Literature DB >> 28261625

Isolation and identification of Legionella spp. from different aquatic sources in south-west of Iran by molecular &culture methods.

Mohammad Tabatabaei1, Zahra Hemati1, Maryam-O-Sadat Moezzi1, Negar Azimzadeh1.   

Abstract

Legionella pneumophila, the causative agent of Legionnaires' diseases (LD) is usually transmitted to humans via inhalation of aerosols from contaminated natural and manmade water sources. These organisms may become fatal especially in immunocompromised patients and LD is the one of the important disease from a public health perspective. This survey investigated the frequency of Legionella spp. including L. pneumophila, in some cold and warm water systems in South-West of Iran by culture and PCR methods. Thirty four water samples were collected from diverse water supply systems. After acid and heat treatments of samples, inoculated onto buffered charcoal yeast extract agar. Isolated colonies were confirmed by morphological and biochemical tests. Then the isolates were examined for icmO, sidA and lidA genes by PCR assay. This study showed that frequency of L. pneumophila was 4 by culture and 14 by PCR. PCR method to be efficient and sensitive test for rapid detection of these organisms in environmental water sources. This study emphasizes the need for effective infection control and prevention strategies to minimize the risk from exposure to potential pathogens such as Legionella spp. and to create a safe working environment.

Entities:  

Keywords:  Legionella pneumophila; Legionnaires’ diseases; manmade water sources

Year:  2016        PMID: 28261625      PMCID: PMC5326485     

Source DB:  PubMed          Journal:  Mol Biol Res Commun        ISSN: 2322-181X


INTRODUCTION

Legionellae spp. are facultative intracellular Gram negative, catalase and oxidase negative bacteria that may cause acute respiratory infection in humans such asLegionnaires’ disease (LD) and Pontiac fever which is a mild flu-like lung illness[1]. Aquatic environments are the most important source for Legionella infections [2]. Human infections are acquired by the inhalation of aerosols produced from natural and artificial aquatic environments, such as cooling tower systems (CTS), water distribution devices, potable hot water systems (HWS), fishponds and equipment of respiratory treatments [3]. It is important from a public health perspective to survey industrial manmade water systems for the presence of Legionella [4]. In recent years, the occurrence rate of LD has been reported to be on the increase in many countries [5]. In current, over 90% of LD cases are caused by infection of L. pneumophila [1]. LD is also recognized as a major form of travel associated pneumonia, these cases present a major problem because of difficulties in identifying the main source of infection [6]. L. pneumophila often protected from harsh environmental conditions within biofilms or intracellular growth amoebae and the biofilms have a major impact on manmade water systems, making the understanding of the bacterial physiological adaptation in biofilms a fundamental step towards their annihilation [7]. There is some limitation on the selection of an appropriate drug for treatment of infections caused by Legionella spp [8]. The increased presence of the large-scale, manmade aquatic reservoirs has possible led to the increased human's exposure to Legionella and subsequently an increased incidence of Legionella infection in the last half of the 20th century [9]. There are numerous reports of colonization of water system in large buildings such as hospitals and fish pools and the current knowledge about the epidemiology of LD is based mainly on data gathered from studies of outbreaks [6]. Water sampling for Legionella is an essential component of investigations of LD outbreaks and sampling is useful in identifying potentially contaminated water system with these bacteria used to identify the sources of the implicated etiologic agent [10]. Persistence of L. pneumophila in water systems is a public health risk and reflects in the greater research focus on this bacterium [9]. The standard method of detection of Legionella spp. in environmental sample is culture on Buffered Charcoal Yeast Extract (BCYE) agar supplemented with L-cysteine [11, 12]. In addition, the polymerase chain reaction (PCR)-based method can be particularly useful for analysis of environmental water samples and provides a platform capable of rapid screening of samples for trace levels of legionella spp [1]. In this study, PCR methods were designed for various genetic loci including Legionella-specific virulence determinants (icmO, sidA and lidA) genes [13]. Despite efforts to keep water systems free of Legionella spp., these pathogens are still causing infection throughout the world wide, including, Iran [3, 14- 16]. Therefore we decided to study some of manmade water sources in view of the presence of Legionella spp. including L. pneumophila, by two methods of culture and PCR. Although, this study was conducted to survey the prevalence of Legionella contamination of various manmade water systems and a larger study and reports from other parts of the country may help in determining the true significance of LD in Iran.

