contractile in nature (Behrendt and Ruthmann, 1986; Smith et al., 2014); gland cells, proposed to play roles in paracrine signaling and which resemble neurons and neurosecretory cells in their expression of exocytotic SNARE proteins and membrane-apposed vesicles (Grell and Ruthmann, 1991; Smith et al., 2014); and ventral lipophil cells, also apparently exocytotic in nature but specialized for secretion of hydrolytic enzymes for external digestion of algae during feeding (Smith et al., 2014, 2015). The apparent morphological, anatomical, and ultrastructural similarly of Trichoplax cell types with those from more complex animals (i.e., epithelial, neuron/neuroendocrine, muscle, and digestive) is suggestive of cellular homology at the level of genes and proteins. In accordance, the presence of numerous genes in the Trichoplax genome crucial for cell-specific functioning (Srivastava et al., 2008), including those for generating and packaging neurotransmitters and neuropeptides (Nikitin, 2015), cellular excitability (e.g., Nav2 and Kv channels, K+ leak channels; Senatore et al., 2016), and muscle contraction (Steinmetz et al., 2012), suggests that homologous molecular processes are taking place in some of these cell types. Here, we extend the apparent homology of gland cells with neurons and neuroendocrine cells in our localization of TCav3 to this cell type (Fig. 4), suggesting that the cells undergo rapid fluxes in membrane voltage and transient rises in cytoplasmic [Ca2+], perhaps for engaging Ca2+ sensitive elements of the exocytotic machinery. A Ca2+ dependence for gland cell exocytosis is further suggested by their expression of complexin, a Ca2+-responsive regulator of the SNARE complex and vesicle fusion (Yoon et al., 2008), and further, by the presence of synaptotagmin in the genome (Srivastava et al., 2008), a key Ca2+ sensor for exocytotic release which interacts with complexin during fusion (Tang et al., 2006). We note from our RT-PCR experiment that beyond the Cav3 channel, Trichoplax expresses Cav1 and Cav2 channels at the whole-animal mRNA level, as well as the single Cavβ and three Cavα2δ accessory subunit genes (Fig. 5). If the Cav1 and/or Cav2 channels are similarly localized to gland cells, TCav3 might thus serve to activate the high voltage–activated channels that in turn drive vesicle fusion and exocytosis, as is common in neuroendocrine cells (Mansvelder and Kits, 2000). Notably, the apparent enrichment of TCav3 along the outward-facing area of gland cells (Fig. 4), where the SNARE proteins and membrane-apposed vesicles were previously shown to reside (Smith et al., 2014), is suggestive of a more direct involvement in exocytosis, perhaps driving graded exocytosis before action potential threshold as occurs in select vertebrate and invertebrate neurons and neurosecretory cells (Carbone et al., 2006; Weiss and Zamponi, 2013; Senatore et al., 2016). In vertebrates, a direct interaction between Cav3 channels and SNARE proteins syntaxin-1A and SNAP-25 has been documented (Weiss et al., 2012), tethering the channels close to Ca2+-sensitive elements of the exocytotic machinery. The expression of TCav3 in gland cells implies that the use of T-type channels in regulating excitation and secretion of neuron/neuroendocrine-like cells might have evolved very early on, at least in the ancestor of placozoans and cnidarians/bilaterians, but perhaps even further back, in the single-celled ancestor of choanoflagellates and metazoans, which possessed a T-type channel gene as well as the core elements of the exocytotic apparatus (King et al., 2008; Fairclough et al., 2013; Moran and Zakon, 2014).

