Recently, we showed that generation of tumours in syngeneic mice by cells devoid of mitochondrial (mt) DNA (ρ0 cells) is linked to the acquisition of the host mtDNA. However, the mechanism of mtDNA movement between cells remains unresolved. To determine whether the transfer of mtDNA involves whole mitochondria, we injected B16ρ0 mouse melanoma cells into syngeneic C57BL/6Nsu9-DsRed2 mice that express red fluorescent protein in their mitochondria. We document that mtDNA is acquired by transfer of whole mitochondria from the host animal, leading to normalisation of mitochondrial respiration. Additionally, knockdown of key mitochondrial complex I (NDUFV1) and complex II (SDHC) subunits by shRNA in B16ρ0 cells abolished or significantly retarded their ability to form tumours. Collectively, these results show that intact mitochondria with their mtDNA payload are transferred in the developing tumour, and provide functional evidence for an essential role of oxidative phosphorylation in cancer.
Recently, we showed that generation of tumours in syngeneic mice by cells devoid of mitochondrial (mt) DNA (ρ0 cells) is linked to the acquisition of the host mtDNA. However, the mechanism of mtDNA movement between cells remains unresolved. To determine whether the transfer of mtDNA involves whole mitochondria, we injected B16ρ0 mousemelanoma cells into syngeneic C57BL/6Nsu9-DsRed2 mice that express red fluorescent protein in their mitochondria. We document that mtDNA is acquired by transfer of whole mitochondria from the host animal, leading to normalisation of mitochondrial respiration. Additionally, knockdown of key mitochondrial complex I (NDUFV1) and complex II (SDHC) subunits by shRNA in B16ρ0 cells abolished or significantly retarded their ability to form tumours. Collectively, these results show that intact mitochondria with their mtDNA payload are transferred in the developing tumour, and provide functional evidence for an essential role of oxidative phosphorylation in cancer.
Entities:
Keywords:
cancer biology; mitochondrial transfer; mouse; respiration recovery; tumour growth
Mitochondria are vital organelles of eukaryotic cells responsible for energy production and other key biochemical functions. Many human diseases, including cancer, are characterised by mutations in mitochondrial DNA (mtDNA). This is linked to altered mitochondrial bioenergetics, such that cancer cells are more glycolytic than their non-malignant counterparts, as postulated almost a century ago by Warburg. Altered energy metabolism is now regarded as one of the hallmarks of cancer (Koppenol et al., 2011; Hanahan and Weinberg, 2011; Vyas et al., 2016). In this context, the mitochondrial genome has been reported to play a role in tumorigenesis (Lee and St John, 2016; Patananan et al., 2016) and in metastatic cancer (Ishikawa et al., 2008; Hayashi et al., 2016).Although many cancer cells are biased towards the glycolytic metabolism, they also need oxidative phosphorylation (OXPHOS) for their ‘pathophysiological’ requirements (Weinberg et al., 2010). Recent research has demonstrated a new concept of cancer metabolism, emphasising the importance of OXPHOS in the tumour environment beyond its role in bioenergetics (Gentric et al., 2016). A novel paradigm has emerged, according to which respiration is important for cancer cell proliferation, and also for tumour formation, progression and metastasis (LeBleu et al., 2014; Viale et al., 2014). This is probably linked to metabolic re-modelling (Birsoy et al., 2015; Sullivan et al., 2015). There are reports that some cancer cells retain OXPHOS capacity and have no obvious respiratory defects (Frezza and Gottlieb, 2009; Jose et al., 2011). Further, inhibiting glycolysis may restore higher rates of OXPHOS in neoplastic cells (Moreno-Sánchez et al., 2007; Michelakis et al., 2010). Hence, depriving cancer cells of their capacity to respire may preclude them from forming tumours.We recently reported on the importance of respiration in tumour formation and progression (Tan et al., 2015). We showed that cancer cells without mtDNA (ρ0 cells) form tumours after a considerable delay compared to their parental counterparts. Tumour progression was associated with mtDNA acquisition from the host, resulting in respiration recovery. While these findings point to a new phenomenon of horizontal transfer of mtDNA between mammalian cells in vivo (Berridge et al., 2015, 2016), direct evidence for the role of mitochondrial respiration in tumour formation as well as understanding the mode of mtDNA acquisition is lacking.Here we provide a link between efficient tumour formation and recovery of mitochondrial respiration, and show that mtDNA acquisition occurs via trafficking of whole mitochondria.
Results
Cell lines derived from tumours that formed from B16ρ0 cells are homogeneous in mtDNA distribution and contain a fully assembled respirasome
We have shown that B16ρ0 cells injected subcutaneously into C57BL/6J mice formed syngeneic tumours with a 2–3-week delay compared to B16 cells, and next generation sequencing (NGS) indicated the host origin of mtDNA (Tan et al., 2015). Since NGS would not detect heteroplasmy of less than about 3%, a much more sensitive single cell/digital droplet (sc/dd) PCR method was used in the current study to document that the homoplasmic polymorphism at the tRNA locus of mtDNA of cell lines isolated from tumours grown subcutaneously from B16ρ0 cells (B16ρ0SC cells) is of the host origin. The assay is able to detect heteroplasmy down to 0.5%, demonstrating with very high confidence that the mtDNA in B16ρ0SC cells is of host origin, and that original B16 polymorphism is either completely absent or present below the detection limit of 0.5% of mtDNA (Figure 1A; see also Appendix 1—figure 1 for validation of sc/ddPCR).
Figure 1.
Cells derived from B16ρo cell-grown tumours feature mtDNA with host polymorphism, and recovered mitochondrial complexes and respiration.
(A) B16, B16ρ0 and B16ρ0SC cells were assessed by sc/dd PCR for polymorphism of the tRNA locus of mtDNA using specific probes (see Materials and methods). The insert shows a cell (circled) before (upper image) and after (lower image) withdrawn for analysis. (B) B16, B16ρ0, B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells were immunostained for anti-DNA (red) and anti-Tom20 or anti-TFAM IgGs (green). The upper panels represent lower resolution confocal images depicting a major part of a whole cell, the lower panels represent higher magnification STED images of the region of interest indicted by the yellow box. (C) Cells as above were subjected to NBGE followed by WB using antibodies against subunits of individual complexes. Below is a densitographic evaluation of three gels derived from individual experiments with HSP60 as the internal control. The cells were assessed for binding of POLG1 to the D-LOOP region of mtDNA using the mitoChIP assay (D), for routine respiration (E) and for respiration via CI and CII following their permeabilisation (F). The sub-lines were next assessed for lactate generation (G), ATP level (H), SDH (I), SQR (J) and CS activities (K) as well as for glucose uptake (L). The symbol ‘*' indicates statistically significant differences between individual sublines and B16 cells, the symbol ‘#' in panel C indicates statistically significant difference between individual sublines and B16ρ0 cells. The nature of the individual sublines derived from B16ρ0 cells is as follows: B16ρ0SC cells, cells derived from primary tumour grown in B57BL mice grafted with B16ρ0 cells; B16ρ0CTC cells, the corresponding circulating tumour cells; B16ρ0SCL cells, the corresponding cells isolated from lung metastases.
DOI:
http://dx.doi.org/10.7554/eLife.22187.002
Appendix 1—figure 1.
Validation of the sc/ddPCR assay for the tRNA locus.
Parental mtDNA (about 20,000 copies) was spiked with 1000; 100; 10 and 1 copy of host mtDNA. Respectively, this corresponds to the expected fractions of 5; 0.5; 0.05% and 0.005%. Red diamonds indicate the measured fractions. NTC is non-template control.
DOI:
http://dx.doi.org/10.7554/eLife.22187.007
Cells derived from B16ρo cell-grown tumours feature mtDNA with host polymorphism, and recovered mitochondrial complexes and respiration.