MATERIALS AND METHODS

Water sample collection procedures: During a one year period starting in September 2013, a total of 34 water samples were collected from diverse water supply systems using sterile Erlenmeyer Flask which had been sterilized at 180ºC for 2 hours. Samples were collected from distinct sites at nine CTS (26/47%) from (four different hospitals, three educational departments, two shopping centers) and 17 HWS (50%) from (four different hospitals, seven different universities, three different abattoirs, one shopping center, one dormitory, one library) and eight different fish pools (23/53%) in Shiraz, Iran, as study points. In the manmade water systems, urban drinking water source.were used. Sample temperature was measured at the time of sampling. All of these samples were transferred to the laboratory of microbiology department of pathobiology, faculty of veterinary medicine, Shiraz University in less than two hour and were kept in the refrigerator (4ºC) until the time of processing. Sample Concentrations &Standard Culture Method: To detect Legionella spp., 2.5 liters of the water samples were concentrated by filtration separately through a 0.22 μm pore-size polycarbonate filter (Advantec Tokyo Co. Ltd., Tokyo, Japan), in sterile condition in a biological safety cabinet and the membranes were resuspended in 5 mL of distilled water. After centrifugation in 2500 rpm for 15 min, the supernatant was subjected to both acid and heat treatment for selective inhibition of non-Legionella bacteria. From all concentrated and treated samples, aliquots of 0.1 ml were plated onto BCYE Agar medium (Difco Laboratories, Detroit, Mich., USA) supplemented with L. cysteine and the plates were incubated in candle jar (3-5% CO2) at 37ºC in a humidified atmosphere and examined for 4–14 days for the presence of Legionella spp. colonies. After incubation, colonies showing characteristics of Legionella species such as grayish-white, shiny colonies were selected. Gram stain was done to show the thin, faintly stained filamentous Gram-negative morphology. Suspected colonies were subcultured on BCYE agar with and without L-cysteine and non-selective media, such as sheep-blood agar and MacConky agar for verification. Isolates which grew on BCYE agar with L. cysteine, but not on the other media, were considered supposed Legionella. Subsequently the identification of Legionella spp. were done by biochemical tests. Strains unable to grow on media without L-cysteine were further identified by PCR analysis of part of the icmO, sidA and lidA genes [13]. DNA extraction & PCR assay: To extract the DNA, freshly grown bacterial colonies from solid media (BCYE agar plates) were suspended in 100 μl of deionized sterile water in an ependorf tube, gently vortexed and frozen in liquid nitrogen and heated in boiling water three times. The DNA was further extracted and purified using Promega DNA Extraction Kit (Promega Wizard® Genomic DNA Purification Kit, Madison, USA) according to manufacturer’s instructions. The DNA concentration was determined by measuring the optical density at 260 nm. PCR was performed to investigate Legionella genes using different primers. Master mixture was prepared for a 25 μl of reaction consisting of 2.5 μL of 10× PCR buffer, 0.2 μM of each primer, 0.2 mM of each dNTPs, 1 units of Taq DNA polymerase (Fermentas) and 2 μL of DNA samples. For amplification, an initial denaturation step for 5 min at 95°C followed by 33 cycles of 95ºC for 30s, 52ºC for 1 min and 72ºC for 90s., and a final extension at 72°C for 5 min in a thermocyler (Techne Co. UK). PCR-amplified DNA fragments were visualized by electrophoretic separation of 8 μL PCR products in a 1.5% agarose gel containing 0.5 ug ethidium bromide per milliliter of gel. Gels were viewed on a UV transilluminator (UV Tech, France), and DNA fragment sizes were compared with a 100-bp DNA ladder (Pharmacia Biotech Co., Ltd., Tokyo, Japan). Oligonucleotide primers were designed from the partial sequences of the icmO, sidA and lidA genes of L. pneumophila [13]. In this study, DNA of L. pneumophila, NCTC 12821 (FEPTU, HPA Center for Infections, London, UK, kindly donated from Dr. Nikaeen Associated professor, Isfahan University of Medical Sciences) was used as positive control and molecular grade water without DNA as the negative control. Sequences and sizes of primers are shown in Table 1.
Table 1