Difficult expression of TCav3 in HEK-293T cells

Our first efforts to express the cloned TCav3 channel in HEK-293T cells for electrophysiological recording were unsuccessful. Instead, we found that coexpression with rat Cavβ1b and Cavα2δ1 accessory subunits of high voltage–activated Cav1 and Cav2 channels dramatically increased channel expression either as a fusion protein with EGFP, or as a separate protein recordable via whole-cell patch clamp. Interestingly, Cavβ and Cavα2δ subunits increase membrane expression of high voltage-activated Cav channels in part by blocking their internalization and proteasomal degradation (Bernstein and Jones, 2007; Altier et al., 2011; Dolphin, 2012), although the process seems to depend on direct interactions between the subunits and the channel proteins. We do not necessarily expect direct protein–protein interaction between TCav3 and the Cavβ1b and Cavα2δ1 accessory subunits because such an interaction has yet to be reported for any other cloned vertebrate or invertebrate T-type channel (Dubel et al., 2004; Senatore and Spafford, 2010; Dawson et al., 2014; Cens et al., 2015; Jeong et al., 2015). However, given the overlapping emergence of Cav1/Cav2 channels, Cav3 channels, and the Cavβ subunit in a premetazoan ancestor (Dawson et al., 2014; Moran and Zakon, 2014), the possibility exists that ancestral T-type channels and those from extant basal organisms such as Trichoplax physically interact with high voltage-activated Cavβ1b and Cavα2δ1 subunits. Here, we found that rat Cavβ1b and Cavα2δ1 subunits significantly increased ectopic expression of GFP expressed in the absence of TCav3 (Fig. 6), indicating that their effect on ectopic protein expression might at least in part be a result of nonspecific processes.

The biophysical properties of TCav3 are consistent with roles in regulating gland cell excitability

