Literature DB >> 28151959

Continuous treatment with FTS confers resistance to apoptosis and affects autophagy.

Eran Schmukler1, Eya Wolfson1, Zvulun Elazar2, Yoel Kloog1, Ronit Pinkas-Kramarski1.   

Abstract

High percentage of human cancers involves alteration or mutation in Ras proteins, including the most aggressive malignancies, such as lung, colon and pancreatic cancers. FTS (Salirasib) is a farnesylcysteine mimetic, which acts as a functional Ras inhibitor, and was shown to exert anti-tumorigenic effects in vitro and in vivo. Previously, we have demonstrated that short-term treatment with FTS also induces protective autophagy in several cancer cell lines. Drug resistance is frequently observed in cancer cells exposed to prolonged treatment, and is considered a major cause for therapy inefficiency. Therefore, in the present study, we examined the effect of a prolonged treatment with FTS on drug resistance of HCT-116 human colon cancer cells, and the involvement of autophagy in this process. We found that cells grown in the presence of FTS for 6 months have become resistant to FTS-induced cell growth inhibition and cell death. Furthermore, we discovered that the resistant cells exhibit altered autophagy, reduced apoptosis and changes in Ras-related signaling pathways following treatment with FTS. Moreover we found that while FTS induces an apoptosis-related cleavage of p62, the FTS-resistant cells were more resistant to apoptosis and p62 cleavage.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28151959      PMCID: PMC5289601          DOI: 10.1371/journal.pone.0171351

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The Ras family of small GTPases consists of 4 highly related members: K-Ras (4A and 4B), H-Ras and N-Ras [1]. Ras proteins are typically found in the inner leaflet of the plasma membrane, where their activation leads to signal transduction through interaction with multiple effector proteins. Activation of Ras guanine nucleotide exchange factors (RasGEFs) results in the exchange of the Ras bound GDP into GTP. Following activation, Ras stimulates diverse downstream effectors, which lead to the activation of an array of cellular signaling pathways. Activating mutations in Ras are found in 33% of human cancers, with mutations in K-Ras being the most prevalent (21.6% of human cancers) [2]. K-Ras mutations are associated mainly with the most lethal malignancies, such as lung, colon and pancreatic cancers [3]. While the wild-type (wt) Ras cycles between its active and inactive states, and is regulated by RasGEFs and RasGAP (GTPase), the oncogenic mutant Ras, which bears a single mutation at residues 12, 13 or 61, binds to GTP constitutively [1]. Activation of Ras requires its association with the cell membrane. This characteristic of Ras is used to design anti-Ras drugs that inhibit its association with the plasma membrane [4]. Several such agents, which have the potential of inhibiting Ras by mimicking its farnesyl group, were developed. One of these agents, FTS (farnesylthiosalicylic acid, also known as Salirasib), acts as a functional Ras antagonist, and was shown to exert anti-tumorigenic effects in vitro and in vivo [5-8]. FTS affects Ras-membrane interactions by dislodging Ras from the membrane anchoring domains, thus facilitating its degradation [9]. FTS treatment was shown to induce autophagy in naïve mouse embryonic fibroblasts (MEF) and in human cancer cell lines, which harbor a K-Ras mutation (HCT-116, DLD-1 and Panc-1) [10,11]. Autophagy is a regulated process, by which proteins and organelles are recognized and delivered to the lysosome for degradation [12]. FTS-induced autophagy acts as a defense mechanism against FTS-induced cell death [10,11]. In addition, FTS enhances the synthesis of p62, which is essential for cargo selection during autophagy [11]. In the present study, we examined the effect of prolonged FTS treatment on cancer cells resistance to FTS-induced growth inhibition, cell death and autophagy. We found that HCT-116 human colon cancer cells treated with FTS for 6 months have become resistant to FTS treatment. Further characterization of these cells revealed changes in autophagy, p62 levels and cleavage, response to other anti-cancer treatments and activation of signaling pathways.

Materials and Methods

Antibodies and reagents

Antibodies are as follows: monoclonal mouse anti-actin (MP Biomedicals; Santa Ana, CA; 691001), polyclonal rabbit anti-caspase 3 (Santa Cruz Biotechnology; Dallas, TX; sc-7148 and Cell Signaling Technology; 9662), polyclonal rabbit anti-AKT (Santa Cruz Biotechnology; sc-8312), polyclonal rabbit anti-p21 (Santa Cruz Biotechnology; sc-756), polyclonal rabbit anti-p62 (MBL International; Woburn, MA; PM045), monoclonal rabbit anti-aurora kinase A (AURKA; Cell Signaling Technology; Denver, MA; 4718), polyclonal rabbit anti-ERK1/2 (Cell Signaling Technology; 4695), polyclonal rabbit anti-phospho-Ser473 AKT (Cell Signaling Technology; 4058), polyclonal rabbit anti-phospho-Thr389-S6 kinase (p-S6K; Sigma-Aldrich; St. Louis, MO; S6311), polyclonal rabbit anti-S6 kinase (S6K; Sigma-Aldrich; S4047), monoclonal mouse anti-phospho-Thr183 and Tyr185 ERK1/2 (Sigma-Aldrich; M8159) polyclonal rabbit anti-LC3B (Immunoblots; Sigma-Aldrich; L7543) and monoclonal rabbit anti-LC3A/B (Immunostaining; Cell Signaling Technology; 12741). FTS (SaliRasib, S-trans, trans-farnesylthiosalicylic acid) was provided by Concordia Pharmaceuticals (Fort Lauderdale, FL); chloroquine (CQ; C6628) and 5-fluorouracil (5-FU; F6627) were from Sigma-Aldrich; QVD-OPH was from R&D systems (Minneapolis, MN; OPH-001); calpeptin was from EMD Millipore (Darmstadt, Germany; 03-34-0051); and rapamycin was from Cayman Chemical (Ann Arbor, MI; 13346).

