Estrogen stimulates osteoprotegerin expression via the suppression of miR-145 expression in MG-63 cells.

Osteoprotegerin (OPG) is implicated in the pathogenesis of postmenopausal osteoporosis, and other metabolic bone diseases caused by estrogen deficiency. Previous studies have demonstrated that estrogen may stimulate OPG expression in osteoblast cells at the transcriptional level; however, whether estrogen can regulate OPG expression at a post-transcriptional level remains elusive. The present study aimed to investigate the role of microRNA (miRNA) in estrogen‑mediated OPG production in human osteoblast‑like MG‑63 cells. The results from ELISA, western blotting and reverse transcription-quantitative polymerase chain reaction (RT‑qPCR) confirmed that estrogen may upregulate OPG expression. Mechanistic studies indicated that estrogen increased the activity of a luciferase reporter harboring the OPG 3'‑untranslated region (3'‑UTR). Bioinformatics analysis demonstrated that there is a potential targeting site in the OPG 3'‑UTR for miRNA (miR)‑145, which is associated with osteoblast differentiation. The results of an RT‑qPCR suggested that estrogen suppressed miR‑145 expression. In addition, dual‑luciferase assay, RT‑qPCR and western blot analysis indicated that miR‑145 directly targets and negatively regulates OPG expression. Furthermore, transfection of cells with miR‑145 mimics was able to partially inhibit the induction of OPG expression by estrogen, thus confirming the role of miR‑145 in estrogen‑mediated OPG induction. Taken together, the results of the present study demonstrated that estrogen may post-transcriptionally regulate OPG expression through suppression of miR-145 expression.

Introduction

Osteoporosis is a major public health problem characterized by low bone mass and impairment of microarchitecture, resulting in fragility fractures (1). For postmenopausal women, estrogen deficiency is one of the most common causes of osteoporosis, which results in an increase in the lifespan of osteoclasts and a concomitant decrease in osteoblast lifespan. These effects of estrogen deficiency on bone cells have been demonstrated to result in bone resorption over bone formation, leading to a sustained bone loss (2).

The mechanism underlying the action of estrogen has been widely studied (3,4). Among the reported mechanisms responsible for estrogen action on bone cells, previous studies have focused on the role of the receptor activator of nuclear factor kappa B ligand/receptor activator of nuclear factor kappa B/osteoprotegerin (RANKL/RANK/OPG) regulatory system in the anti-resorptive action of estrogen (5,6). RANKL, which is the final effector in osteoclastogenesis, is expressed on the surface of osteoblasts. It binds to its cellular receptor, RANK, on pre-osteoclasts and promotes their differentiation and activation (7). Eghbali-Fatourechi et al (8) reported that upregulation of RANKL in bone marrow cells is an important determinant of increased bone resorption induced by estrogen deficiency in postmenopausal women. OPG, which is a decoy receptor for RANKL, is a soluble glycoprotein secreted by various mesenchymal-derived cells, including osteoblasts and bone marrow stromal cells (9,10). OPG reduces bone resorption by inhibiting osteoclast differentiation via suppression of RANKL binding to its functional receptor RANK (11,12). Previous studies have demonstrated that estrogen can induce gene expression and protein synthesis of OPG in in vitro human and rat models (13–16), as well as in vivo studies in postmenopausal women (17). Estrogen stimulates OPG expression mainly at a transcriptional level through the estrogen receptor (ER), particularly ERα (13–15,18). Furthermore, an estrogen response element has been identified in the OPG promoter (19). However, whether OPG is regulated at a post-transcriptional level by estrogen remains unknown.

MicroRNAs (miRNAs) are endogenous, small, noncoding RNAs, 21 to 23 nucleotides in length, which regulate gene expression post-transcriptionally, usually by binding to specific miRNA recognition sequences located in the 3′-untranslated regions (3′-UTRs) of target mRNAs, which finally leads to mRNA degradation and/or inhibition of translation (20). It has previously been demonstrated that miRNAs serve critical roles in regulating osteoblast differentiation and bone formation (21). For example, recent studies have identified that miRNA (miR)-145 regulates osteoblast differentiation by targeting transcription factors, core-binding factor subunit beta (Cbfb) and osterix (Osx) (22,23). Yang et al (24) indicated that miR-21 downregulation may contribute to the tumor necrosis factor-α-induced inhibition of bone formation in estrogen deficiency-induced osteoporosis. Another report revealed that miR-503 was markedly reduced in circulating progenitors of osteoclasts from patients with postmenopausal osteoporosis, and that miR-503 inhibited bone resorption by directly targeting RANK (25). However, few miRNAs are known to be involved in bone metabolism by regulating OPG expression. miR-21 was recently reported to directly target and suppress OPG expression to promote the resorbing activity of mature osteoclasts (26). However, whether miRNAs are implicated in OPG induction by estrogen remains unclear.