One of the most clear cellular functions of Cav3 channels is regulating excitability (Perez-Reyes, 2003; Senatore et al., 2012), invoking their low voltages of activation and fast, transient kinetics. For example, mammalian Cav3.2 calcium channels are enriched in pain-sensing neurons, where they amplify depolarizing sensory inputs to increase nociceptive signaling to the spinal cord (Bourinet et al., 2005; Rose et al., 2013). Similarly, in the brain, neuronal Cav3 channels are enriched along dendrites (McKay et al., 2006), where they boost postsynaptic excitatory potentials to increase the likelihood of eliciting action potentials (Perez-Reyes, 2003; Senatore et al., 2012). In some cases, the rapid kinetics and low voltages of activation of Cav3 channels enable them to function in lieu of Nav channels where they can drive Ca2+ action potentials, as occurs in striated muscle cells from jellyfish (Lin and Spencer, 2001), snail cardiomyocytes (Yeoman et al., 1999; Senatore et al., 2014), and C. elegans pharyngeal muscle (Steger et al., 2005). Here, we show that the biophysical properties of the Trichoplax Cav3 channel are consistent with a role in regulating excitability in gland cells. Inward Ca2+ currents recorded from HEK cells expressing recombinant TCav3 emerge upon slight membrane depolarization from a holding potential of −110 mV (Fig. 7, A and B), indicating that like all other in vitro–expressed Cav3 channels, TCav3 is low voltage activated. In fact, TCav3 has the lowest voltage dependency for activation of any cloned T-type channel, with a 5 mV more negative maximal peak inward current than Lymnaea Cav3, and 10 to 20 mV more negative than the three mammalian isotypes, Cav3.1 to Cav3.3 (Fig. 7 B and Table 2). Accordingly, Boltzmann transformation of the peak current–voltage (IV) plot for TCav3, into an activation curve (Fig. 7 C), reveals a half-maximal activation considerably left-shifted compared with other Cav3 channels. Instead, the channel’s half-maximal steady-state inactivation is roughly similar to those of other channels (Table 2). TCav3 currents also have reasonably fast activation and inactivation kinetics, which although marginally slower than Lymnaea Cav3 and the mammalian Cav3.1/Cav3.2 isotypes, are considerably faster than those of Cav3.3, the slowest of the vertebrate T-type channels (Table 2). TCav3 is thus capable of conducting fast inward Ca2+ currents upon slight membrane depolarization, with a lower voltage threshold than other T-type channels, while being equally subject to voltage-dependent inactivation. These features indicate that TCav3 is poised to be more active at threshold voltages compared with other T-type channels. Furthermore, the particularly slow deactivation kinetics for TCav3, at voltages near −70 mV (Table 2), would serve to counter Kv channel–driven action potential repolarization, effectively widening action potentials and increasing net Ca2+ influx. Overall, the voltage dependencies and kinetic properties of TCav3 are most similar to those of fellow invertebrate T-type, Lymnaea Cav3, and least to those of mammalian Cav3.3 (Table 2). What is striking is that upon side-by-side comparison of biophysical properties of various cloned Cav3 channels, the structurally divergent Trichoplax homologue, which is >600 million years separated from mammalian isotypes, is more similar to mammalian Cav3.1 and Cav3.2 than is Cav3.3. Indeed, there appear to have been strong evolutionary constraints on the TCav3 channel to retain a core set of biophysical properties, suggesting that the need for its cellular contributions are conserved even in the absence of neurons and muscle. An important caveat toward speculation about the physiological roles for TCav3 in vivo is that its contributions would ultimately depend on the membrane potential, which is controlled by a milieu of electrogenic proteins. Although Trichoplax has the majority of these electrogenic genes (Srivastava et al., 2008; Senatore et al., 2016), suggesting that some of its cells have polarized resting membrane potentials and exhibit rapid fluxes in membrane voltage such as action potentials, the membrane properties of Trichoplax cells have yet to be reported. We and others have attempted intracellular recording of isolated Trichoplax cells, but their small size (<10-µm diameter) and particular membrane features make obtaining a gigaohm seal during patch-clamp recording particularly difficult. Based on the biophysical properties of TCav3, we can speculate that if the resting membrane potential of a typical Trichoplax cell sits above −60 mV, the channel would not contribute to excitability because of inactivation (Fig. 7 C). However, transient hyperpolarization from such potentials could recruit the channel by removing inactivation, where it would contribute to postinhibitory rebound (PIR) excitation. In mammals, T-type channel-mediated PIR excitation plays an important role in certain neuronal circuits, such as the thalamus, where postinhibitory Ca2+ spikes support rhythmic bursts of action potentials that project to the cortex and gate sensory information during non-REM sleep (Lee et al., 2004; Anderson et al., 2005; Crunelli et al., 2006). Notably, TCav3 and the Cav3 channel from Lymnaea have a slower recovery from inactivation than mammalian channels (Table 2), so they would require more prolonged hyperpolarization to be recruited for PIR excitation. Finally, even if Trichoplax cells do not undergo rapid changes in membrane voltage, T-type channels could nevertheless contribute a consistent steam of Ca2+ into the cytosol through a window current (Fig. 7 C), which can be used by cells to transition between bimodal resting membrane potentials (Dreyfus et al., 2010) and are associated with cellular proliferation during development and cancer (Lory et al., 2006; Senatore et al., 2012; Gackière et al., 2013).