Cell culture and generation of FTS-resistant sublines

To generate FTS-resistant HCT-116 sublines, naïve human colon cancer HCT-116 cells were grown in RPMI-1640 medium (Sigma-Aldrich) supplemented with 5% heat-inactivated fetal bovine serum (FBS; Hyclone, Thermo Scientific, Waltham, MA), containing FTS at a sub-IC50 concentration of 40 μM (prepared from a 75 mM in DMSO stock). FTS concentration was gradually increased during a period of 6 months up to a final concentration of 60 μM, and the cells were routinely passaged when confluence was achieved. Two sublines were simultaneously generated and designated FR1 (FTS-resistant1) and FR2 HCT-116. These sublines were continuously cultured in RPMI-1640 medium supplemented with 5% FBS, containing 60 μM FTS. Three days before each experiment, FTS was removed from the culture medium. The concentrations and the duration of FTS treatments (and the corresponding 0.1% DMSO control) are indicated for each experiment. An additional subline was generated from FR2 cells, which were further grown at increasing FTS concentrations. This subline was termed FR3, and was cultured at a final concentration of 72.5 μM FTS. A control HCT-116 subline was also generated by culturing naïve HCT-116 cells in RPMI-1640 medium supplemented with 5% FBS, containing 0.1% DMSO. The human pancreatic cancer cell line, Panc-1, was grown in DMEM (Gibco, Carlsbad, CA), supplemented with 10% heat-inactivated fetal bovine serum (or 5% for FTS treatments).

Assessment of cell viability and cell death

Cells were plated in medium supplemented with 5% FBS, and treated as indicated. Cell viability was determined by the methylene blue assay. The cells were fixed with 4% formaldehyde for 2 hours, then washed once with 0.1 M boric acid (pH 8.5) and incubated with the DNA-binding dye methylene blue (1% in boric acid) for 20 minutes at room temperature. The cells were then washed three times with distilled water and lysed with 0.1 M HCl. Absorbance was measured with a Tecan Spectrafluor Plus spectrophotometer (Mannedorf, Switzerland) at 595 nm. Cell viability is presented relative to untreated cultures. IC50 values were calculated using a non-linear regression model (logarithmic inhibitor vs. normalized response-variable slope) with the GraphPad Prism 6 software. To estimate the number of dead cells, live cultures were incubated for 10 minutes with 1 μg/ml of the fluorescent, membrane impermeable, DNA dye bisbenzimide (Hoechst 33258; Sigma). After staining, the cells were photographed with an Olympus motorized inverted microscope Model IX81 (×20 magnification). The percentage of dead cells was estimated by calculating the number of Hoechst-stained nuclei relative to the total cell number in each field.

Lysate preparation and immunoblot analysis

Cells were exposed to the indicated stimuli. After treatment, cells were lysed in solubilization buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1 mM EDTA pH 8, 1 mM EGTA pH 8, 1.5 mM MgCl2, 200 μM Na3VO4, 150 nM aprotinin, 1 μM leupeptin and 500 μM 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride). Lysates were cleared by centrifugation, a sample buffer was added and the lysates were boiled. Lysates were resolved by SDS-polyacrylamide gel electrophoresis (PAGE) through 10%-12.5% polyacrylamide gels, and were electrophoretically transferred to nitrocellulose membranes. Membranes were blocked for 1 hour in TBST buffer (0.05 M Tris-HCl pH 7.5, 0.15 M NaCl, and 0.1% Tween 20) containing 6% milk, and then blotted with primary antibodies for 2 hours. Secondary antibody, linked to horseradish peroxidase, was then added for 1 hour. Immunoreactive bands were detected with the enhanced chemiluminescence reagent. Densitometric analysis of the results was performed using the ImageJ program.

Immunostaining

For immunostaining of endogenous LC3, cells were plated on sterile coverslip (18 mm diameter) coated with poly-l lysine. After treatment, cells were fixed with cold methanol for 15 min and permeabilized/blocked with 2% normal goat serum in 0.3% Triton X-100 for 60 min. Cells were incubated with primary antibodies overnight at 4°C followed by staining with secondary antibodies and 2 μg/ml Hoecsht 33258 for 1 h at RT. Cells were analyzed by Leica TCS SP8 confocal microscope (×63 magnification). For the quantification of LC3 puncta, we used the ImageJ software to measure the total area of LC3 dots per cell.

RNA extraction and qRT-PCR analysis

Total RNA was extracted from the cells using TRIzol reagent (Ambion Life Technologies, Grand Island, NY, USA) and the RNA concentration in each sample was determined by a spectrophotometer. Purified RNA was reverse-transcribed using the High Capacity cDNA Revese Transcription kit (Applied Biosystemns, Foster City, CA, USA) according to the manufacturer’s instructions. cDNA samples (50 ng) were used for quantitative RT–PCR using the FastStart Universal SYBR Green Master kit (Roche, Basel, Switzerland). Fluorescence was measured and the data were analyzed using the 7300 Real Time PCR system (Applied Biosystems). The primers used were human Aurora kinase A (AURKA) forward, TTCAGGACCTGTTAAGGCTACA and reverse, ATTTGAAGGACACAAGACCCG; human p62 forward, CAGAGAAGCCCATGGACAG and reverse, AGCTGCCTTGTACCCACATC; human GUSB forward, CTCATTTGGAATTTTGCCGATT and reverse, CCGAGTGAAGATCCCCTTTTTA. GUSB was used as a reference gene for normalization of relative mRNA expression.

Transient transfections

Cells were transfected with 3 μg of either GFP-expressing or GFP-DN-Ras (17N) expressing vectors using the jetPEI reagent (Polyplus transfection, 101–10), according to the manufacturer's instructions.

Statistical analysis

All experiments were performed at least three times. Results are presented as means ± SE. Differences between means were assessed by the 1-tailed Student’s t-test. Significance was assigned at p < 0.05.