The present study aimed to determine whether estrogen could regulate OPG expression at a post-transcriptional level via miRNA. The results of the present study demonstrated that estrogen stimulated OPG expression via suppression of miR-145 expression. These findings may enrich understanding regarding the molecular events underlying estrogen-mediated bone metabolism.

Materials and methods

Cell culture

Human osteoblast-like MG-63 cells were obtained from the Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin in a humidified incubator containing 5% CO2 at 37°C. For estrogen treatment, MG-63 cells in logarithmic growth phase were treated with various concentrations (0, 1, 10 and 100 nM) of 17β-estradiol (E2; Sigma-Aldrich; Merck Millipore, Darmstadt, Germany) for 48 h at 37°C. Transfection was performed using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Cells were trypsinized with trypsin (cat. no. 25200056; Gibco; Thermo Fisher Scientific, Inc.), counted, and 5×105 cells/well were seeded on 6-well plates the day prior to transfection to ensure a suitable cell confluence (70%) on the day of transfection. Then the cells were transfected with antisense oligonucleotide-miR-145 (ASO-miR-145) or ASO-negative control (NC), miRNA-145 mimic (mimic-145; analog of miR-145) or the negative control mimic (mimic-NC) (Shanghai GenePharma Co., Ltd., Shanghai, China), and then the cells were incubated in a humidified incubator containing 5% CO2 at 37°C for 48 h. The sequence used were listed in Table I.

Table I.

Primer sequences and oligomers used in the present study.

Name	Sequence (5′-3′)
NC mimic	UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAVGGTT
miR-145 mimic	GUCCAGUUUUCCCAGGAAUCCCU AGGGAUUCCUGGGAAAACUGGAC
ASO-NC	GTGGATATTGTTGCCATCA
ASO-miR145	AGGGATTCCTGGGAAAACTGGAC
miR-145-RT	GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGA TACGATGGGATTC
U6-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGACAAAATATGGAAC
miR-145-forward	TGCGGGTCCAGTTTTCCCAGGAATC
Reverse	CCAGTGCAGGGTCCGAGGT
U6-forward	TGCGGGTGCTCGCTTCGGCAGC
Reverse	CCAGTGCAGGGTCCGAGGT
OPG-sense	GGAAAGAAAGTGGGAGCAGAAGACAT
OPG-antisense	CTGAGTGACAGTTTTGGGAAAGTGGT
β-actin-sense	CGTGACATTAAGGAGAAGCTG
β-actin-antisense	CTAGAAGCATTTGCGGTGGAC
OPG-3′-UTR-sense	CGGAATTCACTGGAAATGGCCATTGAGCTGT
OPG-3′-UTR-antisense	CGGCTCGAGTAAGGTACATTCAATTTCTCAG
OPG-3′-UTR-sense-mut	AATTACGTGATGAATTACTGCAAGCAGTAATAAG
OPG-3′-UTR-antisense-mut	CTTATTACTGCTTGCAGTAATTCATCACGTAATT

ASO, antisense oligonucleotide; miR-145, microRNA-145; mut, mutant; NC, negative control; OPG, osteprotegerin; RT, reverse transcription; UTR, untranslated region.