(A) B16, B16ρ0 and B16ρ0SC cells were assessed by sc/dd PCR for polymorphism of the tRNA locus of mtDNA using specific probes (see Materials and methods). The insert shows a cell (circled) before (upper image) and after (lower image) withdrawn for analysis. (B) B16, B16ρ0, B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells were immunostained for anti-DNA (red) and anti-Tom20 or anti-TFAM IgGs (green). The upper panels represent lower resolution confocal images depicting a major part of a whole cell, the lower panels represent higher magnification STED images of the region of interest indicted by the yellow box. (C) Cells as above were subjected to NBGE followed by WB using antibodies against subunits of individual complexes. Below is a densitographic evaluation of three gels derived from individual experiments with HSP60 as the internal control. The cells were assessed for binding of POLG1 to the D-LOOP region of mtDNA using the mitoChIP assay (D), for routine respiration (E) and for respiration via CI and CII following their permeabilisation (F). The sub-lines were next assessed for lactate generation (G), ATP level (H), SDH (I), SQR (J) and CS activities (K) as well as for glucose uptake (L). The symbol ‘*' indicates statistically significant differences between individual sublines and B16 cells, the symbol ‘#' in panel C indicates statistically significant difference between individual sublines and B16ρ0 cells. The nature of the individual sublines derived from B16ρ0 cells is as follows: B16ρ0SC cells, cells derived from primary tumour grown in B57BL mice grafted with B16ρ0 cells; B16ρ0CTC cells, the corresponding circulating tumour cells; B16ρ0SCL cells, the corresponding cells isolated from lung metastases.DOI:
http://dx.doi.org/10.7554/eLife.22187.002We next analysed the properties of B16, B16ρ0 and B16ρ0SC cells, as well as a B16ρ0CTC sub-line derived from circulating tumor cells and a B16ρ0SCL sub-line derived from lung metastases (Tan et al., 2015). Appendix 1–figure 2A documents confocal microscopy analysis of mtDNA in mitochondria, showing that B16ρ0 cells lack mtDNA, whereas mtDNA appears homogeneously distributed in mitochondria in all other sub-lines. Super-resolution stimulated emission depletion (STED) microscopy exerted similar levels and distribution of mtDNA nucleoids in B16, B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells, and no nucleoids in B16ρ0 cells, also showing largely unchanged levels of Tom20 and low level of TFAM (Figure 1B; see also Appendix 1—figure 2E). Native blue gel electrophoresis (NBGE) revealed that B16ρ0 cells do not contain the supercomplex/respirasome (formed by CI, CIII and CIV), but contain low amounts of sub-CV (Figure 1C). CII was found to be fully assembled in all sub-lines, which is reasonable considering that all four subunits in CII are encoded by nuclear DNA (nDNA) (Figure 1C). To test if cells replicate their mtDNA, we established the mitochondrial chromatin immunoprecipitation (mitoChIP) assay. This showed a high level of DNA polymerase-γ1 (POLG1) binding to the D-LOOP region of mtDNA in all cells except B16ρ0 cells (Figure 1D). B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells showed similar respiration to B16 cells, but no respiration was observed with B16ρ0 cells (Figure 1E,F). Accordingly, B16ρ0 cells produced more lactate (Figure 1G) and less ATP (Figure 1H). B16ρ0 cells also had lower succinate dehydrogenase (SDH) (Figure 1I) and succinate quinone reductase (SQR) (Figure 1J) activity, as well as lower citrate synthase (CS) activity (Figure 1K). Finally, we observed higher glucose uptake in B16ρ0 and B16ρ0SC cells, and lower uptake in B16ρ0SCL cells (Figure 1L). Collectively, these results document that mitochondrial function is already fully restored in cells derived from the primary tumour.
Appendix 1—figure 2.
Tumour cells derived from primary tumour have restored mitochondrial function.
(A) B16, B16ρ0, B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells were stained with MitoTracker Red for mitochondria, EtBr for mtDNA and Hoechst 33342 for nuclei. (B) B16 sub-lines were probed using real-time (RT)PCR for expression of mtDNA and selected genes encoded by nDNA and mtDNA. The data are mean values ± S.D. derived from three individual experiments. (C) B16 sub-lines were subjected to SDS-PAGE followed by WB using various IgGs. (D) Control cells and cycloheximide-treated cells (5 µM, time as shown in the figure) were separated by SDS-PAGE and subjected to IgGs for selected mitochondrial proteins. (E) B16 sublines were subjected to SDS-PAGE followed by WB using anti-TFAM and anti-Tom20 IgG. Data shown are representative of three independent experiments.
DOI:
http://dx.doi.org/10.7554/eLife.22187.008
We next analysed cells for their mtDNA levels and expression of selected transcripts. Appendix 1—figure 2B shows no mtDNA in B16ρ0 cells, while mtDNA was present at similar levels in other sub-lines. No mtDNA-encoded transcripts were present in B16ρ0 cells. Their levels were low in B16ρ0SC cells, while higher levels were seen for most transcripts in B16ρ0CTC and in B16ρ0SCL cells. Transcripts of the assembly factor SCAFI were present at similar levels in all sub-lines, but TFAM transcripts were low in B16ρ0 cells relative to the other cells. Transcripts of nDNA genes coding for subunits of respiratory complexes were found to be present in all cells, with some being lower in B16ρ0 cells. WB revealed that most proteins investigated were relatively abundant in all sub-lines with LC3AII levels lower in B16ρ0 cells, indicating stalled autophagy (Appendix 1—figure 2C). Interestingly, although present in B16ρ0 cells, many nDNA-encoded mitochondrial proteins, including subunits of RCs, were unstable in these cells, as evidenced using cycloheximide treatment (Appendix 1—figure 2D). Exceptions were SDHA and ATPβ; a plausible reason is the absence of binding partners encoded by mtDNA, which could render the ‘unassembled nDNA-encoded’ subunits unstable. In summary, these results indicate that, in contrast to 4T1 cells (Tan et al., 2015), the respiratory function of B16 sublines is already fully recovered at the primary tumour stage.
Recovery of B16ρ0 cell respiration fully restores their propensity to form tumours
Given the rapid recovery of respiratory function in the B16 model, we next tested tumour-forming capacity of B16 and B16ρ0 cells, and of the sub-lines B16ρ0SC, B16ρ0CTC and B16ρ0SCL, derived from various tumour stages as described above. We found that all sub-lines formed tumours without delay except for B16ρ0 cells with >2 week delay (Figure 2A). Sectioning of tumours derived from all five sub-lines revealed melanomas with necrotic cells away from blood vessels (Figure 2B). Tumours derived from the sub-lines were assessed by NBGE, identifying full assembly of all complexes as well as the respirasome, with somewhat higher levels of the respirasome in tumours derived from B16ρ0 cells (Figure 2C). WB revealed similar levels of expression of most proteins tested in the five types of tumours (Figure 2D). No obvious differences in the expression of genes coding for transcripts of individual subunits of mitochondrial complexes encoded by mtDNA and nDNA were observed (Figure 2E). Finally, we tested respiration of tumour tissues derived from the sub-lines. Figure 2F reveals increased CI-dependent respiration and the maximum electron transfer capacity (ETS) in tumours derived from B16ρ0 and from B16ρ0SCL cells, and no change in CII-dependent respiration. Normal liver tissue from the same animals used as internal control showed no changes in respiration. The restoration of the tumorigenic potential fully correlates with the observed recovery of respiration.
Figure 2.
B16ρ0 cells form tumours with a delay and with fully assembled respirasome.
(A) B16, B16ρ0, B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells were grafted in C57BL/6J mice (106 cells per animal; 6 mice per group), and tumor growth was evaluated using USI. (B) Tumours derived from individual sub-lines were fixed and sectioned, and inspected following H and E staining. (C) Individual tumours were subjected to NBGE followed by WB to visualize mitochondrial SCs and RCs. SDS-PAGE followed by WB with antibodies to subunits of mitochondrial RCs and other proteins was used to assess their levels (D), qPCR was used to assess the levels of representative mtDNA- and nDNA-coded mRNAs (E). (F) Tumor (left) and liver tissues (right) from mice grafted with individual B16 sub-lines were assessed for CI- and CII-dependent respiration, and for maximal uncoupled respiration (ETS, tumour only). The symbol ‘*' indicates statistically significant differences between tumours derived from individual sub-lines and tumours derived from B16 cells.
