| Literature DB >> 28243622 |
Maria Vlasenok1, Anna Varizhuk2, Dmitry Kaluzhny3, Igor Smirnov4, Galina Pozmogova4.
Abstract
The data provided in this article are related to the research article "The expanding repertoire of G4 DNA structures" [1]. Secondary structures of G-rich oligonucleotides (ONs) that represent "imperfect" G-quadruplex (G4) motifs, i.e., contain truncated or interrupted G-runs, were analyzed by optical methods. Presented data on ON structures include circular dichroism (CD) spectra, thermal difference spectra (TDS) and UV -melting curves of the ONs; and rotational relaxation times (RRT) of ethidium bromide (EtBr) complexes with the ONs. TDS, CD spectra and UV-melting curves can be used to characterize the topologies and thermal stabilities of the ON structures. RRTs are roughly proportional to the hydrodynamic volumes of the complexes and thus can be used to distinguish between inter- and intramolecular ON structures. Presented data on ON interactions with small molecules include fluorescence emission spectra of the G4 sensor thioflavin T (ThT) in complexes with the ONs, and CD-melting curves of the ONs in the presence of G4-stabilizing ligands N-methylmesoporphyrin IX (NMM) and pyridostatin (PDS). These data should be useful for comparative analyses of classical G4s and "defective"G4s, such as quadruplexes with vacancies or bulges.Entities:
Keywords: G-quadruplexes; G4 ligands; G4 motifs; Thermal stability
Year: 2017 PMID: 28243622 PMCID: PMC5320062 DOI: 10.1016/j.dib.2017.02.023
Source DB: PubMed Journal: Data Brief ISSN: 2352-3409
Sequences of oligodeoxyribоnucleotides (ONs) and MALDI-TOF MS data. Interrupted or truncated G3+ runs are in Italics and bold.
| ON code | Sequence, 5′-3′ | m/z [M + H]+ found (calculated.) |
|---|---|---|
| Ct1 | 7335 (7332) | |
| Ct2 | GGGGACA | 7332 (7332) |
| Ct3 | GGGGACAGGGGTAT | 7333 (7332) |
| Ct4 | GGGGACAGGGGTATGGGGA | 7333 (7332) |
| CtG | GGGGACAGGGGTATGGGGAGGGG | 7358 (7357) |
| CtA | 7340 (7340) | |
| CtC | 7319 (7317) | |
| PSTP | 7651 (7652) | |
| Bcl | GGGGGCCGTGGGGTGGGAGCTGGGG | 7950 (7958) |
| BclG | GGGGGCCGTGGGGTGGGGGCTGGGG | 7978 (7974) |
| BclA | GGGGGCCGTGGGGT | 7946 (7942) |
| BclT | GGGGGCCGTGGGGT | 7933 (7933) |
| G3 | GGGTGGGTGGGTGGG | 4805 (4802) |
| G3A | GGGT | 4786 (4786) |
| G4 | GGGGTGGGGTGGGGTGGGG | 6118 (6119) |
| G4A | GGGGT | 6104 (6103) |
| G4AA | GGGGT | 6088 (6087) |
| 22AG | AGGGTTAGGGTTAGGGTTAGGG | 6967 (6968) |
| Bcl-2 | GGGCGCGGGAGGGAATTGGCGGGG | 7624 (7622) |
| cKit1 | GGGAGGGCGCTGGGAGGAGGG | 6699 (6699) |
| cMyc | TGAGGGTGGGTAGGGTGGGTAA | 6994 (6993) |
Fig. 1Characterization of genomic imGQ ONs and their derivatives by optical methods. A: UV-melting curves. B: CD spectra. The ellipticity is given per mole of nucleotide. Buffer conditions: 25 mM Tris–HCl (pH 7.5) and 100 mM КCl (unless otherwise specified; solid lines) or 100 mM LiCl (dotted lines). ON concentration was 1.5 μM. С: Rotational relaxation times (RRT) of EtBr in complexes with the ONs. The RRT values were calculated based on the measured values of fluorescence polarization and fluorescence lifetime. Control is a 27-mer hairpin. Temperature: 20 °C. ON concentration was 5 μM. D: TDS spectra. Buffer conditions: 25 mM Tris–HCl (pH 7.5) and 10 mM КCl. ON concentration was 1.5 μM.
Fig. 2Characterization of model GQ and imGQ ONs by optical methods. A: UV-melting curves. B: CD spectra. The ellipticity is given per mole of nucleotide. Buffer conditions: 25 mM Tris–HCl (pH 7.5). КСl or LiCl concentrations are specified in the figure legends. ON concentration was 1.5 μM. С: Rotational relaxation times (RRT) of EtBr in complexes with the ONs. Temperature: 20 °C. ON concentration was 5 μM. D: TDS spectra. Buffer conditions: 25 mM Tris–HCl (pH 7.5) and 10 mM КCl. ON concentration was 1.5 μM.
Fig. 3GQ stabilization by N-methylmesoporphyrin IX (NMM) and piridostatin (PDS). Melting by CD. Conditions: 20 mM Tris–HCl, 1.5 μM ON, 3 μM PDS/NMM. KCl concentrations are specified in the figure legends.
Fig. 4imGQ stabilization by N-methylmesoporhhyrin IX (NMM) and piridostatin (PDS). Melting by CD. Conditions: 20 mM Tris–HCl, 10 mM KCl, 1.5 uM ON, 3 μM PDS/NMM.
Fig. 5GQ and imGQ interactions with thioflavin T (ThT). Conditions: 20 mM Tris–HCl, 10 mM KCl (* = 1 mM KCl), 1.5 μM ON, 1.5 μM ThT. Excitation at 425 nm. BclT and Ct2 spectra almost coinside with the Ct2 spectrum.
| Subject area | |
| More specific subject area | |
| Type of data | |