Western blot analysis

MG63 cells stimulated by different estrogen doses (0, 1, 10 or 100 nM) for 48 h and cells treated with ASO-NC, ASO-miR-145, mimic-NC or mimic miR-145 for 48 h were used to detect OPG protein levels. Following E2 treatment or transfection, MG-63 cells were lysed with radioimmunoprecipitation assay buffer (150 mM NaCl, 1% Nonidet P-40, 1% Triton X-100, 1 mM MgCl2, 0.1% SDS, 10 mM Tris-HCl, pH 7.4) for 30 min before harvesting the protein. The protein concentrations were measured with the Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). An equal amount of protein (30 µg) was resolved on a 10% SDS-polyacrylamide gel and was then transferred to a nitrocellulose membrane. Membranes were incubated with blocking buffer at room temperature (RT) for 2 h, followed by incubation with specific primary antibodies against OPG (dilution, 1:200; cat. no. sc-71747; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) or GAPDH (dilution 1:500; cat. no. sc-293335; Santa Cruz Biotechnology, Inc.) overnight at 4°C. The membranes were then washed with TBST buffer (0.05% Tween-20, 150 mM NaCl, 50 mM Tris, pH 7.4) and incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody (dilution, 1:3,000; cat. no. sc-2375; Santa Cruz Biotechnology, Inc.) for 1 h at RT. The protein of interest was visualized by enhanced chemiluminescence (Applygen Technologies, Inc., Beijing, China). LabWorks 4.0 image acquisition and analysis software (UVP, LLC, Upland, CA, USA) was used for densitometric analysis.

OPG ELISA

OPG protein secretion into the medium was determined in triplicate measurements using the OPG ELISA kit (cat. no. BV51101; IBL International; Tecan, Männedorf, Switzerland) according to the manufacturer's protocol. Briefly, MG63 cells was stimulated by different estrogen doses (0, 1, 10 or 100 nM) and the medium were collected following treatment for 48 h, the collected medium was added to wells (96-well plate), following incubation at RT for 1 h. Biotin-labeled antibodies from the ELISA kit were added to each well and were incubated at RT for 1 h. After washing, streptavidin-HRP conjugate was added, followed by substrate solution and subsequent stop solution. Absorbance readings were measured at 450 nm.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. RNA was reverse-transcribed to cDNA with oligo (dT) primers or a miR-145 specific primer using the Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI, USA). Total RNA (2 µg) with the primer was incubated at 70°C for 5 min, then added to the M-MLV 5X Reaction Buffer, dNTPs, RNasin (Promega Corporation), M-MLV RT enzyme (cat. no. M5301; Promega Corporation), and nuclease-free water to final volume of 25 µl, then was incubated for 1 h at 42°C. RT-qPCR was performed with SYBR Premix EX Taq™ kit (Takara Bio, Inc., Otsu, Japan). β-actin was used as an endogenous control to normalize OPG expression levels; U6 small nuclear RNA was used an endogenous control to normalize miR-145 expression levels. The PCR reaction (20 µl) system contain SYBR-Green premix 10 µl, cDNA 2 µl, forward primer (10 µM) 1 µl, reverse primer (10 µM) 1 µl and H2O 6 µl. PCR cycles were as follows: 94°C for 3 min followed by 40 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec. All primers (GENEWIZ, South Plainfield, NJ, USA) used are listed in Table I. The relative fold-change in the transcripts were calculated using the 2-ΔΔCq method (27).

Plasmid construction

The 817-bp OPG 3′-UTR was amplified from MG-63 cDNA with the primers listed in Table I, and cloned into the dual-luciferase miRNA target expression vector pmirGLO (Promega Corporation) between the PmeI and XhoI sites. Mutations within the miR-145 binding sites were performed with the QuikChange Site-Directed Mutagenesis kit (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA). All insertions were confirmed by DNA sequencing, performed by GENEWIZ. All primers (GENEWIZ) used are listed in Table I.

Luciferase reporter assay

For the luciferase assay, pmirGLO/OPG-3′-UTR or pmirGLO/OPG-3′-UTR mut or pmirGLO (Promega Corporation) along with mimic miR-145, mimic-NC, ASO-miR-145 or ASO-NC were transfected into MG-63 cells with Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). 24 h following transfection, MG-63 cells were harvested and lysed with passive lysis buffer (Promega Corporation). Luciferase activity was measured using a dual luciferase reporter assay using a GloMax® 20/20 Luminometer (Promega Corporation). The hRluc-neo was used as an internal control. The results were expressed as relative luciferase activity (LUC/Renilla LUC).