Oligonucleotide primers used in this study

Gene Primer sequence (5′-3′) Product size(bp) Reference
lidA TCACATCAAGTTAAAACATCAG ATGCTCACGCTGTAAGGATTG882
icmO AATTTTCGGTTCAACGGGTAG CAGTGCGGGTAATAAAACCAC763Gilmour et al (2007)
sidA GAC GAA CCA ACG GTC AGG AT TGC CGC CAG TAC CAA AGA CA330
Oligonucleotide primers used in this study Statistical analysis: All statistical analysis were made with SPSS software. Results were analyzed by McNemar test and one way analysis of variance.

RESULTS

This survey presents the results of an environmental investigation on Legionella spp. that was carried out on the numerous water samples taken from fish pools, drain of CTS and HWS within the building of department of eight hospitals, seven universities, eight pools, three abattoirs, three shopping centers, three educational departments, one dormitory and one library in Shiraz, Iran. Water samples included sediments and biofilms in these infrastructures. Inoculating samples on BCYE and nonselective media resulted in isolation of several strains of filamentous gram negative bacteria. These gram-negative strains were identified based on morphology of the colonies and growth on the Blood agar and MacConky agar and biochemical tests. The results of growth on blood and MacConky agar, biochemical tests, such as Catalase, Oxidase, Urease, Gelatin, Motility, and gram staining were −, −, +, +, −, and −, respectively. Isolates were positive by oxidase, hippurate hydrolysis, gelatin tests and had weaker reaction with catalase were suspected to be L. pneumophila. The culture method revealed 7.3% (4 of 34) of the water samples among the manmade water systems studied being positive for L. pneumophila. Nine strains of Legionella-like organisms which were isolated by culture from water sources studied, four strains were later identified by biochemical tests as L. pneumophila. The results of this study also showed only one strain (2.9%) to be isolated from 9 CTS, two strains (5.9 %) to be isolated from 17 HWS and one strain (2.9%) to be isolated from 8 fish pool samples were identified as L. pneumophila by culture. Extraction of DNA by snap-chill method (10 minutes boiling and chilling in crushed ice) turned out to be an efficient method of DNA preparation for PCR as the results of this method was equally good and comparable to that of PCR employing pure DNA extracted by DNA extraction kit. PCR-based detection assays for L. pneumophila were conducted on DNA extractions of all water samples. The sidA, icmO and lidA genes of L. pneumophila were amplified using specific primers and showed amplicons about 330, 763 and 882 bp respectively on agarose gel (Fig. 1). Of the total of 34 samples, 14 (41.18%) were PCR positive for one, two or three of these genes. The results in Table 2 show that the following genes were detected in all samples. About 41.18% of the samples contained L. pneumophila that 50% (7 of 14) were isolated from HWS, 14.3% (2 of 14) were isolated from CTS and 35.7% (5 of 14) were found in fish pool waters. The numbers of L. pneumophila positive samples from the hospitals, universities, pools, abattoirs, shopping center, dormitory, library and educational departments were 3, 3, 5, 2, 1, 0, 0 and 0, respectively. Seven (20.6%) isolates were positive for lidA gene, two (5.9%) isolates were positive for icmO gene, one isolate (2.9%) was positive for lidA and sidA genes, one isolate (2.9%) was positive for sidA and icmO genes and three isolate (8.8%) were positive for three genes.
Figure 1

Amplified products of Legionella L. pneumophila. by PCR. Lane 1, 100 bp DNA ladder; Lanes 2 and 8, positive sample of lidA gene; Lane 3, negative control; Lanes 4 and 6, positive samples of icmO gene; Lane 5, positive control; Lane 7, positive sample of sidA gene