TCav3 resembles mammalian Cav3 channels with respect to Na+ permeation

Previous work examining altered Na+ permeation of the Lymnaea T-type channel, caused by alternative splicing of exons 12a and 12b in a region of the domain II P-loop called the turret, revealed that factors outside of the selectivity filter can nevertheless have important consequences for defining Ca2+ versus Na+ permeation. However, based on these studies, it is difficult to reconcile differences in permeation properties among Cav3 channels purely on the structure of exon 12, where in Lymnaea, the smaller exon 12a imposes extreme Na+ permeability (i.e., 93.5% of current carried by Na+; Fig. 10 B: 1,440 ÷ 1,540% = 93.5%), whereas in mammalian channels, homologous 12a-like exons produce only moderate Na+ permeability (∼21.0%, 24.3%, and 31.3% for Cav3.1, Cav3.2, and Cav3.3, respectively). We found the basal TCav3 channel to resemble mammalian channels, with ∼29.6% of inward current carried by Na+, making it statistically indistinguishable from Cav3.2 and Cav3.3 (Table 2). Indeed, a low Na+ permeability for T-type channels bearing exon 12a–like turrets extends to other non-protostome channels that span the lineages between placozoans and mammals, including those from cnidarians (i.e., jellyfish; Lin and Spencer, 2001) and deuterostomes (i.e., echinoderm starfish eggs; Hagiwara et al., 1975), where T-type currents were reported to be carried mostly by Ca2+. Based on the available data, one explanation for the emergence of altered Na+ permeation in the snail and other protostome T-type channels via exon 12 splicing is that after dupliction of exon 12, structural alterations took place outside of the exon 12 region, rendering 12a-bearing channels more Na+ permeable. The duplicated exon 12b, unique to protostomes, was possibly adaptated to retain Ca2+ conducting channels via enlargement relative to exon 12a by ∼11 aa and increase in cysteine content from 0–3 to ∼5. In Lymnaea, exon 12b produces a channel more in line with non-protostome 12a-like channels, from Trichoplax through to mammals, with only ∼60.5% of current carried by Na+. Interestingly, the degree of co-permeation of Na+ alongside Ca2+ for the various cloned T-type channels seems to hold true even in the presence of Ba2+, which can exhibit increased or decreased permeation relative to Ca2+ in a channel-dependent manner. Like rat Cav3.1, TCav3 conducts larger Ca2+ currents than Ba2+ currents in vitro, whereas rat Cav3.2, LCav3-12a, and LCav3-12b all conduct larger Ba2+ currents and rat Cav3.3 conducts equal Ca2+ and Ba2+ currents (McRory et al., 2001). Despite these differences, the pattern of fold increases in peak inward current for the various channels upon replacement of impermeant external NMDG+ with Na+ is consistent regardless of whether Ca2+ or Ba2+ is present in the extracellular solution (Fig. 10). As such, it appears as though the factors that determine macroscopic conduction preference among divalent cations are different from those that determine preference between divalent versus monovalent cations. Notably, a previous study found that NMDG+ might directly block inward current through T-type channels (Khan et al., 2008), potentially confounding loss of current amplitude caused by replacement of Na+ in our experiments. However, for the snail T-type channel exon 12a and 12b variants, we previously found that replacement of Na+ with impermeant Tris+ resulted in a similar pattern of current attenuation compared with NMDG+ (Senatore, 2012), suggesting that the major effect on T-type channel current amplitude in these experiments is caused by Na+ depletion, and not NMDG+ block.

Ca2+ block versus Ca2+ over Na+ selectivity in defining T-type channel cation permeability