DOI:
http://dx.doi.org/10.7554/eLife.22187.003
B16ρ0 cells form tumours with a delay and with fully assembled respirasome.
(A) B16, B16ρ0, B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells were grafted in C57BL/6J mice (106 cells per animal; 6 mice per group), and tumor growth was evaluated using USI. (B) Tumours derived from individual sub-lines were fixed and sectioned, and inspected following H and E staining. (C) Individual tumours were subjected to NBGE followed by WB to visualize mitochondrial SCs and RCs. SDS-PAGE followed by WB with antibodies to subunits of mitochondrial RCs and other proteins was used to assess their levels (D), qPCR was used to assess the levels of representative mtDNA- and nDNA-coded mRNAs (E). (F) Tumor (left) and liver tissues (right) from mice grafted with individual B16 sub-lines were assessed for CI- and CII-dependent respiration, and for maximal uncoupled respiration (ETS, tumour only). The symbol ‘*' indicates statistically significant differences between tumours derived from individual sub-lines and tumours derived from B16 cells.DOI:
http://dx.doi.org/10.7554/eLife.22187.003
Suppression of respiration interferes with efficient tumour formation
We have shown for B16 cells (Figures 1 and 2, Appendix 1—figure 2) and previously for 4T1 cells (Tan et al., 2015) that tumour formation from their respective ρ0 variants correlates with the acquisition of mtDNA and recovery of respiration. However, direct evidence for the requirement of respiration for tumour formation has been missing. We therefore prepared B16 and B16ρ0 cells with suppressed levels of NDUFV1 (the catalytic subunit of CI) or SDHC (ubiquinone-binding CII subunit essential for its SQR activity) by RNA interference (RNAi) using two different shRNAs for each protein. Figure 3A shows that NDUFV1 shRNA#2 and SDHC shRNA#2 were rather efficient in knocking down the respective proteins. Figure 3A also reveals that NDUFV1 knock-down (KD) cells exhibit lower level of CI subunits (NDUFV1 and NDUFS3) while CII subunits (SDHA and SDHC) were unaffected. Conversely, SDHC KD cells showed low levels of CII subunits and also decreased levels of CI subunits. We used cells stably transfected with NDUFV1 shRNA#2 or SDHC shRNA#2 in subsequent experiments. Both NDUFV1 KD and SDHC KD cells proliferated at a slower rate than parental cells (Figure 3B). NDUFV1 KD as well as SDHC KD cells showed lower routine respiration and lower ETS (Figure 3C). NDUFV1 KD cells respired less via CI, while CII-dependent respiration was largely unaffected; SDHC KD cells not only showed much lower CII-dependent respiration, but also significantly suppressed CI-dependent respiration (Figure 3D).
Figure 3.
Suppression of respiration deregulates tumour growth.
(A) B16 and B16ρ0 cells were stably knocked down for either NDUFV1 or SDHC, or transfected with non-silencing (NS) shRNA, and the expression of NDUFS3, NDUFV1, SDHA and SDHC was assessed by WB. The sub-lines were next evaluated for proliferation on days 1 (D1), D2, D3 and D4 (B), for routine, leak and ETS respiration (C), and for respiration via CI and CII (D). Balb/-c nude mice were injected s.c. with 5 × 106 B16ρ0 cells as well as cells with NDUFV1 KD or SDHC KD cells (E), or with B16 cells and the derived NDUFV1 KD or SDHC KD cells (F), with six mice per group except for the NDUFV1 group with five animals. Individual mice were assessed for tumor volume using USI. Tumours derived from B16ρ0 and B16 cells were averaged and plotted as mean values, while tumours derived from knock-down cells were plotted individually. Circles on the X-axis represent individual mice in which tumours did not form within the duration of the experiment. (G) Mice with tumours derived from cell lines as shown in the Figure were sacrificed, and tumours fixed, sectioned and stained with H and E. The symbol ‘*' indicates statistically significant differences between B16 cells and NDUFV1 KD or SDHC KD cells.
DOI:
http://dx.doi.org/10.7554/eLife.22187.004
Suppression of respiration deregulates tumour growth.
(A) B16 and B16ρ0 cells were stably knocked down for either NDUFV1 or SDHC, or transfected with non-silencing (NS) shRNA, and the expression of NDUFS3, NDUFV1, SDHA and SDHC was assessed by WB. The sub-lines were next evaluated for proliferation on days 1 (D1), D2, D3 and D4 (B), for routine, leak and ETS respiration (C), and for respiration via CI and CII (D). Balb/-c nude mice were injected s.c. with 5 × 106 B16ρ0 cells as well as cells with NDUFV1 KD or SDHC KD cells (E), or with B16 cells and the derived NDUFV1 KD or SDHC KD cells (F), with six mice per group except for the NDUFV1 group with five animals. Individual mice were assessed for tumor volume using USI. Tumours derived from B16ρ0 and B16 cells were averaged and plotted as mean values, while tumours derived from knock-down cells were plotted individually. Circles on the X-axis represent individual mice in which tumours did not form within the duration of the experiment. (G) Mice with tumours derived from cell lines as shown in the Figure were sacrificed, and tumours fixed, sectioned and stained with H and E. The symbol ‘*' indicates statistically significant differences between B16 cells and NDUFV1 KD or SDHC KD cells.DOI:
http://dx.doi.org/10.7554/eLife.22187.004We next grafted B16, B16ρ0 and B16 cells, as well as their derived NDUFV1 KD and SDHC KD cells into C57BL/6J mice. Figure 3E shows that tumours started to grow from B16ρ0 cells shortly after day 20 post-grafting of B16ρ0 cells in all mice. 4 out of 6 mice grafted with B16ρ0 SDHC KD cells formed tumours with delays of 15 to 40 days compared to B16ρ0 cells. Only one out of 5 mice of the B16ρ0 NDUFV1 KD group formed a tumour, with a lag of about 40 days compared to B16ρ0 cells. A similar pattern was observed for B16 cells and their NDUFV1 KD and SDHC KD variants, though the lag for these sub-lines was considerably shorter (Figure 3F). On pathological examination of the different tumours, relatively subtle differences in morphology were observed (Figure 3G). B16 melanoma cells form tumours in control mice (NS) showed prominent nuclear pleomorphism. They appeared more aggressive than cells from ρ0 tumours. Tumours derived from both B16 NDUFV1 KD and B16 SDHC KD cells showed better histological differentiation associated with eosinophilic cytoplasm, vesicular nuclei and frequent deposits of melanin pigments, indicating the KD cells are less aggressive than their parental counterpart. There were no obvious differences in morphology of the 3 types of ρ0 melanoma cells. Both B16ρ0 NDUFV1 KD and B16ρ0 SDHC KD tumours showed focal areas of nuclear pleomorphism and frequent mitotic features.These data clearly point to respiration recovery as essential for driving efficient tumour formation, since suppression of respiration completely deregulated this process. Interestingly, while with CII suppression the majority of mice formed tumours (albeit with additional lag time), most mice grafted with CI-compromised cells failed to form tumours within 100 days. In summary, we show that respiration is important for efficient tumour formation, which is consistent with recent reports (Weinberg et al., 2010; Birsoy et al., 2015; Sullivan et al., 2015).