Table 2

PCR products of different genes in different bacterial sources

SourcesHot water system
Cooling tower
Fish pools
Total
lidA icmO LidA,sidA,icm LidA,sidA,icmO SidA,icm lidA LidA,sidA icmO
Hospitals001110003(21.43%)
Universities201000003 (21.43%)
Fish pools000003115 (35.71%)
Abattoirs110000002 (14.29%)
Shopping centre100000001 (7.14%)
Dormitory000000000
Library000000000
Education Department000000000
Total4121131114 (100%)
From the HWS, 5.9% of the samples had temperatures of 15–30ºC, 23.5% had temperature between 30–45ºC, 58.8% had temperature between 45–60ºC, and 11.8% of them had temperature over 60ºC. Legionella spp was detected in 7 of the 17 samples of HWS, 71.4% of these samples had temperatures between 45-60ºC and 26.6% of them had temperatures below 45ºC. Amplified products of Legionella L. pneumophila. by PCR. Lane 1, 100 bp DNA ladder; Lanes 2 and 8, positive sample of lidA gene; Lane 3, negative control; Lanes 4 and 6, positive samples of icmO gene; Lane 5, positive control; Lane 7, positive sample of sidA gene Statistical analyses (McNemartest) indicated there was a significant difference between PCR and culture results of these water sources (P<0.006). The statistical analysis using a one-way ANOVA test also confirms there was statistically significant difference among the temperatures of the samples taken from the HWS, CTS and those taken from the fish pools (P<0.001). PCR products of different genes in different bacterial sources

DISCUSSION

LD is a common form of nosocomial and community-acquired pneumonia in human, that majority of this infection is caused by L. pneumophila [12, 17]. L. pneumophila is a dangerous pathogenic bacterium can cause serious lower respiratory tract infection especially in immunocompromised peoples and may become fatal for them [8]. Legionella spp. present a significant public health risk when they colonize manmade water systems operating between 20-45ºC and grow to high concentrations [18]. Infection of these bacteria is not contagious, and inhaling the contaminated aerosol is the only way of Legionella infections thus having the clean air is the first important parameter to prevent LD [19]. Legionella spp. are ubiquitous distributed in different water environments and have been isolated from a wide variety of water samples [3, 17]. These pollution sources can serve as a focus for the spread of Legionella spp. For the majority of sporadic LD cases the source of infection remains unknown [12]. Increased standardization of LD reporting, and more precise follow-up of LD events, would help generate stronger, more comparable evidence on LD sources, contributing factors, and control measure effectiveness [21]. The disease may result from exposure to these bacteria in different resources that are not yet considered to be a source of infection [10]. Therefore, some environmental water samples from potentially implicated building water systems were studied to identify the possible source of exposure to pathogenic Legionella bacteria. In this study we used a combination of PCR and culture methods for identifying the environmental sources of Legionella spp. The PCR assay used in this study to target the icmO, sidA and lidA genes showed to be a rapid and sensitive test. In our study, frequency of positive L. pneumophila in 34 examined water samples were 4 (7.3%) by culture, while PCR could detect 14 (41.18%) of these samples. All samples that were found positive with the culture method were also positive with the PCR assay. Ten of 34 water samples (29.4%) tested in their study were negative by culture but positive by PCR. Control reaction included pure DNA sample of reference strain. In a study conducted by Li et al., (2015), Legionella spp. were detected in 35.7% of collected industrial CTS samples from 22 factories during the 19-month study period, and showed a high degree of pollution of Legionella in industrial CTS in China. Statistical analyses (McNemartest) indicated there was a significant difference between PCR and culture results of these water sources (P<0.006). Several authors showed PCR to have a higher rate of detection than culture-based methods (3, 16, 20). Baghal Asghari et al., (2013) reported the rates of detection of Legionella spp. to be 66% (29 of 44) of the water samples by PCR compared to 23% (10 of 44) by culture. Furthermore, prevalence of Legionella spp. could be affected by temperature because that lower temperature of the CTS contains lower number of positive cases [14]. Legionella spp. present a significant public health risk when they colonize manmade water systems operating between 20-45oC and grow to high concentrations [18]. In our study, the mean temperature of the water samples positive for Legionella spp. was higher compared to the mean temperature of the negative samples (44.3°C versus 37.6°C). In addition, the most number of positive water samples were belonged to HWS, number of Legionella- positive samples was much lower in CTS. We found that lower temperatures could explain the lower prevalence of Legionella spp. These findings is agree with research in Greece, where the temperature, which was found not only within the limits favorable to developing Legionella spp. (20-45°C) but also for development and proliferation of the bacteria, and other microorganisms as well [6]. In any case, the use of internal control reduced the chances of false negative results. Our results demonstrated high prevalence of Legionella in industrial manmade water systems and we can conclude that the results of our study provide data and some insight in the possible detected Legionella spp. in water sources in Shiraz, which would be of value in investigating any further outbreak of LD in the geographical region studied. Thus improving control and prevention strategies of Legionella, containing routine monitoring of industrial manmade water systems are urgently needed. For future studies, we wish to conduct prospective surveillance in Shiraz and obtain L. pneumophila isolates from patient samples.
  15 in total