We sought to identify different aspects of cation permeation through T-type channels that could account for their varying Na+ permeabilities. For high voltage–activated Cav1 and Cav2 channels, which are considerably better than T-types at selecting for Ca2+ (e.g., compare 21–90% Na+ current for Cav3 channels with <0.1% for Cav1/Cav2; Tsien et al., 1987; Sather and McCleskey, 2003; Shcheglovitov et al., 2007; Cheng et al., 2010; Buraei et al., 2014; Tang et al., 2014), selectivity for Ca2+ is attributed to the ability of the ion to associate with a high-affinity binding site at the extracellular surface of the pore to repel and block inward Na+ flux (i.e., Ca2+ block). T-type channels are also expected to bind Ca2+, but their reduced selectivity is attributed to a ∼10-fold lowered binding affinity and reduced Ca2+ block (Shcheglovitov et al., 2007). We compared the Ca2+ block properties of various Cav3 channels, revealing that TCav3 shares with mammalian channels a potent Ca2+ block, indicated by rapidly attenuating Na+ currents as Ca2+ is incrementally added to the extracellular solution (Fig. 11). By stark contrast, exon 12 variants of LCav3 exhibit a reduction in Ca2+ block that is most extreme for LCav3-12a, for which the Ca2+ titration curve does not exhibit the classic U shape (where decreasing Ca2+-blocked Na+ currents gradually give way to increasing Ca2+ currents as [Ca2+]out increases; Fig. 11 A). Instead, the channels exhibit continued decline through to 10 mM [Ca2+]out, reflecting dramatically reduced Ca2+ binding affinity in the pore. Altogether, the Ca2+ block properties of the different Cav3 channels (Fig. 11) correlate with their respective Na+ permeabilities, apparent in Na+/NMDG+ replacement experiments (Fig. 10 B): TCav3 and human Cav3.1 have the most potent Ca2+ block and lowest Na+ permeability, and LCav3-12a and LCav-12b have reduced Ca2+ block proportional to their respective increases in Na+ permeability. However, we point out a minor inconsistency between our Ca2+-Na+ permeation data (Fig. 10) and our Ca2+ block data (Fig. 11). Whereas the Ca2+ block data suggests that at near-physiological external Ca2+ concentrations (i.e., 1 mM [Ca2+]out), most of the Na+ current has been blocked for all T-type channels (Fig. 11, A and B), replacement of 135 mM NMDG+ with Na+ in the presence of 2 mM [Ca2+]out causes significant increases in peak inward current (most marked for LCav3-12a), reflecting additive Na+ currents over already present Ca2+ currents (Fig. 10, A and B). So a question arises: why in 2 mM Ca2+ can you observe a considerable additive Na+ current via NMDG+ replacement, whereas 1–3 mM Ca2+ seems to mostly block the Na+ currents? We explain this inconsistency by noting that in Ca2+ block experiments, there are considerable residual currents, ranging in amplitudes from 100–200 pA (i.e., for LCav3-12b) to 100–800 pA (for LCav3-12a), which persist despite saturation in the Ca2+ block effect. We suggest that these residual currents represent combined Ca2+/Na+ currents, which would be differentially attenuated if the Na+ ions were to be replaced with impermeant NMDG+, consistent with the Na+/NMDG+ substitution data (Fig. 10, A, B, E, and F). TCav3 appears to be slightly more Na+ permeable than human Cav3.1, in part because of a slightly reduced Ca2+-block and pore Ca2+-binding affinity (Fig. 11, A and B). However, other aspects of the pore might influence the degree of Na+ permeation. Our bi-ionic reversal potential experiments, which approximate