B16ρ0 cells acquire mtDNA via transfer of whole mitochondria from the host
We have previously documented the host origin of mtDNA in cancer cells isolated from primary tumours derived from 4T1ρ0 and B16ρ0 cells based on NGS analysis (Tan et al., 2015), which we confirmed here for B16ρ0SC cells using the more sensitive sc/dd PCR assay (Figure 1A). The only plausible explanation for this phenomenon is the transfer of mtDNA from host cells to tumour cells with compromised mtDNA. The question of how mtDNA moves between cells has not been addressed. An attractive scenario is that whole mitochondria with their payload of mtDNA are transferred, but alternative explanations such as cell fusion have also been suggested (Vitale et al., 2011; Maiuri and Kroemer, 2015). Mesenchymal stem cells (MSCs) have been proposed as donors of mitochondria due to their high levels of Miro-1, which is the adaptor protein responsible for mitochondrial association with the microtubule mobility complex (Ahmad et al., 2014; Mills et al., 2016). We performed co-culture of MSCs isolated from C57BL/6J mouse bone marrow with either B16 or B16ρ0 cells. Prior to co-culture, the mitochondria of the potential donor (MSC or B16) cells were labelled with mitochondrial dark red fluorophore (MitoDR). Carboxyfluorescein succinimidyl ester (CFSE) that binds covalently to amino acid residues inside cells was used for staining the potential recipient (B16 or B16ρ0) cells. Following co-culture, cells were assessed by confocal microscopy to determine the extent of mitochondrial transfer to recipient cells. Representative images and quantitative evaluation (Figure 4A, Appendix 1—figure 3A,B) reveal accumulation of MitoDR stained mitochondria in CFSE stained ρ0 cells, as a result of their transfer from MitoDR stained MSCs. In similar experiments, pairs of either CFSE+B16 / MitoDR+MSC or CFSE+B16ρ0/MitoDR+B16 cells did not show any evidence of MitoDR stained mitochondria in CFSE positive cells, thereby excluding dye diffusion. Collectively, this indicates that transfer of mitochondria between cells in a regulated process.
Figure 4.
mtDNA transfers from host cells to B16ρ0 cells in whole mitochondria.
(A) MSCs prepared from C57BL/6J mice were labelled with Mito Deep Red (MitoDR) targeted to mitochondria, B16 or B16ρ0 cells were labelled with CFSE. On the left, confocal micrographs are shown for MSCs labelled with MitoDR co-cultured with B16 or B16ρ0 cells, or B16 cells labelled with MitoDR co-cultured with B16ρ0 cells labelled with CFSE for 24 hr. On the right, evaluation of confocal microscopy is shown. (B) C57BL/6N mice with red fluorescent mitochondria were grafted subcutaneously with 106 B16ρ0 cells stably transfected with nBFP. After 11 days, a mouse was sacrificed and the pre-tumour lesion excised and digested into the single cell population, which was sorted for double positive (DP) (red and blue fluorescent) cells. The cells were then inspected by confocal microscopy for blue nuclei and red mitochondria. The image shows maximum intensity Z-projection of a representative DP cell. (C) Parental B16, ρ0 and ρ0DP cells were evaluated for mitochondrial morphology using transmission electron microscopy. (D) Parental cells and their ρ0 and DP counterparts were imunnostained for DNA, TFAM and Tom20, and inspected by STED microscopy for mitochondrial nucleoids. The upper panels show a confocal image of a major part of a whole cell, the lower images depict higher magnification of the regions of interest indicated above by the yellow box obtained by STED. (E) Parental cells and their ρ0 and DP counterparts were assessed for binding of POLG1 to the mtDNA D-LOOP region using mitoChIP. (F) Parental cells and their ρ0 and DP counterparts were evaluated for routine respiration or respiration via CI and CII. (G) B16 cells and their ρ0 and DP counterparts were grafted s.c. in C57BL/6J mice at 106 per animal and tumour growth evaluated by USI. The symbol ‘*' indicates statistically significant differences between individual B16ρ0 or B16ρ0 DP cells and parental B16 cells.
DOI:
http://dx.doi.org/10.7554/eLife.22187.005
Appendix 1—figure 3.
The efficiency of mitochondrial transfer during pair-wise co-culture of MSC, B16 and B16ρ0 was assessed by confocal imaging after 24 hr co-culture in vitro.
The donor mitochondria were labelled with MitoTracker Deep Red, a mitochondria targeted stain (red), while putative recipient cells were stained with cytoplasmic stain, CFSE (green), and the nucleus was stained with DAPI (blue). Cells were stained 2 hr prior to co-culture. Panel A shows representative images with separate colour channels for each co-culture pair, as labelled. Panel B shows Z stacks for the composite images. Panel C documents mitochondrial transfer from MSCs isolated from C57BL/6N mice with DsRed mitochondria co-cultured with ρ0 cells labelled with nBFP and pmGFP.
DOI:
http://dx.doi.org/10.7554/eLife.22187.009
mtDNA transfers from host cells to B16ρ0 cells in whole mitochondria.
(A) MSCs prepared from C57BL/6J mice were labelled with Mito Deep Red (MitoDR) targeted to mitochondria, B16 or B16ρ0 cells were labelled with CFSE. On the left, confocal micrographs are shown for MSCs labelled with MitoDR co-cultured with B16 or B16ρ0 cells, or B16 cells labelled with MitoDR co-cultured with B16ρ0 cells labelled with CFSE for 24 hr. On the right, evaluation of confocal microscopy is shown. (B) C57BL/6N mice with red fluorescent mitochondria were grafted subcutaneously with 106 B16ρ0 cells stably transfected with nBFP. After 11 days, a mouse was sacrificed and the pre-tumour lesion excised and digested into the single cell population, which was sorted for double positive (DP) (red and blue fluorescent) cells. The cells were then inspected by confocal microscopy for blue nuclei and red mitochondria. The image shows maximum intensity Z-projection of a representative DP cell. (C) Parental B16, ρ0 and ρ0DP cells were evaluated for mitochondrial morphology using transmission electron microscopy. (D) Parental cells and their ρ0 and DP counterparts were imunnostained for DNA, TFAM and Tom20, and inspected by STED microscopy for mitochondrial nucleoids. The upper panels show a confocal image of a major part of a whole cell, the lower images depict higher magnification of the regions of interest indicated above by the yellow box obtained by STED. (E) Parental cells and their ρ0 and DP counterparts were assessed for binding of POLG1 to the mtDNA D-LOOP region using mitoChIP. (F) Parental cells and their ρ0 and DP counterparts were evaluated for routine respiration or respiration via CI and CII. (G) B16 cells and their ρ0 and DP counterparts were grafted s.c. in C57BL/6J mice at 106 per animal and tumour growth evaluated by USI. The symbol ‘*' indicates statistically significant differences between individual B16ρ0 or B16ρ0 DP cells and parental B16 cells.DOI:
http://dx.doi.org/10.7554/eLife.22187.005We next conducted a co-culture experiment, in which MSCs were isolated from transgenic C57BL/6N mice with red fluorescent mitochondria in somatic cells. These cells were cultured with ρ0 cells transfected with a plasmid coding for nuclear targeted blue fluorescence protein (nBFP) and plasma membrane green fluorescence protein (pmGFP). Appendix 1—figure 3C documents transfer of DsRed mitochondria from MSCs into the recipient ρ0 cells via an intracellular bridge.To investigate the origin of mtDNA and the manner of its transfer between host and cancer cells in vivo, we used transgenic C57BL/6N mice with red fluorescent mitochondria in somatic cells. B16ρ0 cells transfected with a plasmid coding for nuclear-targeted blue fluorescent protein (nBFP) were injected subcutaneously into C57BL/6N mice. Several days later, mice were sacrificed, the pre-tumour lesion excised, and single cell suspension sorted for double-positive (DP) cells with both red and blue fluorescence that on average were found with the frequency of 0.23 ± 0.18 in the BFP-positive population. Immediately after sorting, B16ρ0 DP cells were plated and inspected by confocal microscopy within about 12 hr before red fluorescence in mitochondria has been lost. Figure 4B shows an image of a B16ρ0 DP cell prepared from a day 11 pre-tumour lesion, identifying mouse stromal cells as a source of mitochondria that moved into a grafted B16ρ0 cell. The sorted DP cells were established as a sub-line. B16, B16ρ0, and B16ρ0 DP cells were subjected to transmission electron microscopy and STED microscopy to show the presence of fully formed mitochondrial cristae (Figure 4C) and mtDNA nucleoids in DP cells (Figure 4D). DP cells also showed strong binding of POLG1 to the D-LOOP region of mtDNA (Figure 4E) as well as recovery of respiration (Figure 4F), and showed a propensity to form tumours without a lag phase (Figure 4G). These results document that mtDNA is transferred from stromal cells to B16ρ0 cells within intact mitochondria, resulting in the restoration of respiration and in efficient tumour formation.