Statistical analysis

All experiments were performed at least three times. Data are presented as the mean ± standard deviation. Statistical analysis was performed using SPSS version 15.0 (SPSS, Inc., Chicago, IL, USA) by conducting one-way analysis of variance. Comparisons between groups were analyzed with the Bonferroni post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Estrogen stimulates OPG expression

Previous studies have indicated that E2 can stimulate OPG expression in osteoblast cells (13–15). In order to confirm the stimulation of OPG by estrogen, the present study examined the effects of E2 on OPG expression in the human osteoblast cell line, MG-63. MG-63 cells were treated with various concentrations of E2 (1, 10 and 100 nM). The protein and mRNA expression levels of OPG were examined using ELISA, western blotting and RT-qPCR, respectively. As demonstrated in Fig. 1A-C, the protein expression levels of OPG in the culture medium and cytoplasm were significantly increased, even following treatment with the lowest E2 concentration (1 nM). The induction of OPG expression reached the highest levels following treatment with 10 nM E2; however, 100 nM was less potent. The effects of E2 on OPG mRNA indicated a similar pattern of results (Fig. 1D).

Figure 1.

E2 stimulates OPG expression. MG-63 cells were treated with the indicated concentrations of E2 for 48 h. (A) Levels of OPG protein secreted into the medium were measured by ELISA. (B and C) Levels of intracellular OPG protein were analyzed by western blot analysis and GAPDH was used for normalization. (D) OPG mRNA expression was detected by reverse transcription-quantitative polymerase chain reaction, and β-actin was used for normalization. *P<0.05, **P<0.01 vs. control. E2, 17β-estradiol; OPG, osteoprotegerin.

Estrogen post-transcriptionally stimulates OPG expression via the 3′-UTR

It has been hypothesized that estrogen may stimulate OPG expression at the post-transcriptional level. In order to provide evidence supporting this hypothesis, the OPG 3′-UTR was inserted downstream of the luciferase reporter gene within the pmirGLO vector and transfected into MG-63 cells. The luciferase activities were examined following treatment with various doses of E2 for 48 h. As presented in Fig. 2, there was no response to E2 treatment for cells transfected with the reporter vector without any 3′-UTR. However, compared with untreated cells, the luciferase activities from the cells transfected with reporter vectors containing the OPG 3′-UTR were markedly stimulated by E2 in a dose-dependent manner (Fig. 2B, P<0.01). These findings suggested that E2 regulation for OPG is specific and the OPG 3′-UTR is involved.

Figure 2.

E2 stimulates OPG expression through its 3′-UTR. MG-63 cells were transfected with the control vector, pmirGLO, or the pmirGLO vector harboring the 3′-UTR of OPG. A total of 24 h post-transfection, the cells were treated with the indicated concentrations of E2 for 48 h, subsequently the luciferase activities were examined by dual luciferase assay. The results were normalized to Renilla activity, and the untreated group was normalized as 1. **P<0.01 vs. control. E2, 17β-estradiol; mut, mutant; OPG, osteoprotegerin; UTR, untranslated region; wt, wild type.

E2 regulation of OPG involves miR-145

Sequence analysis of the OPG 3′-UTR was performed using several web-based bioinformatics tools including TargetScan (http://www.targetscan.org/vert_71/), MicroCosm Targets (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/) and PicTar (www.pictar.org), and identified several potential binding sites for various miRNAs. The interest in miRNAs came from previously determined findings identifying that they are involved in bone homeostasis, and that they may selectively target the 3′-UTR of OPG mRNA. As a result, the present study identified a target site matched to the seed sequence of miR-145 (Fig. 3A), which was found to be involved in the regulation of osteoblast differentiation (26). To the best of our knowledge, the present study is the first to investigate the regulation of miR-145 by E2 in MG-63 cells. RT-qPCR analysis demonstrated that E2 treatment resulted in a significant decrease in miR-145 expression levels at concentrations of 10 and 100 nM compared with the control group (P<0.01), and the effects of E2 reached a peak of ~60% inhibition at 10 nM (Fig. 3B).

Figure 3.

E2 decreases mature miR-145 levels. (A) miRNA target sites in the OPG 3′-UTR were analyzed by TargetScan. The potential miR-145 site is presented. (B) MG-63 cells were treated with the indicated concentrations of E2 for 48 h, miR-145 levels were determined by reverse transcription-quantitative polymerase chain reaction. U6 was used as an internal control. **P<0.01 vs. control. E2, 17β-estradiol; miR, microRNA; OPG, osteoprotegerin; TNFRSF11B, TNF receptor superfamily member 11b; UTR, untranslated region.