Results

Generation of FTS-resistant HCT-116 sublines

To determine whether continuous treatment with FTS induces drug resistance in human HCT-116 colon cancer cells (expressing endogenous mutant K-Ras), the cells were grown in the presence of increasing FTS concentrations for 6 months, up to a final concentration of 60 μM. Two sublines were generated and designated FR1 (FTS-resistant1) and FR2 HCT-116. As shown in Fig 1A, FR1 and FR2 HCT-116 cells have gained partial resistance to FTS treatment compared to control HCT-116 cells. Accordingly, the IC50 of FR1 and FR2 HCT-116 cells were similar (57 ± 0.5) and significantly higher than the IC50 of the control HCT-116 cells (48 ± 0.55; Fig 1B). Moreover, FR1 and FR2 HCT-116 cells were more resistant to FTS-induced cell death, as demonstrated in Fig 1C and 1D.
Fig 1

Continuous treatment with FTS induces resistance.

CTRL, FR1 and FR2 HCT-116 cells were treated with increasing concentrations of FTS for 5 days. (A) cell viability was assessed using the methylene blue staining assay and (B) IC50 values were calculated as described in Materials and methods (mean ± SE; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells). (C-D) CTRL, FR1 and FR2 HCT-116 cells treated with FTS at concentrations of 60 and 70 μM for 5 days were stained with the fluorescent DNA dye bisbenzimide (Hoechst 33258, 1 μg/ml) to assess the number of dying cells. Following staining, the cells were photographed (×20 magnification; scale bars, 20 micrometer). The percentage of dying cells was estimated by counting the number of Hoechst-positive cells compared to the number of total cells in each field (7–10 fields for each treatment, 100–200 cells per field). Results are the mean ± S.E (*, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^^, p < 0.01, FTS treated compared to untreated cells).

Continuous treatment with FTS induces resistance.

CTRL, FR1 and FR2 HCT-116 cells were treated with increasing concentrations of FTS for 5 days. (A) cell viability was assessed using the methylene blue staining assay and (B) IC50 values were calculated as described in Materials and methods (mean ± SE; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells). (C-D) CTRL, FR1 and FR2 HCT-116 cells treated with FTS at concentrations of 60 and 70 μM for 5 days were stained with the fluorescent DNA dye bisbenzimide (Hoechst 33258, 1 μg/ml) to assess the number of dying cells. Following staining, the cells were photographed (×20 magnification; scale bars, 20 micrometer). The percentage of dying cells was estimated by counting the number of Hoechst-positive cells compared to the number of total cells in each field (7–10 fields for each treatment, 100–200 cells per field). Results are the mean ± S.E (*, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^^, p < 0.01, FTS treated compared to untreated cells). An additional FTS-resistant subline was generated by culturing FR2 HCT-116 cells at further increasing concentrations of FTS for another 6 months (up to a concentration of 72.5 μM). This subline, termed FR3, exhibited an even greater IC50 (64 ± 0.71; S1 Fig).

FTS-induced autophagy is altered in FTS-resistant cells

Previously, we have shown that FTS induces autophagy in several cancer cell lines, including HCT-116 [10,11]. FTS-induced autophagy serves as a resistance mechanism, promoting cell survival after FTS treatment [10,11]. Therefore, we next examined autophagy in the FTS resistant sublines, using LC3 protein as a marker. During autophagy, LC3-I is lipidated to form LC3-II, which binds to the autophagsomal membrane and promotes autophagy [13]. Previously, we have used the concentration range of 60–75 μM FTS in HCT-116 cells, in order to examine the effect of the treatment on cell growth, cell death and autophagy. Since the concentration of 75 μM has proven to be the most efficient in terms of autophagy induction, we decided to use it as a standard working dose in this study for the majority of the experiments. As shown in Fig 2A, FTS induced an increase in the levels of LC3-II in the control, as well as in the FR HCT-116 sublines, indicating that the treatment activates autophagy. However, in the resistant sublines, FTS also induced a reduction in LC3-I levels. These results may indicate that FTS induces a more efficient LC3-I lipidation in the FR HCT-116 cells compared to the control cells. In fact, in the presence of FTS, the LC3-II/LC3-I ratio was significantly greater in the resistant cells compared to the control cells (Fig 2B).
Fig 2

FTS resistant cells exhibit altered LC3-II/LC3-I ratio and LC3-II consumption after FTS treatment.

(A) CTRL, FR1 and FR2 HCT-116 cells were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) for 48 h. The cells were then subjected to immunoblot analysis using anti-LC3 antibodies. (B) Densitometric analysis of LC3-II/LC3-I ratio is presented as fold induction over the untreated cells (left graph) and as the difference between measured values of LC3II/actin levels with or without chloroquine (right graph, Δ±CQ) (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells).

FTS resistant cells exhibit altered LC3-II/LC3-I ratio and LC3-II consumption after FTS treatment.

(A) CTRL, FR1 and FR2 HCT-116 cells were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) for 48 h. The cells were then subjected to immunoblot analysis using anti-LC3 antibodies. (B) Densitometric analysis of LC3-II/LC3-I ratio is presented as fold induction over the untreated cells (left graph) and as the difference between measured values of LC3II/actin levels with or without chloroquine (right graph, Δ±CQ) (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells). It should be noted that autophagy is a dynamic process, in which LC3-II formation is followed by its degradation in the lysosome. For this reason, we measured the autophagic flux using an autophagosome-lysosome fusion inhibitor, chloroquine [13]. Hence, we examined the effect of FTS and chloroquine co-treatment on LC3 levels. As shown in Fig 2A, following the combined treatment, there was no difference in the levels of LC3-II in the FR HCT-116 cells compared to the control cells; however, LC3-I levels were still lower in the FR HCT-116 cells compared to the control cells. Likewise, LC3-II/LC3-I ratio was significantly higher in the FR HCT-116 cells (Fig 2B), indicating that the lipidation step remained more efficient also in the presence of chloroquine. Next, the differences between LC3-II levels following FTS treatment alone and those following combined treatment with chloroquine were measured (Δ±CQ). Since chloroquine blocks lysosomal degradation, these differences reflect the amount of LC3-II consumed during autophagy. As demonstrated in Fig 2A and 2B, the differences were significantly greater in the FR HCT-116 cells compared to the control cells, suggesting that the process of cargo degradation had become more effective. To confirm the results obtained by immunoblotting, we have also used immunostaining with anti-LC3 antibodies to examine the autophagosomes content, following treatment with FTS, chloroquine or both. As shown in Fig 3A, FTS induced an increase in the total area of autophagosomes (LC3 puncta) per cell after 48 h treatment; however, this increase was greater in the control compared to the FR HCT-116 cells. The addition of chloroquine led to a further increase in the autophagosomes area, probably as a result of late-stage autophagy blockage. Under these conditions, however, the total area of autophagosomes per cell in the control HCT-116 cells was slightly lower compared to that of the FR HCT-16 cells. Accordingly, the difference between autophagosome area after FTS treatment alone and that following combined treatment with chloroquine (Δ±CQ), was significantly higher in the FR HCT-116 cell compared to the control cells (Fig 3A). Since these differences reflect autophagosome consumption following FTS treatment, the results obtained using immunostaining are in accordance with the immunoblot profile.
Fig 3

FTS resistant cells exhibit altered autophagosome consumption and increased viability following FTS and chloroquine co-treatment.