Review 1.  Molecular pathogenesis of infections caused by Legionella pneumophila.

Authors:  Hayley J Newton; Desmond K Y Ang; Ian R van Driel; Elizabeth L Hartland
Journal:  Clin Microbiol Rev       Date:  2010-04       Impact factor: 26.132

2.  Surveillance of Legionella species in hospital water systems: the significance of detection method for environmental surveillance data.

Authors:  Farzaneh Baghal Asghari; Mahnaz Nikaeen; Maryam Hatamzadeh; Akbar Hassanzadeh
Journal:  J Water Health       Date:  2013-12       Impact factor: 1.744

3.  Detection of legionella contamination in tabriz hospitals by PCR assay.

Authors:  Reza Ghotaslou; Fatemeh Yeganeh Sefidan; Mohammad Taghi Akhi; Mohammad Hussein Soroush; Mohammad Saeid Hejazi
Journal:  Adv Pharm Bull       Date:  2013-02-07

4.  Proteomic regulation during Legionella pneumophila biofilm development: decrease of virulence factors and enhancement of response to oxidative stress.

Authors:  Arbia Khemiri; Sandra Ahmed Lecheheb; Philippe Chan Chi Song; Thierry Jouenne; Pascal Cosette
Journal:  J Water Health       Date:  2014-06       Impact factor: 1.744

5.  Legionella pneumophila pangenome reveals strain-specific virulence factors.

Authors:  Giuseppe D'Auria; Nuria Jiménez-Hernández; Francesc Peris-Bondia; Andrés Moya; Amparo Latorre
Journal:  BMC Genomics       Date:  2010-03-17       Impact factor: 3.969

Review 6.  Legionnaires' Disease in Hotels and Passenger Ships: A Systematic Review of Evidence, Sources, and Contributing Factors.

Authors:  Varvara A Mouchtouri; James W Rudge
Journal:  J Travel Med       Date:  2015-07-29       Impact factor: 8.490

7.  Legionella pneumophila infection associated with renal failure causing fatality in a known case of sarcoidosis.

Authors:  R Chaudhry; A Valavane; A Mohan; A B Dey
Journal:  Indian J Med Microbiol       Date:  2014 Jul-Sep       Impact factor: 0.985

8.  Viable Legionella pneumophila bacteria in natural soil and rainwater puddles.

Authors:  E van Heijnsbergen; A M de Roda Husman; W J Lodder; M Bouwknegt; A E Docters van Leeuwen; J P Bruin; S M Euser; J W den Boer; J A C Schalk
Journal:  J Appl Microbiol       Date:  2014-06-26       Impact factor: 3.772

9.  Prevalence and Molecular Characteristics of Waterborne Pathogen Legionella in Industrial Cooling Tower Environments.

Authors:  Lijie Li; Tian Qin; Yun Li; Haijian Zhou; Hongmei Song; Hongyu Ren; Liping Li; Yongguang Li; Dong Zhao
Journal:  Int J Environ Res Public Health       Date:  2015-10-12       Impact factor: 3.390

10.  Detection of Legionella spp. from Domestic Water in the Prefecture of Arta, Greece.

Authors:  Dimitra Dimitriadi; Emmanuel Velonakis
Journal:  J Pathog       Date:  2014-03-12
View more
  10 in total

1.  Comparison of the culture method with multiplex PCR for the confirmation of Legionella spp. and Legionella pneumophila.