Discussion
Horizontal gene transfer is a process that until recently had not been known in mammals (Keeling and Palmer, 2008), but has been described for lower eukaryotes (Gladyshev et al., 2008), affecting their phenotype (Boschetti et al., 2012). In mammals, the mitochondrial gene transfer has been inferred in a 10,000 year-old canine transmissible venereal tumour (CTVT) (Rebbeck et al., 2011; Murchison et al., 2014; Strakova and Murchison, 2015). These predictions have now been confirmed, and a recent study showed at least 5 mtDNA transfers in CTVT within the last 1–2 thousand years (Strakova et al., 2016). Mitochondrial transfer was reported in vitro with functional consequences (Spees et al., 2006; Wang and Gerdes, 2015), as well as in mice with endogenously injected MSCs (Islam et al., 2012; Ahmad et al., 2014), but these results could also be explained by the association of membrane-bound particles or exosomes containing mitochondria with the damaged cells rather than functional mitochondria proliferating/dividing inside cells. A recent publication from our laboratory showed, for the first time, horizontal transfer of mitochondrial genes between mammalian cells in vivo, based on acquisition of host mtDNA by ρ0 tumour cells and on the presence of host mtDNA markers in cell lines derived from these tumours (Tan et al., 2015). Several subsequently published papers also provide evidence for horizontal transfer of mitochondria under (patho)physiological conditions (Lei and Spradling, 2016; Hayakawa et al., 2016; ,Osswald et al., 2015; Moschoi et al., 2016), pointing to OXPHOS as a factor complicating cancer therapy (Osswald et al., 2015; Moschoi et al., 2016, Matassa et al., 2016). Hence, our data, along with those of other groups, point to mitochondrial transfer as a highly dynamic field of research, with important implications for the conceptual understanding of cancer.Our recent findings (Tan et al., 2015) provoke a number of questions, such as whether respiration is essential for tumour formation, and what is the mode of mtDNA acquisition. To address these queries, B16 metastatic melanoma cells without mtDNA and with compromised respiratory function were used. We show that B16ρ0 cells do not form tumours unless they acquire mtDNA and that severe suppression of either CI- or CII-dependent respiration leads to impaired ability to form tumours, directly linking mitochondrial respiration and tumor growth. The reason(s) for the apparently greater importance of CI-dependent respiration in tumour formation (Figure 3E,F) remain to be explored, particularly when the role of SDH in metabolic re-modelling is taken into consideration (Cardaci et al., 2015; Lussey-Lepoutre et al., 2015). From a mechanistic point of view, CI is essential for respirasome assembly (Moreno-Lastres et al., 2012) that is needed for CI-dependent respiration (Acín-Pérez et al., 2008; Lapuente-Brun et al., 2013; Tan et al., 2015). Another indication of the importance of CI is the finding that tumours derived from B16ρ0 cells feature much higher CI-dependent respiration (Figure 2F).We document here that the primary tumour-derived B16ρ0SC cells feature a fully assembled respirasome and complete recovery of respiration, while corresponding 4T1ρ0SC cells show only partial (20–25%) recovery of respiration (Tan et al., 2015). Consistent with this, 4T1ρ0SC cells formed tumours with a longer delay than parental 4T1 cells, while no delay was observed for B16ρ0SC cells. This is likely related to the higher requirement of B16ρ0 cells for respiration recovery to form tumours. This ‘threshold’, apparently lower for 4T1ρ0 cells, may be due to higher routine respiration of B16 cells of some 100 pmol O2/s/106 cells (Figure 1E) when compared to less than 20 pmol O2/s/106 cells for 4T1 cells (Tan et al., 2015). Additionally, the different genetic changes in B16 melanoma and 4T1 breast carcinoma cells could underpin altered respiration recovery. Whether there is a link to a requirement for ‘threshold’ recovery of respiration for cancer cells to initiate tumour formation has yet to be determined. We propose the term ‘OXPHOS addiction’ to describe the requirement for mitochondrial respiration across the landscape of tumours, and will investigate this in more detail in future research.A key question has been the mode of movement of mtDNA between cells. Both selective transfer of mitochondria and cell fusion have been proposed in the past (Tan et al., 2015; Vitale et al., 2011). Using C57BL/6N mice with red fluorescent mitochondria in somatic cells, we now provide evidence for acquisition of mtDNA by the trafficking of whole mitochondria from host donor cells to ρ0 cells both in vivo (Figure 4B), resulting in long-lasting respiration recovery and, consequently, efficient tumour formation (Figure 4E–G). The transient nature of dsRed expression in recipient B16ρ0 cell mitochondria in the in vivo model sheds additional light on the mechanism of mitochondrial transfer. When dsRed-containing mitochondria are selectively transferred from the host into the recipient cells, dsRed cannot be replenished in the donated mitochondria by de novo synthesis (not being encoded in the recipient’s nuclear genome), and the red fluorescence in donated mitochondria is quickly lost. On the other hand, if cell fusion were responsible for the observed acquisition of mitochondria from the donor cells (Maiuri and Kroemer, 2015), the donor’s nuclear material would also be transferred, and mitochondrial dsRed expression would be maintained. As this is not the case, the selective transfer of whole, intact mitochondria remains the only possible explanation of our experimental data. The next step will be to investigate the mechanism of mitochondrial trafficking between cells in vivo, with tunnelling nanotubes being a plausible mode of intercellular transfer of the organelles (Rustom et al., 2004; Rogers and Bhattacharya, 2014; Rustom, 2016).We conclude that recovery of respiration in tumor cells with damaged mtDNA is essential for efficient tumour formation and that this is accomplished by the intercellular transfer of whole mitochondria. Our findings are consistent with the emerging notion of the essential role of respiration in cancer cell proliferation and tumor progression (LeBleu et al., 2014; Viale et al., 2014; Birsoy et al., 2015; Sullivan et al., 2015; Cardaci et al., 2015; Lussey-Lepoutre et al., 2015; Berridge et al., 2015; Viale et al., 2015), and of a role for mitochondrial transfer in maintaining the bioenergetics balance (Sinha et al., 2016; Wu et al., 2016). From translational angle, recent studies on horizontal mitochondrial transfer indicate two tantalising, novel approaches to cancer therapy: targeting mitochondrial respiration and blocking transfer of mitochondria from stromal cells to cancer cells. While we have started exploring the first approach (Dong et al., 2011; Boukalova et al., 2016; Kluckova et al., 2015; Rohlenova et al., 2017), the other approach remains untested, with recent papers (Osswald et al., 2015; Moschoi et al., 2016) pointing to its plausibility. Finally, to the best of our knowledge, this paper is the first report to show lasting functional consequences of a well-documented mitochondrial transfer event.
Materials and methods
Cell culture
Cell lines were prepared and maintained as described (Tan et al., 2015). C57BL/6J mice were used as host animals for grafting B16 sub-lines as indicated (Tan et al., 2015). B16 lines formed syngeneic tumours in C57BL/6J mice indicating their authenticity. Parental and ρ0 cells with BFP nuclei were prepared by stable transfection with the pTagBFP-H2B plasmid (Evrogen) followed by clonal selection. RNAi was used to knock down NDUFV1 or SDHC subunits, using two different shRNAs (OriGene) for each protein. In brief, cells were transfected with shRNA using a standard protocol and inspected by WB for protein levels. Cells with more efficient knock-down of NDUFV1 or SDHC were used in further experiments.