The effects of miR-145 on OPG expression were subsequently investigated. Firstly, the effects of miR-145 on luciferase activity in a transient transfection system were measured using chemically synthesized miR-145 mimics and a 2-O-methyl-modified antisense oligonucleotide of miR-145 (ASO-miR-145) as an inhibitor of miR-145 (Fig. 4). Transfection of cells with miR-145 mimics induced a ~50% decrease in the activities of the reporter harboring OPG 3′-UTR. Conversely, inhibition of miR-145 with ASO-miR-145 resulted in an increase of ~44% when compared with the ASO-NC-transfected cells (Fig. 4B). To determine the potential miR-145 target site responsible for regulation of the OPG 3′-UTR, a pmirGLO reporter vector containing the OPG 3′-UTR was constructed with a mutated miR-145 binding site (Fig. 3A). As expected, neither overexpression nor suppression of miR-145 had any effect on the luciferase activities of the reporter harboring mutated OPG 3′-UTR (Fig. 4C), thus suggesting that the predicted miR-145 binding site is functional.

Figure 4.

miR-145 targets the 3′-UTR of OPG and suppresses its expression. (A-C) miR-145 mimics or ASO-miR-145 were co-transfected with pmirGLO or pmirGLO vectors containing wt or mut 3′-UTRs of OPG into MG-63 cells. Following 48 h, cells were harvested and assayed for dual luciferase activity. The results were normalized to Renilla activity. The effects of miR-145 on endogenous OPG expression were determined by (D) reverse transcription-quantitative polymerase chain reaction and (E and F) western blotting. The mRNA and protein expression levels of OPG were normalized to the levels of β-actin mRNA and GAPDH protein, respectively. **P<0.01 vs. control. ASO, antisense oligonucleotide; miR, microRNA; NC, negative control; OPG, osteoprotegerin; UTR, untranslated region.

In order to determine whether miR-145 also suppresses endogenous OPG at a post-transcriptional level, the effects of miR-145 on OPG mRNA and protein levels were analyzed using RT-qPCR and western blotting, respectively. As shown in Fig. 4D, overexpression of miR-145 led to a ~35% reduction when compared with the negative control, and inhibition of miR-145 with the ASO resulted in a ~66% increase in OPG mRNA compared with the negative control. In accordance with these results, overexpression of miR-145 reduced protein levels, whereas inhibition of miR-145 increased OPG protein levels (Fig. 4E and F).

Restoration of miR-145 compromises the induction of OPG by estrogen

To verify the role of miR-145 in estrogen-mediated OPG induction, MG-63 cells were transfected with miR-145 mimics prior to E2 treatment, and the level of OPG that was secreted into the medium, as well as OPG mRNA expression, were measured using ELISA and RT-qPCR, respectively. The results from the ELISA demonstrated that the induction of OPG by E2 treatment was partially counteracted post-transfection with miR-145 (Fig. 5A, P<0.01). RT-qPCR analysis of OPG mRNA indicated a similar result (Fig. 5B, P<0.01). Together, these results indicated that estrogen stimulated OPG expression at least partly through suppression of miR-145 expression.

Figure 5.

Overexpression of miR-145 compromises the induction of OPG by estrogen. MG-63 cells were transfected with miR-145 mimics or NC. A total of 24 h post-transfection, the cells were treated with 10 nM E2 for 48 h, and the OPG protein levels secreted into the medium and OPG mRNA were measured by (A) ELISA and (B) reverse transcription-quantitative polymerase chain reaction. The mRNA expression levels of OPG were normalized to the mRNA expression levels of β-actin. **P<0.01 vs. control. E2, 17β-estradiol; miR, microRNA; NC, negative control; OPG, osteoprotegerin.

Discussion

Previous studies have demonstrated that estrogen can stimulate OPG expression in human and rodent osteoblast cells, and the primary mechanism underlying this regulation is through the transcription factor ER (13–15,18,19). The present study is the first, to the best of our knowledge, to indicate that estrogen can induce OPG expression at the post-transcriptional level via suppression of miR-145 expression in human osteoblast-like MG-63 cells. Considering the important role of OPG in regulating bone resorption, this result may aid in the understanding of the molecular mechanism underlying estrogen therapy for osteoporosis.