(A) CTRL and FR1 HCT-116 cells were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) for 48 h. The cells were then fixed and stained with anti-LC3 antibodies and Hoechst 33258. Cells were microscopically analyzed. Upper panels, representative results are shown (×63 magnification; scale bars, 10 micrometer). Lower panels, the total area of LC3 puncta (LC3 dots) per cell was calculated using ImageJ, and is presented as fold induction over the untreated cells (left graph) or as the difference between measured values with or without chloroquine (right graph, Δ±CQ) (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 HCT-116 cells; ^, 0.05 < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells). (B) CTRL, FR1 and FR2 HCT-116 cells were treated with 55 μM FTS with or without 6 μM chloroquine for 4 days. Cell viability was then assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ##, p < 0.01, FTS combined with chloroquine compared to each treatment alone).

FTS resistant cells exhibit altered autophagosome consumption and increased viability following FTS and chloroquine co-treatment.

(A) CTRL and FR1 HCT-116 cells were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) for 48 h. The cells were then fixed and stained with anti-LC3 antibodies and Hoechst 33258. Cells were microscopically analyzed. Upper panels, representative results are shown (×63 magnification; scale bars, 10 micrometer). Lower panels, the total area of LC3 puncta (LC3 dots) per cell was calculated using ImageJ, and is presented as fold induction over the untreated cells (left graph) or as the difference between measured values with or without chloroquine (right graph, Δ±CQ) (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 HCT-116 cells; ^, 0.05 < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells). (B) CTRL, FR1 and FR2 HCT-116 cells were treated with 55 μM FTS with or without 6 μM chloroquine for 4 days. Cell viability was then assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ##, p < 0.01, FTS combined with chloroquine compared to each treatment alone). Chloroquine was shown to enhance the effect of FTS on cancer cell growth inhibition, death and tumorigenicity [11]. This combined effect of FTS and chloroquine on cell viability was also evident in the FR HCT-116 sublines (Fig 3B); however, the FR HCT-116 cells exhibited a partial resistance to the co-treatment compared to the control HCT-116 cells. Surprisingly, the FR HCT-116 sublines were also resistant to chloroquine treatment alone. These findings could be explained by the increased LC3-II/LC3-I ratio in the FR compared to control HCT-116 cells, observed following chloroquine, FTS or both treatments (Fig 2A and 2B). Taken together, the results imply that FTS-induced autophagy has become more efficient in the FR HCT-116 sublines, which may affect their resistance to FTS treatment.

FTS-induced cleavage of p62 is reduced in FTS-resistant cells

The ubiquitin-binding protein, p62 (also known as SQSTM1), mediates the degradation of ubiquitinated proteins and mitochondria through autophagy [14,15], by binding LC3, and recruiting the cargo to the autophagosome. This process is followed by p62 degradation in the lysosome, leading to decreased p62 levels following autophagy induction. On the other hand, persistent pro-autophagic stimuli can induce transcription-dependent synthesis of p62, resulting in elevated levels of the protein [16]. Previously, we have found that 48–72 h FTS treatment triggers de novo synthesis of p62 [11]. Accordingly, here we found that FTS increased the levels of p62 mRNA, and that this increase was significantly higher in the control HCT-116 cells compared to the FR cells (Fig 4A). At the protein level, FTS also induced synthesis of p62; however, there was no significant difference between the FR and the control HCT-116 cells (Fig 4B). These differences between the mRNA and the protein level can be explained by a possible cleavage of p62, which is greater in the control HCT-116 cells. Indeed, cells treated with FTS expressed a 46 kDa band, which might represent a cleavage product of p62 (Fig 4B). The alleged cleavage product appeared after a 24 h treatment with FTS, and became more prominent as the treatment continued. In addition, the levels of this 46 kDa product were significantly higher in the control HCT-116 cells compared to the FR cells, which led us to suspect that it is related to cell death. In accordance with this possibility, it was reported that p62 is cleaved by the pro-apoptotic proteins caspase 6, caspase 8 and calpain, to yield a 46 kDa product [17]. Furthermore, another apoptosis-related p62 cleavage product of 30 kDa was reported. This smaller product was detected only following co-treatment with FTS and chloroquine, but not after treatment with FTS alone (Fig 4C, long exposure), which might indicate an enhancement of apoptosis under these conditions. Consistent with that assumption, we have previously demonstrated that chloroquine enhances FTS-induced apoptosis [11]. Accordingly, the levels of the 30 kDa cleavage product were significantly higher in the control HCT-116 cells compared to those in the FR cells. Further experiments should be performed in order to verify the involvement of caspase 6 and caspase 8.
Fig 4

FTS-induced p62 cleavage is reduced in FTS-resistant cells.

(A) CTRL, FR1 and FR2 HCT-116 sublines were treated with 75 μM FTS for 48 h and then subjected to qRT-PCR analysis of p62 transcript expression. Results are presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05, FTS treated compared to untreated cells). (B) CTRL, FR1 and FR2 HCT-116 sublines were treated with 75 μM FTS for the indicated time, or (C) 75 μM FTS combined with 6 μM chloroquine (CQ) for 48 h. Cell lysates were then subjected to immunoblot analysis using anti-p62 antibodies. Upper panels, representative results, short and long exposures are shown for FTS and CQ co-treatment blots. Lower panels, densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells).