the preference of a given channel pore for inward-flowing Ca2+ ions versus outward-flowing monovalents (i.e., Li+, Na+, K+, and Cs+), revealed that TCav3 was considerably less selective for Ca2+ than human Cav3.1 (e.g., PCa/PNa = 35.61 ± 1.52 vs. 89.56 ± 8.21, respectively), falling between the more Na+ permeable channels LCav3-12a (33.06 ± 1.50) and LCav3-12b (41.49 ± 1.98). Indeed, if preference for Ca2+ over monovalents measured under bi-ionic conditions was the major determinant for Na+ permeation, then we would expect TCav3 to conduct a much higher proportion of inward Na+ upon depolarization, most similar to the LCav3-12a variant (Fig. 10 B). Instead, the selectivity for Ca2+ over monovalents in the TCav3 channel pore seems somewhat inconsequential, where 29.6% of the total current is carried by Na+, which is more similar to Cav3.1 (21.0%) than either LCav3-12b (60.5%) or LCav3-12a (93.5%). As such, Ca2+ block appears to be more consequential for determining Na+ permeation than is Ca2+ over Na+ selectivity. Instead, Ca2+ selectivity appears to play a more marginal role, possibly accounting for the 8.6% increase in Na+ permeability for TCav3 relative to Cav3.1. Finally, we also find an interesting inverse correlation between conductance values across bi-ionic reversal potential (GRev) and outward monovalent current flow (GOut) versus the potency of the Ca2+-block effect: whereas LCav3-12a has the largest GRev and GOut values and the weakest Ca2+ block, Cav3.1 has the smallest GRev and GOut values and the strongest Ca2+ block (compare Fig. 11 B with the top two panels of Fig. 12 E). This is not surprising because GRev and GOut should reflect the pore’s permeability to outward-flowing monovalents, against external Ca2+ which seeks to bind the extracellular high-affinity site. However, there is a slight inconsistency in this correlation, where GRev and GOut conductance values for TCav3 are significantly larger than Cav3.1, despite both channels bearing similarly potent Ca2+ block properties. Instead, the conductance values for TCav3 lie between those of Cav3.1 and the two exon 12 splice variants of LCav3. Thus, conductance across the reversal potential and during outward current flow though T-type channels might depend on a combination of both affinity for Ca2+ at the external pore surface (where TCav3 and Cav3.1 are similar), and pore Ca2+ versus Na+ permeability (where TCav3 and LCav3 are more similar). In conclusion, we find evidence that for T-type channels, Ca2+ block—and not Ca2+ versus Na+ selectivity—best correlates with the degree of inward Na+ permeation under simulated physiological conditions. For Trichoplax, which lives in seawater, the abundance of external Ca2+ must ensure efficient saturation of the Ca2+ block effect, rendering the channels mostly permeable to Ca2+. Here, our studies were performed using salines that are compatible with HEK-293T cells, with reduced ionic concentrations and osmolarity across both sides of the membrane compared with seawater. In future studies, it will be interesting to evaluate the consequences of altered ion concentrations on TCav3 biophysical, permeation, and pharmacological properties (and indeed other ion channel types), where evolutionary transitions from seawater to land/freshwater environments, and perhaps back again, would likely require some level of adaptation in channel function, such that contributions to cellular excitability and Ca2+ influx remain within acceptable parameters.
  105 in total