Authors:  D Eble; V Gehrig; P Schubert-Ullrich; R Köppel; H P Füchslin
Journal:  J Appl Microbiol       Date:  2021-08-07       Impact factor: 4.059

2.  Loop-mediated isothermal amplification for detection of Legionella pneumophila in respiratory specimens of hospitalized patients in Ahvaz, southwest Iran.

Authors:  Mojtaba Moosavian; Sakineh Seyed-Mohammadi; Morteza Saki; Fatemeh Shahi; Mahtab Khoshkholgh Sima; Davoud Afshar; Sara Barati
Journal:  Infect Drug Resist       Date:  2019-03-01       Impact factor: 4.003

3.  Multiple Cross Displacement Amplification Coupled with Lateral Flow Biosensor (MCDA-LFB) for rapid detection of Legionella pneumophila.

Authors:  Luxi Jiang; Rumeng Gu; Xiaomeng Li; Meijun Song; Xiaojun Huang; Deguang Mu
Journal:  BMC Microbiol       Date:  2022-01-08       Impact factor: 3.605

4.  Is a Proactive Approach to Controlling Legionella in the Environment Justified?

Authors:  Daniela Glažar Ivče; Dobrica Rončević; Marina Šantić; Arijana Cenov; Dijana Tomić Linšak; Vladimir Mićović; Dražen Lušić; Marin Glad; Davor Ljubas; Darija Vukić Lušić
Journal:  Food Technol Biotechnol       Date:  2021-09       Impact factor: 3.918

Review 5.  Detection performance of PCR for Legionella pneumophila in environmental samples: a systematic review and meta-analysis.

Authors:  Xin Yin; Ying-Zhou Chen; Qi-Qing Ye; Li-Juan Liao; Zhuo-Rui Cai; Min Lin; Jia-Na Li; Geng-Biao Zhang; Xiao-Li Peng; Wen-Fang Shi; Xu-Guang Guo
Journal:  Ann Clin Microbiol Antimicrob       Date:  2022-03-18       Impact factor: 3.944

6.  Risk assessment and quantitative measurement along with monitoring of Legionella in hospital water sources.

Authors:  S Bavari; S Mirkalantari; F Masjedian Jazi; D Darban-Sarokhalil; B Golnari Marani
Journal:  New Microbes New Infect       Date:  2021-12-24

7.  Decreasing Pasteurization Treatment Efficiency against Amoeba-Grown Legionella pneumophila-Recognized Public Health Risk Factor.

Authors:  Maša Knežević; Dobrica Rončević; Darija Vukić Lušić; Mirna Mihelčić; Rok Kogoj; Darja Keše; Marin Glad; Arijana Cenov; Mateja Ožanič; Daniela Glažar Ivče; Marina Šantić
Journal:  Int J Environ Res Public Health       Date:  2022-01-19       Impact factor: 3.390

8.  One health pathogen surveillance demonstrated the dissemination of gut pathogens within the two coastal regions associated with intensive farming.

Authors:  Qingyao Wang; Yixiang Zhang; Qian Yang; Songzhe Fu; Baocheng Qu; Tom Defoirdt
Journal:  Gut Pathog       Date:  2021-07-23       Impact factor: 4.181

9.  Isolation and Identification of Legionella spp. in environmental water sources based on macrophage infectivity potentiator (mip) gene sequencing in southwest Iran.

Authors:  Mojtaba Moosavian; Mina Moradzadeh; Ataollah Ghadiri; Morteza Saki
Journal:  AIMS Microbiol       Date:  2019-08-16

Review 10.  Legionella Occurrence beyond Cooling Towers and Premise Plumbing.

Authors:  David Otto Schwake; Absar Alum; Morteza Abbaszadegan
Journal:  Microorganisms       Date:  2021-12-09
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.