FTS-induced p62 cleavage is reduced in FTS-resistant cells.

(A) CTRL, FR1 and FR2 HCT-116 sublines were treated with 75 μM FTS for 48 h and then subjected to qRT-PCR analysis of p62 transcript expression. Results are presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05, FTS treated compared to untreated cells). (B) CTRL, FR1 and FR2 HCT-116 sublines were treated with 75 μM FTS for the indicated time, or (C) 75 μM FTS combined with 6 μM chloroquine (CQ) for 48 h. Cell lysates were then subjected to immunoblot analysis using anti-p62 antibodies. Upper panels, representative results, short and long exposures are shown for FTS and CQ co-treatment blots. Lower panels, densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells). To confirm that FTS-induced cleavage of p62 results from enhanced apoptosis, control HCT-116 cells were treated with FTS in the presence of either QVD-OPH (pan-caspase inhibitor) or calpeptin (calpain inhibitor) (Fig 5A). The results obtained show that QVD-OPH completely abolished the cleavage of p62, while calpeptin had a partial inhibitory effect on p62 cleavage. Thus, it appears that FTS induces apoptosis-dependent cleavage of p62, which is significantly greater in the control HCT-116 cells than in the FTS-resistant cells.
Fig 5

QVD, Calpeptin and rapamycin treatments inhibit the FTS-induced p62 cleavage.

(A) CTRL HCT-116 cells were treated with 75 μM FTS for 48 h, in the presence or in the absence of 25 μM QVD-OPH or 10 μM calpeptin (Calp) and then subjected to immunoblot analysis using anti-p62 antibodies. Left panel, representative blot is shown. Right panel, densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01). (B) CTRL HCT-116 cells were treated with FTS at the indicated concentrations for 3 days, with or without 100 nM rapamycin (rapa). Cell viability was then assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01, FTS and rapamycin co-treatment compared to FTS treatment alone; ^^, p < 0.01, treated compared to untreated cells). (C) CTRL HCT-116 cells were treated with 60 μM FTS, with or without rapamycin at the indicated concentrations for 48 h. The cells were then subjected to immunoblot analysis using anti-LC3, anti-p62, anti-phospho S6K (p-S6K) and S6K antibodies. (D) Densitometric analysis of LC3-II/LC3-I ratio, full length p62 and cleaved p62 is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01).

QVD, Calpeptin and rapamycin treatments inhibit the FTS-induced p62 cleavage.

(A) CTRL HCT-116 cells were treated with 75 μM FTS for 48 h, in the presence or in the absence of 25 μM QVD-OPH or 10 μM calpeptin (Calp) and then subjected to immunoblot analysis using anti-p62 antibodies. Left panel, representative blot is shown. Right panel, densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01). (B) CTRL HCT-116 cells were treated with FTS at the indicated concentrations for 3 days, with or without 100 nM rapamycin (rapa). Cell viability was then assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01, FTS and rapamycin co-treatment compared to FTS treatment alone; ^^, p < 0.01, treated compared to untreated cells). (C) CTRL HCT-116 cells were treated with 60 μM FTS, with or without rapamycin at the indicated concentrations for 48 h. The cells were then subjected to immunoblot analysis using anti-LC3, anti-p62, anti-phospho S6K (p-S6K) and S6K antibodies. (D) Densitometric analysis of LC3-II/LC3-I ratio, full length p62 and cleaved p62 is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01). To further strengthen the notion that FTS-induced cleavage of p62 is related to the induction of apoptosis, we tested the effect of rapamycin on p62 cleavage. Rapamycin, an inhibitor of mTOR, is a known inducer of autophagy. As judged by the levels of full-length p62 and LC3-II/LC3-I ratio, rapamycin enhanced the pro-autophagic effect of FTS in the control HCT-116 cells (Fig 5C and 5D). In addition, rapamycin had partially reversed the inhibitory effect of FTS on cell viability (Fig 5B), probably as a result of autophagy enhancement. As expected, rapamycin also abolished the cleavage of p62 (Fig 5C and 5D), which might indicate that the protective effect of rapamycin originates from attenuation of FTS-induced apoptosis. FTS was also shown to induce protective autophagy in the human pancreatic cancer cell line, Panc-1 [11]. In addition, chloroquine enhanced FTS-induced apoptosis in these cells. Therefore, we tested whether FTS will have a similar effect on p62 cleavage in Panc-1 cells (S2 Fig). We found that FTS induced cleavage of p62 to yield a 46 kDa product. In the presence of chloroquine a 30 kDa fragment was observed. Thus, FTS-induced cleavage of p62 also occurs in cancer cell lines other than HCT-116.

FTS-resistant cells exhibit reduced apoptotic features

Having demonstrated that the FR HCT-116 sublines are less prone to FTS-induced p62 cleavage, and that this cleavage may be related to apoptosis, we next examined other apoptotic characteristics in these cells. Fig 6A shows that FTS induced a decrease in full-length caspase 3 expression, and, concomitantly, an increase in cleaved caspase 3, which was enhanced by chloroquine, and is indicative of apoptosis. Nevertheless, the cleavage of caspase 3 following FTS treatment, with or without chloroquine, is greater in the control cells compared to the FR HCT-116 cells.
Fig 6

FTS-resistant cells exhibit reduced apoptosis.

(A) CTRL, FR1 and FR2 HCT-116 sublines were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) for 48 h and then subjected to immunoblot analysis using anti-caspase 3 (Casp3) antibodies. Upper panel, representative results are shown. Lower panel, Densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^^, p < 0.01, FTS treated compared to untreated cells; ##, FTS and CQ co-treatment compared to each treatment alone). (B) CTRL, FR1, FR2 and FR3 HCT-116 sublines were treated with FTS at the indicated concentrations for 48 h and then subjected to qRT-PCR analysis of AURKA transcript expression or (C) immunoblot analysis using anti-AURKA antibodies. Results are presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to HCT FR1, FR2 and FR3 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells). (D) CTRL, FR2 and FR3 HCT-116 sublines were treated with increasing concentrations of 5-fluorouracil (5-FU) for 3 days. Cell viability was then assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01).