1.  Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.

Authors:  Emmanuel Bourinet; Abdelkrim Alloui; Arnaud Monteil; Christian Barrère; Brigitte Couette; Olivier Poirot; Anne Pages; John McRory; Terrance P Snutch; Alain Eschalier; Joël Nargeot
Journal:  EMBO J       Date:  2004-12-16       Impact factor: 11.598

2.  The codon Adaptation Index--a measure of directional synonymous codon usage bias, and its potential applications.

Authors:  P M Sharp; W H Li
Journal:  Nucleic Acids Res       Date:  1987-02-11       Impact factor: 16.971

Review 3.  Thalamic T-type Ca2+ channels and NREM sleep.

Authors:  Vincenzo Crunelli; David W Cope; Stuart W Hughes
Journal:  Cell Calcium       Date:  2006-06-13       Impact factor: 6.817

4.  Functional properties of a neuronal class C L-type calcium channel.

Authors:  W J Tomlinson; A Stea; E Bourinet; P Charnet; J Nargeot; T P Snutch
Journal:  Neuropharmacology       Date:  1993-11       Impact factor: 5.250

5.  Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.

Authors:  Mark B Gerstein; Zhi John Lu; Eric L Van Nostrand; Chao Cheng; Bradley I Arshinoff; Tao Liu; Kevin Y Yip; Rebecca Robilotto; Andreas Rechtsteiner; Kohta Ikegami; Pedro Alves; Aurelien Chateigner; Marc Perry; Mitzi Morris; Raymond K Auerbach; Xin Feng; Jing Leng; Anne Vielle; Wei Niu; Kahn Rhrissorrakrai; Ashish Agarwal; Roger P Alexander; Galt Barber; Cathleen M Brdlik; Jennifer Brennan; Jeremy Jean Brouillet; Adrian Carr; Ming-Sin Cheung; Hiram Clawson; Sergio Contrino; Luke O Dannenberg; Abby F Dernburg; Arshad Desai; Lindsay Dick; Andréa C Dosé; Jiang Du; Thea Egelhofer; Sevinc Ercan; Ghia Euskirchen; Brent Ewing; Elise A Feingold; Reto Gassmann; Peter J Good; Phil Green; Francois Gullier; Michelle Gutwein; Mark S Guyer; Lukas Habegger; Ting Han; Jorja G Henikoff; Stefan R Henz; Angie Hinrichs; Heather Holster; Tony Hyman; A Leo Iniguez; Judith Janette; Morten Jensen; Masaomi Kato; W James Kent; Ellen Kephart; Vishal Khivansara; Ekta Khurana; John K Kim; Paulina Kolasinska-Zwierz; Eric C Lai; Isabel Latorre; Amber Leahey; Suzanna Lewis; Paul Lloyd; Lucas Lochovsky; Rebecca F Lowdon; Yaniv Lubling; Rachel Lyne; Michael MacCoss; Sebastian D Mackowiak; Marco Mangone; Sheldon McKay; Desirea Mecenas; Gennifer Merrihew; David M Miller; Andrew Muroyama; John I Murray; Siew-Loon Ooi; Hoang Pham; Taryn Phippen; Elicia A Preston; Nikolaus Rajewsky; Gunnar Rätsch; Heidi Rosenbaum; Joel Rozowsky; Kim Rutherford; Peter Ruzanov; Mihail Sarov; Rajkumar Sasidharan; Andrea Sboner; Paul Scheid; Eran Segal; Hyunjin Shin; Chong Shou; Frank J Slack; Cindie Slightam; Richard Smith; William C Spencer; E O Stinson; Scott Taing; Teruaki Takasaki; Dionne Vafeados; Ksenia Voronina; Guilin Wang; Nicole L Washington; Christina M Whittle; Beijing Wu; Koon-Kiu Yan; Georg Zeller; Zheng Zha; Mei Zhong; Xingliang Zhou; Julie Ahringer; Susan Strome; Kristin C Gunsalus; Gos Micklem; X Shirley Liu; Valerie Reinke; Stuart K Kim; LaDeana W Hillier; Steven Henikoff; Fabio Piano; Michael Snyder; Lincoln Stein; Jason D Lieb; Robert H Waterston
Journal:  Science       Date:  2010-12-22       Impact factor: 47.728

6.  The genome of the choanoflagellate Monosiga brevicollis and the origin of metazoans.

Authors:  Nicole King; M Jody Westbrook; Susan L Young; Alan Kuo; Monika Abedin; Jarrod Chapman; Stephen Fairclough; Uffe Hellsten; Yoh Isogai; Ivica Letunic; Michael Marr; David Pincus; Nicholas Putnam; Antonis Rokas; Kevin J Wright; Richard Zuzow; William Dirks; Matthew Good; David Goodstein; Derek Lemons; Wanqing Li; Jessica B Lyons; Andrea Morris; Scott Nichols; Daniel J Richter; Asaf Salamov; J G I Sequencing; Peer Bork; Wendell A Lim; Gerard Manning; W Todd Miller; William McGinnis; Harris Shapiro; Robert Tjian; Igor V Grigoriev; Daniel Rokhsar
Journal:  Nature       Date:  2008-02-14       Impact factor: 49.962

7.  Unbiased View of Synaptic and Neuronal Gene Complement in Ctenophores: Are There Pan-neuronal and Pan-synaptic Genes across Metazoa?

Authors:  Leonid L Moroz; Andrea B Kohn
Journal:  Integr Comp Biol       Date:  2015-10-09       Impact factor: 3.326

8.  The Trichoplax genome and the nature of placozoans.

Authors:  Mansi Srivastava; Emina Begovic; Jarrod Chapman; Nicholas H Putnam; Uffe Hellsten; Takeshi Kawashima; Alan Kuo; Therese Mitros; Asaf Salamov; Meredith L Carpenter; Ana Y Signorovitch; Maria A Moreno; Kai Kamm; Jane Grimwood; Jeremy Schmutz; Harris Shapiro; Igor V Grigoriev; Leo W Buss; Bernd Schierwater; Stephen L Dellaporta; Daniel S Rokhsar
Journal:  Nature       Date:  2008-08-21       Impact factor: 49.962

9.  trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses.