Isolation of mesenchymal stem cells and their co-culture with cancer cells
Mouse MSCs were isolated from C57BL/6J mice as described earlier (Ahmad et al., 2014). The primary cells were plated at the density of 106 cells/ml in T25 culture flasks and experiments were performed after the fourth passage. For co-culture experiments, MSCs were stained with Mito Deep Red (Ex/Em, 644/665 nm; Invitrogen) and B16ρ0 cells with the CFSE dye (Ex/Em, 492/517 nm; Invitrogen) for 15 min. The cells were then co-cultured for 24 hr and evaluated by flow cytometry (FACS Calibur) and confocal microscopy (63 x; Leica SP8). Mitochondrial transfer was primarily ascertained by a fraction of CFSE-positive cells that were also MitoDeepRed-positive. The quantitative mitochondrial transfer was primarily ascertained by pixel counts on Z-stack confocal images i.e. red pixels in cells with green background. Geometric mean intensity of MitoDeerRed fluorescence in double positive cells was additionally calculated, as a confirmatory measurement of the degree of mitochondrial transfer. Other co-culture combinations (MSCs with B16 cells, B16 cells with B16ρ0 cells) were performed in a similar fashion. Additionally, ρ0 cells were transfected with a plasmid coding for nBFP and pmGFP followed by clonal selection. Transfected ρ0 cells were seeded with MSCs prepared from C57BL/6N mice in glass-bottom dishes (In Vitro Scientific) at 1:1 ratio and co-cultured for 24 hr. Live cells were inspected using the inverted fluorescence microscope Delta Vision Core with laser photo-manipulation. The acquired images were deconvolved by Huygens Professional software (Scientific Volume Imaging) and processed by FiJi ImageJ software.
Animals
C57BL/6J mice were used for most of the experiments. They were purchased from the Animal Resources Centre or produced by the animal breeding facilities of the Institute of Biotechnology and Malaghan Institute. In all cases, the mice were grafted subcutaneously with various cell lines at 5 × 105 cells per animal. Tumours were monitored by ultrasound imaging (USI) using the Vevo770 system (VisualSonics, Toronto, Canada). Transgenic mice expressing red fluorescent protein in somatic cell mitochondria (the CAG/su9-DsRed2 transgene) were generated in the Transgenic Unit of the Czech Centre for Phenogenomics, Institute of Molecular Genetics, Prague, Czech Republic, using a pronuclear injection from the construct provided by Prof. Masaru Okabe (Osaka University, Japan) (Hasuwa et al., 2010) and C57BL/6N mice. The stable colony of transgenic mice was housed in the animal facility of the Faculty of Science, Charles University, Prague, Czech Republic, and food and water were supplied ad libitum. The mice used for the grafting experiments were healthy 10 weeks old animals with no sign of stress or discomfort. All animal procedures and experimental protocols were approved by the Animal Welfare Committee of the Czech Academy of Sciences (Animal Ethics Number 18/2015).
Single cell-digital droplet PCR
Details of the methodology are in the Supplemental information.
Microscopic and flow cytometric cell evaluation, cell sorting and STED microscopy
Details of the methodology are in the Supplemental information.
Mitochondrial biochemistry assays, gene expression analysis and respiration assays
Details of the methodology are in the Supplemental information.
Statistical analysis
Unless stated otherwise, data are mean values ± S.D. of at least three independent experiments. In mouse experiments, groups of 6 animals were used, unless stated otherwise. The two-tailed unpaired Student’s t test was used to assess statistical significance with p<0.05 being regarded as significant. Images are representative of three independent experiments.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Horizontal transfer of whole mitochondria restores tumorigenic potential in mitochondrial DNA-deficient cancer cells" for consideration by eLife. Your article has been favorably evaluated by Sean Morrison (Senior Editor) and three reviewers, one of whom, Ralph DeBerardinis (Reviewer #1), is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has agreed to reveal their identity: Konstantin Khrapko (Reviewer #3).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:This paper examines the role of mitochondrial function in the growth of B16-derived melanoma xenografts in a syngeneic model. It follows from a previous study from the same authors demonstrating that rho0 B16 cells acquire mtDNA from the host during tumorigenesis. Here the authors provide two new types of information. First, they significantly extend their previous work to demonstrate the importance of, and selection for, cells with electron transport chain function during tumorigenesis in this model. Second, the authors use additional mouse models to provide evidence for direct transfer of intact mitochondria from the host into rho0 melanoma cells during tumor growth, as opposed to cellular fusion events or transfer of mtDNA. This is a provocative finding, novel to models of cancer biology.Essential revisions:1) In Figure 3, additional controls are needed. NDUFV1 and SDHC should be silenced with multiple independent shRNAs, ideally with rescue using cDNAs resistant to shRNA knockdown. Statistics are required for Figure 3B.2) Figure 4A: It is unclear that the data represent true transfer of intact mitochondria. The MitoDR dye diffuses into the cell and then accumulates in the mitochondria. Therefore, simple dye transfer from donor to recipient would produce the same result. A better experiment would be to fuse GFP or another fluorescent marker to a nuclear-encoded protein that is targeted to the mitochondria.3) Figure 4A: It is unclear why mitochondria from MSCs are transferred to B16p˚ cells but not B16 cells. Because the analysis was performed just 12 hours after co-culture, the result should not be influenced by selective pressure. This implies a regulated process of transfer, e.g. structural changes that facilitate acceptance of transfer or a signaling-mediated event. If true, this would be the most interesting and surprising component of the paper. This should be studied more thoroughly.4) Figure 4A: More systematic analysis of the images, including analysis of z-stacks, is required to assure that the transferred mitochondria are really inside the recipient cells. In addition, it is unclear how the quantification of this result was done; more detail should be added to the legend. The middle image should have separate color channels.5) Figure 4B: It appears that the recipient cells contain many mitochondria, but to better understand the result, it is important to visualize all mitochondria in the double positive cells to determine the portion that are labeled with DsRed. Also, if mitochondria are transferred over the 11-day period of the tumor experiment, the labeled mitochondria would be expected to fuse with the rho-zero mitochondria, resulting in diffusion of the DsRed. This figure also needs data from several mice to assess the reproducibility of the findings and the frequency of double-positive cells, which appears to be extremely low.6) Figure 4C is hard to interpret. It does not look like images of mitochondria and nucleoids from other studies. It would be helpful to outline the cell boundaries to help the reader understand the image.Essential revisions:1) In Figure 3, additional controls are needed. NDUFV1 and SDHC should be silenced with multiple independent shRNAs, ideally with rescue using cDNAs resistant to shRNA knockdown. Statistics are required for Figure 3B.The reviewers are correct that several different shRNAs should be used. In response to this well taken point, we state that we used four different shRNAs for both NDUFV1 and SDHC. We assessed the level of expression of the relevant proteins and respiration in cell lines transfected with all four shRNAs. In Figure 3A, we document protein levels for shRNA#1 and shRNA#2 for both NDUFV1 and SDHC. In Figures 3B-D we only show proliferation and respiration (both routine and CI- and CII-dependent) for the more efficient shRNA#2 (for both NDUFV1 and SDHC). Since we then wanted to perform the experiments (respiration and tumour growth) using the shRNA with higher level of knock down, we focused on shRNAs #2 for both NDUFV1 and SDHC. We decided not to carry out the functional experiments with shRNAs #1 due to their less profound effect on the protein levels. The fact that in case of SDHC shRNA and, in particular NDUFV1 shRNA, we observed highly delayed tumour growth initiation or no tumour growth within 100 days after grafting the cells (with the corresponding ρ0 cells giving rise of tumour growth within 20-25 days), we believe that the knock down (also given its effect on respiration shown in Figure 3C and D), is causally linked to knocking down of SDHC and NDUFV1, respectively. It is important that both SDHC and NDUFV1 knockdowns led to a delay in tumor formation. It is quite unlikely that both an SDHC and NDUFV1 shRNA would manifest an off-target effect that would result in a delay of tumor growth, it is much more likely that reduction in CI and CII activity induced by respective shRNA is at the bases of the observed phenomenon. This brings consistency to the reported results, as these are in fact two independent shRNAs directed at different components of the electron transport chain. Furthermore, to perform the in vivo experiments again with an independent set of shRNA would require at least 5 months, including all preparatory work, renewal of mouse work permits and the extended 100 days observation period in mice (cf. Figure 3E). For these reasons, we asked the editors to consider exempting this point from the revision process.In support of our reasoning re the point pertaining to the use of several different shRNAs, we discussed this point with the Editor of eLife and obtained the response as shown below, supporting our explanation above.