FTS-resistant cells exhibit reduced apoptosis.

(A) CTRL, FR1 and FR2 HCT-116 sublines were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) for 48 h and then subjected to immunoblot analysis using anti-caspase 3 (Casp3) antibodies. Upper panel, representative results are shown. Lower panel, Densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^^, p < 0.01, FTS treated compared to untreated cells; ##, FTS and CQ co-treatment compared to each treatment alone). (B) CTRL, FR1, FR2 and FR3 HCT-116 sublines were treated with FTS at the indicated concentrations for 48 h and then subjected to qRT-PCR analysis of AURKA transcript expression or (C) immunoblot analysis using anti-AURKA antibodies. Results are presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to HCT FR1, FR2 and FR3 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells). (D) CTRL, FR2 and FR3 HCT-116 sublines were treated with increasing concentrations of 5-fluorouracil (5-FU) for 3 days. Cell viability was then assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01). Next, we examined the levels of the tumor promoter aurora kinase A (AURKA). This protein serves as a target for several anti-cancer agents, and its downregulation leads to apoptosis in various cancer cell lines [18-21]. It was previously shown that in A549 human lung cancer cells, FTS treatment decreases AURKA mRNA levels, and inhibits its assembly at the spindle poles [22]. We found that FTS induced a dramatic decrease of AURKA mRNA and protein levels in the control HCT-116 subline (Fig 6B and 6C). Although this decrease was also evident in the FR1 and FR2 HCT-116 cells, these sublines still expressed significantly higher levels of AURKA mRNA and protein compared to the control cells; moreover, in the FR3 HCT-116 subline, FTS had no significant effect on AURKA mRNA levels and a less pronounced effect on its protein levels, compared to the other sublines (Fig 6B and 6C). Collectively, the results indicate that the FR HCT-116 sublines have developed resistance to FTS-induced apoptosis. Next, we examined the possibility that the FR cells have developed a general resistance mechanism that allows them to tolerate other pro-apoptotic, anti-cancer, treatments. Therefore, we employed 5-fluorouracil (5-FU), a conventional treatment for colon cancer, which is known to induce apoptosis [23]. As shown in Fig 6B, the FR HCT-116 sublines have indeed gained partial resistance to 5-FU treatment, and the subline which exhibited the highest IC50 toward FTS (FR3) also showed the highest resistance to 5-FU treatment.

FTS-resistant cells exhibit changes in proliferation/survival signaling pathways following FTS treatment

The findings, which suggest resistance to apoptosis in the FR HCT-116 sublines, have led us to examine the effect of FTS on major signaling pathways known to be affected by Ras activation. We analyzed pathways that regulate cell cycle progression/cell proliferation (ERK), cell growth (S6K) and cell survival (AKT) 24 h following FTS treatment [1] (Fig 7). In the control HCT-116 cells, 63 and 75 μM FTS treatments induced a decrease in the levels of phosphorylated ERK and AKT (p-ERK and p-AKT, respectively). In contrast, at the same concentrations, FTS induced an increase in the levels of p-AKT and p-ERK in the FR HCT-116 cells. Similarly, FTS reduced the levels of p-S6K in the control HCT-116 cells; however, in the FR HCT-116 cells, 63 μM FTS had led to an increase in p-S6K levels while only at 75 μM FTS, p-S6K levels decreased. Nevertheless, under these conditions, p-S6K levels remained significantly higher in the FR HCT-116 cells compared to the control cells. Similar results were obtained following transfection with a dominant negative (DN) H-Ras 17N mutant (S3 Fig.), which was previously found to inhibit the downstream signaling activity of all Ras isoforms [24]. Taken together, the results suggest that in the control HCT-116 cells, cell proliferation, growth and survival are suppressed by FTS, possibly through its effect on Ras signaling. On the contrary, in the FR HCT-116 cells, these processes are activated following FTS treatment, perhaps as a compensation mechanism. Next, we examined the levels of p21 protein, which negatively regulates cell cycle progression, and whose expression was shown to increase following FTS treatment [25]. While FTS enhanced the expression of p21 in the control HCT-116 cells, it had no effect on p21 levels in the FR cells, indicating that the treatment did not affect cell cycle progression in the FR HCT-116 sublines (Fig 7). Here again, a similar effect was visible following transfection with DN-Ras (S3 Fig).
Fig 7

FTS-resistant cells exhibit changes in proliferation/survival signaling pathways following FTS-treatments.

CTRL, FR1 and FR2 HCT-116 sublines were treated with FTS at the indicated concentrations for 24 h and then subjected to immunoblot analysis using anti-phospho-ERK, anti-phospho-S6K, anti-phospho-AKT and anti-p21 antibodies. Results are presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells).

FTS-resistant cells exhibit changes in proliferation/survival signaling pathways following FTS-treatments.

CTRL, FR1 and FR2 HCT-116 sublines were treated with FTS at the indicated concentrations for 24 h and then subjected to immunoblot analysis using anti-phospho-ERK, anti-phospho-S6K, anti-phospho-AKT and anti-p21 antibodies. Results are presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05; **, p < 0.01, CTRL compared to FR1 and FR2 HCT-116 cells; ^, p < 0.05; ^^, p < 0.01, FTS treated compared to untreated cells).

FTS-resistant HCT-116 cells preserve their resistance characteristics after prolonged FTS withdrawal

To examine whether FTS-resistance is transient or stable, we withdrew the FR HCT-116 cells from FTS treatment for one month, and tested cell viability following 5 days treatment with FTS at a range of concentrations (Fig 8A). Compared to the control-HCT-116 cells, the FR HCT-116 cells preserved their resistance toward FTS. Moreover, the FR HCT-116 cells have also retained the low levels of cleaved p62 compared to the control cells, following treatment with FTS (Fig 8B). These findings suggest that the mechanisms involved in FTS-resistance are relatively stable.
Fig 8

The FTS–resistant cells preserve the apoptosis resistance characteristics after one month of FTS withdrawal.