Authors:  Salvador Capella-Gutiérrez; José M Silla-Martínez; Toni Gabaldón
Journal:  Bioinformatics       Date:  2009-06-08       Impact factor: 6.937

10.  Complexin and Ca2+ stimulate SNARE-mediated membrane fusion.

Authors:  Tae-Young Yoon; Xiaobing Lu; Jiajie Diao; Soo-Min Lee; Taekjip Ha; Yeon-Kyun Shin
Journal:  Nat Struct Mol Biol       Date:  2008-06-15       Impact factor: 15.369

View more
  10 in total

1.  Sodium action potentials in placozoa: Insights into behavioral integration and evolution of nerveless animals.

Authors:  Daria Y Romanova; Ivan V Smirnov; Mikhail A Nikitin; Andrea B Kohn; Alisa I Borman; Alexey Y Malyshev; Pavel M Balaban; Leonid L Moroz
Journal:  Biochem Biophys Res Commun       Date:  2020-08-20       Impact factor: 3.575

Review 2.  The enduring legacy of the "constant-field equation" in membrane ion transport.

Authors:  Osvaldo Alvarez; Ramon Latorre
Journal:  J Gen Physiol       Date:  2017-09-20       Impact factor: 4.086

3.  Neuropeptidergic integration of behavior in Trichoplax adhaerens, an animal without synapses.

Authors:  Adriano Senatore; Thomas S Reese; Carolyn L Smith
Journal:  J Exp Biol       Date:  2017-09-15       Impact factor: 3.312

Review 4.  Neuronal Cav3 channelopathies: recent progress and perspectives.

Authors:  Philippe Lory; Sophie Nicole; Arnaud Monteil
Journal:  Pflugers Arch       Date:  2020-07-07       Impact factor: 3.657

Review 5.  Thalamic T-Type Calcium Channels as Targets for Hypnotics and General Anesthetics.

Authors:  Tamara Timic Stamenic; Slobodan M Todorovic
Journal:  Int J Mol Sci       Date:  2022-02-21       Impact factor: 6.208

6.  Cation Permeability of Voltage-Gated Hair Cell Ca2+ Channels of the Vertebrate Labyrinth.

Authors:  Marta Martini; Giorgio Rispoli
Journal:  Int J Mol Sci       Date:  2022-03-29       Impact factor: 5.923

7.  A Na+ leak channel cloned from Trichoplax adhaerens extends extracellular pH and Ca2+ sensing for the DEG/ENaC family close to the base of Metazoa.

Authors:  Wassim Elkhatib; Carolyn L Smith; Adriano Senatore
Journal:  J Biol Chem       Date:  2019-09-15       Impact factor: 5.157

8.  Early Metazoan Origin and Multiple Losses of a Novel Clade of RIM Presynaptic Calcium Channel Scaffolding Protein Homologs.

Authors:  Thomas Piekut; Yuen Yan Wong; Sarah E Walker; Carolyn L Smith; Julia Gauberg; Alicia N Harracksingh; Christopher Lowden; Brian B Novogradac; Hai-Ying Mary Cheng; Gaynor E Spencer; Adriano Senatore
Journal:  Genome Biol Evol       Date:  2020-08-01       Impact factor: 3.416

9.  Conserved biophysical features of the CaV2 presynaptic Ca2+ channel homologue from the early-diverging animal Trichoplax adhaerens.

Authors:  Julia Gauberg; Salsabil Abdallah; Wassim Elkhatib; Alicia N Harracksingh; Thomas Piekut; Elise F Stanley; Adriano Senatore
Journal:  J Biol Chem       Date:  2020-10-23       Impact factor: 5.157

10.  Calmodulin regulates Cav3 T-type channels at their gating brake.

Authors:  Jean Chemin; Valentina Taiakina; Arnaud Monteil; Michael Piazza; Wendy Guan; Robert F Stephens; Ashraf Kitmitto; Zhiping P Pang; Annette C Dolphin; Edward Perez-Reyes; Thorsten Dieckmann; Joseph Guy Guillemette; J David Spafford
Journal:  J Biol Chem       Date:  2017-09-25       Impact factor: 5.157

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.