The results of the present study indicated that estrogen at a concentration of 10 nM can stimulate OPG expression by ~3-fold in human osteoblast-like MG-63 cells, which is consistent with the results from the human osteoblast cell lines and a mouse stromal cell line, ST-2 (13–15). However, estrogen at a higher concentration (100 nM) did not exhibit a more potent stimulation on OPG expression, this may be limited by the presence of its receptor ERα, ERβ in the nucleus and/or the membrane-associated receptor. This may be because there is a more complicated response following higher doses of estrogen treatment, which neutralizes its induction on OPG expression. The specific explanation requires further investigation.

It has been reported that estrogen activates its intracellular signaling via binding with the classic steroid receptors (ERα and ERβ) or G-protein-coupled receptors (28). In human and rodent osteoblast cells, estrogen stimulates OPG expression in an ER-dependent manner (13,14). Conversely, estrogen suppresses OPG production in MCF-7 breast cancer cell and in peripheral blood mononuclear cells (29,30), and ERα mediated the suppression of OPG in MCF-7 cells (29). A previous report demonstrated that there is an estrogen response element within the OPG gene promoter (19), which suggested the direct regulation of estrogen on OPG gene transcription through ER. In human dental pulp cells, an ERK inhibitor significantly increased estradiol-induced OPG expression and a p38 inhibitor significantly attenuated this expression (16). All these findings indicated that the regulation of estrogen on OPG expression is complex and may occur at both a transcriptional and post-transcriptional level. For the important regulatory role of miRNA at a post-transcriptional level, the present study explored the possibility of miRNA in estrogen-mediated OPG induction. To identify the regulatory elements that are responsible for E2-mediated OPG induction, bioinformatics analysis was performed on the OPG 3′-UTR sequence, and the results indicated that there are several potential miRNA binding sites within the 3′-UTR of OPG. In combination with the reported function of miR-145, miR-145 was selected for further investigation. The results of the present study suggested that miR-145 was decreased by estrogen in a dose-dependent manner and that miR-145 suppressed OPG expression by directly binding to its 3′-UTR, which implicated its important role in regulating bone resorption. It has been reported that estrogens regulate miRNA transcription through multiple pathways (31–33). A previous study reported that estrogen upregulates OPG expression in an ERα-dependent manner. Whether ER was responsible for the suppression of miR-145 by estrogen will be investigated in future studies.

miR-145 is a miRNA that is widely reported to be dysregulated in various types of human cancer, including breast, prostate, colon and lung cancer (34). In addition, miR-145 has been reported to be downregulated in osteosarcoma cells and tissues, and serves an important role in bone cell function (35,36). miR-145 previously inhibited cell proliferation, migration, and invasive abilities of MG-63 cells by targeting Rho-associated protein kinase 1 (36). Furthermore, miR-145 served an important role in suppressing osteoblastic differentiation by targeting Osx and Cbfb, two transcription factors that are essential for bone formation (22,23). The present study is the first, to the best of our knowledge, to determine that miR-145 directly binds to and negatively regulates OPG expression. Notably, when the miR-145 binding site in the reporter vector carrying the OPG 3′-UTR was mutated, the stimulation of estrogen on the reporter activity was not completely abolished (data not shown). It is common for 3′-UTRs in mRNA to contain several miRNA-binding sites; therefore, additional miRNAs that may be involved in this process cannot be excluded. It has previously been reported that the expression levels of numerous miRNAs are altered following estrogen treatment (32,33). These estrogen-regulated miRNAs may be involved in regulating OPG expression in a direct manner or indirect manner by targeting OPG regulators. Further investigation is required to examine the action of these miRNAs on OPG expression and the underlying mechanism.

In conclusion, the present study indicated an indirect regulation of estrogen on OPG expression via modulating miR-145 expression. Estrogen suppressed miR-145 expression, and OPG was confirmed to be a direct target of miR-145. Decreased miR-145 expression, as induced by estrogen, resulted in the release of OPG 3′-UTR, thus reviving OPG expression. These findings may extend the understanding regarding the molecular mechanisms underlying estrogen-mediated OPG induction.