FR1 and FR2 HCT-116 sublines were grown without FTS for 1 month (FR1-W and FR2-W). These cells, as well as CTRL HCT-116 cells, were then treated with increasing concentrations of FTS for 5 days after. Cell viability was assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01, CTRL compared to HCT-116 FR1-W and FR2-W HCT-116 cells). (B) CTRL, FR1-W and FR2-W HCT-116 cells were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) and then subjected to immunoblot analysis using anti-p62 antibodies. Upper panel, representative blot is shown. Lower panel, densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05, CTRL compared to FR1-W and FR2-W HCT-116 cells; ^, p < 0.05, FTS treated compared to untreated cells).

The FTS–resistant cells preserve the apoptosis resistance characteristics after one month of FTS withdrawal.

FR1 and FR2 HCT-116 sublines were grown without FTS for 1 month (FR1-W and FR2-W). These cells, as well as CTRL HCT-116 cells, were then treated with increasing concentrations of FTS for 5 days after. Cell viability was assessed using the methylene blue staining assay (mean ± SE; **, p < 0.01, CTRL compared to HCT-116 FR1-W and FR2-W HCT-116 cells). (B) CTRL, FR1-W and FR2-W HCT-116 cells were treated with 75 μM FTS, with or without 6 μM chloroquine (CQ) and then subjected to immunoblot analysis using anti-p62 antibodies. Upper panel, representative blot is shown. Lower panel, densitometric analysis of the results is presented as fold induction over the untreated cells (mean ± SE; *, p < 0.05, CTRL compared to FR1-W and FR2-W HCT-116 cells; ^, p < 0.05, FTS treated compared to untreated cells).

Discussion

Drug resistance in cancer cells poses a major barrier for tumor eradication, and for further designing of novel anti-cancer drugs. Numerous anti-cancer agents were shown to induce resistance in tumor cells following continuous treatment, in vitro and in vivo, as well as in human subjects [26]. In this study, we examined the possibility that long exposure to the Ras inhibitor, FTS, would lead to treatment resistance. Resistance to FTS following 6 months treatment was tested in the human colon cancer cell line HCT-116. We found that, indeed, the cells have developed resistance to FTS-induced growth inhibition and cell death. Further characterization of the FTS-resistant cells revealed that their autophagy has become more efficient, as judged by the levels of LC3-I conversion into LC3-II and LC3 puncta. Another feature of the, presumably, more efficient autophagy in the FTS-resistant cells is reflected by the increased rates of cargo degradation following treatment (enhanced autophagic flux), compared to non-resistant cells, as reflected by both immunoblotting and immunostaining of endogenous LC3. This change might result from an enhanced autophagosome-lysosome fusion, an increased lysosomal activity or an increase in lysosomal content in the FTS-resistant cells. Previously, we have demonstrated that autophagy has a protective role in cancer cells treated with FTS [10,11]. Thus, the enhanced autophagy observed in the FTS-resistant cells might represent an adaptation mechanism to FTS. The results also suggest that in the non-resistant cells, autophagy does not function at its full capacity following the treatment, compared to the resistant cells. Indeed, activation of autophagy with rapamycin seems to enhance the conversion of LC3-I into LC3-II, to augment cargo degradation, and to reverse the inhibitory effect of FTS on cell viability. The p62 protein is involved in cargo selection during autophagy. In addition, other functions were attributed to p62, some of which are related to apoptosis [27]. In the present study, we found that FTS induced cleavage of p62 in HCT-116 cells, as well as in Panc-1 cells, to yield a 46 kDa product, and that at the addition of chloroquine, a 30 kDa product was also generated. This cleavage was inhibited by QVD-OPH and calpeptin, as well as by rapamycin. Cleavage of p62 into a 46 kDa fragment was previously reported to be caspase 6- and 8-dependent, while the 30 kDa fragment depends on caspase 6 activity. Calpain was also reported to contribute to p62 cleavage, generating multiple cleavage products [17]. Thus, FTS-induced cleavage of p62 appears to be related to apoptosis induction. We have previously shown that chloroquine enhances FTS-induced apoptosis in Panc-1 and HCT-116 cells [11]. Given the fact that the 30 kDa cleavage product was detected only following combined FTS and chloroquine treatment, but not after FTS treatment alone, it may be related to the occurrence of enhanced apoptosis under these conditions. The cleavage of p62 was more prominent in non-resistant HCT-116 cells compared with FTS-resistant cells, indicating that the resistant cells exhibit reduced apoptosis following treatment. This assumption is further supported by the fact that FTS, alone and with chloroquine, had less effect on caspase 3 cleavage in the FTS-resistant HCT-116 cells, compared with the non-resistant cells. The low levels of cleaved p62 generated in the FTS-resistant cells might be linked to their resistance mechanism, since cleaved p62 was shown to inhibit autophagy, and it may possess cytotoxic activity [28,29]. Therefore, it is plausible that the reduced cleavage of p62 in the FTS-resistant cells allows them to exhibit a more effective autophagy, resulting in a higher resistance to the treatment. In the FTS-resistant HCT-116 cells, other proteins were affected. One such protein is AURKA, which is involved in spindle assembly and cell division [18]. FTS treatment reduced the levels of AURKA mRNA and protein; however, this effect was more profound in the non-resistant HCT-116 cells compared to the resistant cells. This result pinpoints AURKA as part of an additional mechanism responsible for FTS resistance. In fact, AURKA expression was shown to potentiate Ras-induced transformation, and it correlates with colon cancer progression [18]. Moreover, AURKA inhibitors were found to be highly effective against the growth of HCT-116 cells and xenograft tumors. In accordance with these results we have found changes in signaling pathways related to cell growth (S6K, a substrate of mTOR), survival (AKT) and proliferation (Erk). FTS inhibits these pathways in the non-resistant HCT-116 cells; however, in the FTS-resistant cells, an opposite effect occurs, which may indicate that the alterations in these signaling pathways allow the cells to better cope with the treatment. Moreover, while FTS induced an increase in p21 in the non-resistant HCT-116 cells, which is indicative of cell cycle arrest, it did not affect p21 levels in the FTS-resistant cells, further showing an altered response to the treatment. It was shown that HCT-116 cells harbor a heterozygous activation mutation in PI3K [30]. Yet, intriguingly, it appears that inhibition of Ras, which occurs upstream of PI3K, by both FTS and the DN-Ras, suppressed PI3K/Akt/mTOR signaling in the non-resistant HCT-116. As for the Erk pathway, it was shown that it can activate autophagy in several cancer cell lines, including colon cancer cells [31]; therefore, the activation of this pathway by FTS in the resistant cells might explain their enhanced autophagy compared with the non-resistant cells following FTS treatment. To summarize, we found that HCT-116 human colon cancer cells can develop resistance to the Ras inhibitor FTS, following prolonged treatment. Some of the FTS-resistance characteristics were more prominent in HCT-116 cells that were exposed to higher concentrations of FTS during the continuous treatment period (FR3 HCT-116 cells). Hence, the degree of resistance seems to depend upon FTS concentration. It also appears that the acquired resistance to FTS is quite stable, since it was still evident one month after FTS withdrawal. Several features appear to be altered in the FTS-resistant HCT-116 cells, some of which might account for FTS-resistance. In addition, the mechanisms involved in FTS-resistance might represent a more general phenomenon, since the FTS-resistant HCT-116 cells were also less affected by treatment with 5-FU. The suggested resistance mechanisms described here might assist in understanding acquired resistance mechanisms for anticancer therapy consisting of anti-Ras agents in combinations with other inhibitors.