‘Thanks for your recent query that relates to point 1 in the reviewers' comments. I've shared your comments with the editors and they have the following comments:The key experiment will be the one using the mitochondrially-targeted fluorescent protein to better substantiate the claim about horizontal transfer. It would be helpful if they referred to this exchange in their rebuttal letter, so that I remember that we decided to go forward without the additional shRNAs in the in vivo experiment.As the editors point out, please refer to the above exchange so the editors remember what they decided to go with.’We agree with the reviewers that Figure 3B requires statistical evaluation, and we performed it. This is now included in the revised version of the manuscript.2)While in general we agree with reviewer’s concern in the matter of die leakage, we find it unlikely that this is an issue in our co-cultures of ρ0 cells with MitoDeepRed-labelled MSCs prepared from C57BLmice. The reason is that we do not see any mitochondria staining of parental cells co-cultured with MitoDeepRed-labelled MSCs, whereas if die leakage occurred from MCSs, the parental cell mitochondria would be stained as well, all the more so that these cells have higher mitochondrial membrane potential compared to ρ0 cells and would accumulate the die more readily. Notwithstanding this reasoning, we performed an additional experiment to unequivocally document intercellular transfer of whole mitochondria in MCSs co-cultures using nuclear-encoded mitochondria-targeted fluorescent protein as suggested by the reviewer. We used transgenic C57BL/6N mice with red fluorescent mitochondria in somatic cells, from which we isolated MSCs and co-cultured them with ρ0 cells, whose nuclei were labelled with blue fluorescent protein (BFP) and plasma membrane with green fluorescence protein (GFP). Images in Appendix 1—figure 3C of the revised version of the manuscript document that mitochondria labelled with DsRed protein moved from MSCs to B16ρ0 cells. This confirms results in Figure 4A, strongly supporting the case for mitochondrial transfer. We added a few sentences concerning this result in the Results section and also added legend to the new Appendix 1—figure 3C in the revised version of the manuscript.3)We agree with the reviewers that this is a very intriguing point. In fact, we have started a separate project that will answer the very question why transfer of mitochondria from MSCs occursinto B16ρ0 cells but not into their normal counterparts. The group of our collaborator and co-author of this manuscript Prof. Agrawal published a paper recently showing that mitochondria move from MSCs to rotenone-stressed lung alveolar epithelial cells (Ahmad et al. Miro1 regulates intercellular mitochondrial transport & enhances mesenchymal stem cell rescue efficacy. EMBO J 33, 994-1010). We have now carried out similar experiments with MSCs isolated from C57BL mice and with parental B16 cells stressed with rotenone. As seen from Author response image 1, there was over 3-fold increase in movement of mitochondria from MSCs into rotenone-treated B16 cells compared to their control counterparts, recapitulating our observation with B16ρ0 cells. We do not include these results in the revised version of the manuscript, since they are a part of another project (as eluded to above), in which we study the reasons for selective movement of mitochondria to cells lacking mtDNA or whose mtDNA is compromised in some way. The fact that we do see movement of mitochondria into B16 cells with normal mtDNA that were stressed with rotenone indicates that cells with compromised mitochondrial function (rotenone targets mitochondrial complex I) will import mitochondria in order to correct the situation, such as recover their respiratory capacity as we show in our manuscript. The nature of the signal that directs mitochondrial transfer to mitochondria-compromised cell is a matter of intense research in our laboratory.
Author response image 1.
CFSE labeled B16 cells were co-cultured with mitoDR labeled MSC for 24 h.
In identical experiments the B16 cells were pretreated with rotenone to induce mitochondrial dysfunction. Double positive cells were counted by FACS and also visualized on microscopy. Rotenone pre-treatment of B16 led to greater mitochondrial transfer and increase in double positive cells from about 2% to 7%. The geometric mean intensity of double positive cells also in-creased suggesting greater transfer.
DOI:
http://dx.doi.org/10.7554/eLife.22187.010
CFSE labeled B16 cells were co-cultured with mitoDR labeled MSC for 24 h.
In identical experiments the B16 cells were pretreated with rotenone to induce mitochondrial dysfunction. Double positive cells were counted by FACS and also visualized on microscopy. Rotenone pre-treatment of B16 led to greater mitochondrial transfer and increase in double positive cells from about 2% to 7%. The geometric mean intensity of double positive cells also in-creased suggesting greater transfer.DOI:
http://dx.doi.org/10.7554/eLife.22187.0104)In agreement with the request by the reviewers, we have now added the z-stack images for Figure 4A in the revised version of the manuscript as Appendix 1—figure 3B. As requested, we also included individual colour channels in the middle image of Figure 4A as Appendix 1—figure 3A in the revised version of the manuscript. Additionally, we have added more explanation about the quantification of the results in Figure 4A as requested by the reviewers.5)We basically agree with the reviewers. Before answering this point, it may be good to recapitulate the experiment we performed in Figure 4B, where we document the presence of dsRed-positive mitochondria donated by the stroma cells of the C57BL/6N mouse in the cytoplasm of the grafted, nuclear BFP-expressing B16ρ0 cells. The experiment itself is quite complicated. First, one needs to take into consideration that mitochondria move across over a relatively long period of time. We now have data from a different cell line from another project documenting that mitochondria start to move from the mouse stromal cells to grafted ρ0 cells within 5 days (will be published elsewhere). Also, using single cells real-time PCR, we observe continuous movement of mitochondria between stromal cells and grafted ρ0 cells for some 20 days following grafting of ρ0 cells, until all cells in the small tumour that starts to grow contain mitochondria with DNA. These new, unpublished data are from experiments with 4T1ρ0 cells, where the principle of mitochondrial transfer is similar to that of mitochondrial transfer to B16ρ0 cells. An important aspect of the experiment shown in Figure 4B stems from the fact that the MitoDsRed protein is coded for in the nucleus of the host (stromal, presumably mesenchymal stem) cells. Once the mitochondrion moves across to the grafted B16ρ0 cell, the MitoDsRed protein will ‘fade’, since it is not replenished – the recipient ρ0 cell does not code for this transgene. This in itself is a good evidence of selective mitochondria transfer as opposed to other possible mechanisms such as cell fusion. Therefore, at any point in time, we can visualise only a small percentage of mitochondria that would have moved across and would not have yet lost the red fluorescence emitted by the MitoDsRed protein.We have performed the experiment in which we grafted B16ρ0 cells with BFL nuclei into C57BL/6N mice 4 times. In each experiment, we subjected the cells recovered from the animal after being sacrificed to fractionation by cell sorting 4, 7, 9, 11 or 12 days