Effect of FTS on cell viability in CTRL and FTS-resistant HCT-116 (FR3) sublines.

CTRL and FR3 HCT-116 sublines, were treated with increasing concentrations of FTS for 5 days. Cell viability was then assessed using the methylene blue staining assay (A) and IC50 values were calculated (B) as described in materials and methods (**, p < 0.01, CTRL compared to FR3 HCT-116 cells). (TIF) Click here for additional data file.

Effect of FTS and chloroquine on p62 cleavage in Panc-1 cells.

Panc-1 cells were treated with FTS for the indicated concentrations and times (A) or for 96 h in combination with 15 μM chloroquine (CQ) (B). The cells were then subjected to immunoblot analysis using anti-p62 antibodies. (TIF) Click here for additional data file.

FTS-resistant cells exhibit changes in proliferation/survival signaling pathways following transfection with a dominant negative (DN) Ras variant.

CTRL, FR1 and FR2 HCT-116 sublines were transfected with either GFP or GFP-DN-Ras for 48 h and subjected to immunoblot analysis using anti-phospho-S6K, anti-phospho-AKT and anti-p21 antibodies. Numbers below bands indicate fold induction of total protein /actin levels. The results shown are of a representative experiment. (TIF) Click here for additional data file.
  31 in total

1.  To aggregate or not to aggregate? A new role for p62.

Authors:  Jorge Moscat; Maria T Diaz-Meco
Journal:  EMBO Rep       Date:  2009-08       Impact factor: 8.807

2.  Silencing of Aurora kinase A by RNA interference inhibits tumor growth in human osteosarcoma cells by inducing apoptosis and G2/M cell cycle arrest.

Authors:  Zhenhuan Jiang; Jiannong Jiang; Huilin Yang; Zhijun Ge; Qiang Wang; Leiyan Zhang; Chenguang Wu; Jinzhi Wang
Journal:  Oncol Rep       Date:  2014-01-20       Impact factor: 3.906

3.  The in vitro cleavage of the hAtg proteins by cell death proteases.

Authors:  Joanna M Norman; Gerald M Cohen; Edward T W Bampton
Journal:  Autophagy       Date:  2010-11       Impact factor: 16.016

4.  A novel Ras antagonist regulates both oncogenic Ras and the tumor suppressor p53 in colon cancer cells.

Authors:  J Halaschek-Wiener; V Wacheck; H Schlagbauer-Wadl; K Wolff; Y Kloog; B Jansen
Journal:  Mol Med       Date:  2000-08       Impact factor: 6.354

5.  Cancer statistics, 2010.

Authors:  Ahmedin Jemal; Rebecca Siegel; Jiaquan Xu; Elizabeth Ward
Journal:  CA Cancer J Clin       Date:  2010-07-07       Impact factor: 508.702

Review 6.  Mitophagy: mechanisms, pathophysiological roles, and analysis.

Authors:  Wen-Xing Ding; Xiao-Ming Yin
Journal:  Biol Chem       Date:  2012-07       Impact factor: 3.915

Review 7.  Circumventing cancer drug resistance in the era of personalized medicine.

Authors:  Levi A Garraway; Pasi A Jänne
Journal:  Cancer Discov       Date:  2012-02-28       Impact factor: 39.397

Review 8.  Aurora kinase inhibitors: progress towards the clinic.

Authors:  Madhu Kollareddy; Daniella Zheleva; Petr Dzubak; Pathik Subhashchandra Brahmkshatriya; Martin Lepsik; Marian Hajduch
Journal:  Invest New Drugs       Date:  2012-02-18       Impact factor: 3.850

9.  Regulation of autophagy by kinases.

Authors:  Savitha Sridharan; Kirti Jain; Alakananda Basu
Journal:  Cancers (Basel)       Date:  2011-06-09       Impact factor: 6.639

10.  Chloroquine synergizes with FTS to enhance cell growth inhibition and cell death.

Authors:  Eran Schmukler; Eya Wolfson; Roni Haklai; Galit Elad-Sfadia; Yoel Kloog; Ronit Pinkas-Kramarski
Journal:  Oncotarget       Date:  2014-01-15
View more
  2 in total

1.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

2.  Altered mitochondrial dynamics and function in APOE4-expressing astrocytes.

Authors:  Eran Schmukler; Shira Solomon; Shira Simonovitch; Yona Goldshmit; Eya Wolfson; Daniel Morris Michaelson; Ronit Pinkas-Kramarski
Journal:  Cell Death Dis       Date:  2020-07-24       Impact factor: 8.469

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.