post-grafting. Prompted by the reviewer, we analysed data from available sorts and the average percentage of double-positive (DP) cells in the BFP-positive population was 0.23 ± 0.18, demonstrating that mitochondrial transfer is a reproducible phenomenon occurring in vivo at a relatively low, but stable frequency for an extended period of time. This frequency has now been included in the revised version of the manuscript.We performed sorting of DP cells with very conservative settings, so that we were sure that we only recover DP cells without any contamination by single-positive cells or cell doublets. This stringency would cause exclusion of, for example, B16ρ0 cells with only a few red mitochondria and B16ρ0 cells were mitochondrial DsRed is already fading. Hence, the presented data give most likely some underestimation of the true in vivo mitochondrial transfer frequency.Another, separate and more technical issue, is imaging of the double-positive cells that are recovered and sorted following subcutaneous grafting of B16ρ0nuBFP cells into C57BL/6N mice. As discussed above, we have to take into consideration the fact that, following transfer from stromal cells of the host into the grafted ρ0 cells, the MitoDsRed protein will fade rather fast, within about 20-24 h. Therefore, we only have a small window of opportunity to get an image of cells still expressing the mitochondrial red fluorescent protein. This involves first dissection of the tissue comprising the grafted cells, preparation of single cell suspension and sorting of DP cells with red and blue fluorescence. It takes up to 12 hours from sacrificing the animal to having cells sorted for further experimentation. For confocal microscopy, we need to seed the cells in special dishes and allow them to attach, at least to some extent, so that we can take reasonably clear images. We cannot allow the cells to be in the incubator for more than some 6-8 hours before imaging is performed, otherwise the red fluorescence will fade. Therefore, the images that we take in this way are not perfect, although they still clearly document red fluorescent mitochondria in cells with BFP nuclei. Later on, when we use these cells that are established as a subline, imaging is good but the cells do not comprise the MitoDsRed protein anymore. Therefore, we chose the best image we obtained. Additional images of B16ρ0DP cells recovered on different days following the engraftment of B16ρ0 nBFP cells into C57BL/6N mice are presented in the attachment to this document, demonstrating that the images shown do not represent a one-off scenario. Given the technical difficulties of confocal imaging in this setup, the sorting data discussed above present a much more reliable evidence for the reproducibility of the mitochondria-transfer process in vivo.The issue of potential fusion of original ρ0 mitochondria in B16ρ0 cells and mitochondria with mtDNA moving into these grafted cells form the host cells is of great interest. We do not know much about this process at this moment. In fact, we are researching this issue at the moment using the 4T1 cellular system and Balb-c mice in a separate project. We know that cells that contain both ρ0 mitochondria and mitochondria with mtDNA will not change their ratio much over longer periods in culture, which more-or-less excludes fusion of mtDNA-positive and mtDNA-negative mitochondria, which need to undergo fission in the course of cell division, at which stage they need to be shared relatively similarly between the daughter cells. A rather different issue is to resolve what happens under in vivo conditions, i.e. after cells with ρ0 mitochondria are grafted in mice and after they import mitochondria with mtDNA from the stroma. The original ρ0 mitochondria may fuse with the incoming mitochondria with mtDNA or ρ0 mitochondria may be removed by mitophagy, or both processes may occur in parallel. We know that at certain stage (about 20-25 days post grafting of 4T1ρ0 cells; unpublished data), the ρ0 mitochondria ‘disappear’ and the original ρ0 cells now contain virtually only mitochondria with mtDNA.While we do not study in vivo fusion or fission of mitochondria in this manuscript (it is a separate and rather complex project), we subjected the B16 parental, B16ρ0 and B16ρ0DP cells to transmission electron microscopy. As seen in new Figure 4C in the revised version of the manuscript, B16 and B16ρ0DP cells comprise mitochondria with cristae, while B16ρ0 cells contain mitochondria with two concentric membranes with no cristae or with very low number of cristae. This suggests that defective mitochondria have been either cleared or reconstituted with mtDNA in vivo. Due to the new panel B in Figure 4, panels C, D, E and F of the original Figure 4 are panels D, E, F and G, respectively, in the revised version of the manuscript. We accordingly changed the Results section and legends to the figures. Also, we added a short chapter on TEM in the Supplementary Methods.6)We apologise to the reviewer for omitting this in the original version. We now include in Figure 4C (and also in Figure 1B) confocal images of whole cells with indicated region of interest (ROI) examined by STED microscopy. The higher magnification of STED unequivocally shows the presence of mitochondrial nucleoids within the examined ROIs in B16 and B16ρ0DP cells (and in B16ρ0SC, B16ρ0CTC and B16ρ0SCL cells), and their absence in B16ρ0 cells.
Appendix 1—table 1.
Primer and probe sequences used in sc/ddPCR. *Capital letters indicate LNA bases; polymorphism is shown in gray.
DOI:
http://dx.doi.org/10.7554/eLife.22187.006
m_tRNA_Fw
gtcacaattctatctctagg
m_tRNA_Rv
ggttgaagaaggtagatg
m_tRNA_8A_FAM (host mouse)
taattagtTtAaAaAaAaTtAaTgattt
m_tRNA_9A_HEX (parental B16)
taattagtTtAaAaAaAaAtTaAtgattt
*Polymorphism of the mtDNA tRNA locus of C57 mice and B16 cells has been published (Bayona-Bafaluy et al., 2003; Tan et al., 2015).
Authors: Lan-Feng Dong; Victoria J A Jameson; David Tilly; Jiri Cerny; Elahe Mahdavian; Alvaro Marín-Hernández; Luz Hernández-Esquivel; Sara Rodríguez-Enríquez; Jan Stursa; Paul K Witting; Bela Stantic; Jakub Rohlena; Jaroslav Truksa; Katarina Kluckova; Jeffrey C Dyason; Miroslav Ledvina; Brian A Salvatore; Rafael Moreno-Sánchez; Mark J Coster; Stephen J Ralph; Robin A J Smith; Jiri Neuzil Journal: J Biol Chem Date: 2010-11-08 Impact factor: 5.157
Authors: Frank Weinberg; Robert Hamanaka; William W Wheaton; Samuel Weinberg; Joy Joseph; Marcos Lopez; Balaraman Kalyanaraman; Gökhan M Mutlu; G R Scott Budinger; Navdeep S Chandel Journal: Proc Natl Acad Sci U S A Date: 2010-04-26 Impact factor: 11.205
Authors: Matthias Osswald; Erik Jung; Felix Sahm; Gergely Solecki; Varun Venkataramani; Jonas Blaes; Sophie Weil; Heinz Horstmann; Benedikt Wiestler; Mustafa Syed; Lulu Huang; Miriam Ratliff; Kianush Karimian Jazi; Felix T Kurz; Torsten Schmenger; Dieter Lemke; Miriam Gömmel; Martin Pauli; Yunxiang Liao; Peter Häring; Stefan Pusch; Verena Herl; Christian Steinhäuser; Damir Krunic; Mostafa Jarahian; Hrvoje Miletic; Anna S Berghoff; Oliver Griesbeck; Georgios Kalamakis; Olga Garaschuk; Matthias Preusser; Samuel Weiss; Haikun Liu; Sabine Heiland; Michael Platten; Peter E Huber; Thomas Kuner; Andreas von Deimling; Wolfgang Wick; Frank Winkler Journal: Nature Date: 2015-11-04 Impact factor: 49.962
Authors: Elizabeth P Murchison; David C Wedge; Ludmil B Alexandrov; Beiyuan Fu; Inigo Martincorena; Zemin Ning; Jose M C Tubio; Emma I Werner; Jan Allen; Andrigo Barboza De Nardi; Edward M Donelan; Gabriele Marino; Ariberto Fassati; Peter J Campbell; Fengtang Yang; Austin Burt; Robin A Weiss; Michael R Stratton Journal: Science Date: 2014-01-24 Impact factor: 47.728
Authors: Martina Bajzikova; Jaromira Kovarova; Ana R Coelho; Stepana Boukalova; Sehyun Oh; Katerina Rohlenova; David Svec; Sona Hubackova; Berwini Endaya; Kristyna Judasova; Ayenachew Bezawork-Geleta; Katarina Kluckova; Laurent Chatre; Renata Zobalova; Anna Novakova; Katerina Vanova; Zuzana Ezrova; Ghassan J Maghzal; Silvia Magalhaes Novais; Marie Olsinova; Linda Krobova; Yong Jin An; Eliska Davidova; Zuzana Nahacka; Margarita Sobol; Teresa Cunha-Oliveira; Cristian Sandoval-Acuña; Hynek Strnad; Tongchuan Zhang; Thanh Huynh; Teresa L Serafim; Pavel Hozak; Vilma A Sardao; Werner J H Koopman; Miria Ricchetti; Paulo J Oliveira; Frantisek Kolar; Mikael Kubista; Jaroslav Truksa; Katerina Dvorakova-Hortova; Karel Pacak; Robert Gurlich; Roland Stocker; Yaoqi Zhou; Michael V Berridge; Sunghyouk Park; Lanfeng Dong; Jakub Rohlena; Jiri Neuzil Journal: Cell Metab Date: 2018-11-15 Impact factor: 27.287
Authors: Kathryn T Baker; Daniela Nachmanson; Shilpa Kumar; Mary J Emond; Cigdem Ussakli; Teresa A Brentnall; Scott R Kennedy; Rosa Ana Risques Journal: Mol Cancer Res Date: 2018-11-16 Impact factor: 5.852