Karyosystematics and molecular taxonomy of the anomalous blue butterflies (Lepidoptera, Lycaenidae) from the Balkan Peninsula.

The Balkan Peninsula represents one of the hottest biodiversity spots in Europe. However, the invertebrate fauna of this region is still insufficiently investigated, even in respect of such well-studied organisms as Lepidoptera. Here we use a combination of chromosomal, molecular and morphological markers to rearrange the group of so-called anomalous blue butterflies (also known as 'brown complex' of the subgenus Agrodiaetus Hübner, [1822] and as the Polyommatus (Agrodiaetus) admetus (Esper, 1783) species group) and to reveal its cryptic taxonomic structure. We demonstrate that Polyommatus aroaniensis (Brown, 1976) is not as widespread in the Balkans as was previously thought. In fact, it has a dot-like distribution range restricted to the Peloponnese Peninsula in South Greece. Polyommatus orphicus Kolev, 2005 is not as closely related to the Turkish species Polyommatus dantchenkoi (Lukhtanov & Wiemers, 2003) as was supposed earlier. Instead, it is a Balkan endemic represented by two subspecies: Polyommatus orphicus orphicus (Bulgaria) and Polyommatus orphicus eleniae Coutsis & De Prins, 2005 (Northern Greece). Polyommatus ripartii (Freyer, 1830) is represented in the Balkans by an endemic subspecies Polyommatus ripartii pelopi. The traditionally recognized Polyommatus admetus (Esper, 1783) is shown to be a heterogeneous complex and is divided into Polyommatus admetus sensu stricto (the Balkans and west Turkey) and Polyommatus yeranyani (Dantchenko & Lukhtanov, 2005) (east Turkey, Armenia, Azerbaijan and Iran). Polyommatus nephohiptamenos (Brown & Coutsis, 1978) is confirmed to be a species with a dot-like distribution range in Northern Greece. Finally, from Central Greece (Timfristos and Parnassos mountains) we describe Polyommatus timfristos Lukhtanov, Vishnevskaya & Shapoval, sp. n. which differs by its haploid chromosome number (n=38) from the closely related and morphologically similar Polyommatus aroaniensis (n=47-48) and Polyommatus orphicus (n=41-42). We provide chromosomal evidence for three separate south Balkan Pleistocene refugia (Peloponnesse, Central Greece and Northern Greece/South Bulgaria) and stress the biogeographic importance of Central Greece as a place of diversification. Then we argue that the data obtained have direct implications for butterfly karyology, taxonomy, biogeography and conservation.

Introduction

The Balkan Peninsula is recognized as a European biodiversity hotspot, with high endemism found in animals and plants (Nicolić et al. 2014, Buj et al. 2015, Bregović and Zagmajster 2016). However, the invertebrate fauna of this region is still insufficiently investigated (Previšić et al. 2016), even in respect of such a well-studied group as (butterflies and moths) (Sobezyk and Gligorović 2016).

Within Balkan , the Hübner, [1822] blue butterflies are the most complicated group from the taxonomical point of view. The subgenus is a distinct monophyletic lineage within the species-rich genus Latreille, 1804 (Talavera et al. 2013a). Adult butterflies are small in size with wing span from 1.9 to 3.6 cm. Females are mostly warm brown on the upperside of the wings, whereas males can be either blue or brown. In the latter case, they resemble females. Thus, a species can be classified as either dimorphic or monomorphic depending on the wing color of the males. Most of the species have a white streak on the underside of hind wings, and this feature appears to be an apomorphic character of the subgenus . However, in a few species and populations this white streak is secondarily reduced or totally absent (Eckweiler and Bozano 2016).

The subgenus includes numerous species, subspecies and forms with uncertain taxonomic positions (Eckweiler and Häuser 1997). It was estimated to have originated only about 3 million years ago (Kandul et al. 2004) and radiated rapidly in the Western Palaearctic (Kandul et al. 2007). The last published review of the subgenus includes 120 valid species (Eckweiler and Bozano 2016). Many of them have extremely local ‘dot-like’ distributions that are restricted to particular mountain valleys in the Balkan Peninsula, Asia Minor, Transcaucasus, Iran and Central Asia (Vila et al. 2010, Eckweiler and Bozano 2016).

Although this group has attracted the attention of numerous researchers (e.g. de Lesse 1960a, b, Häuser and Eckweiler 1997, Oliver et al. 1999, Carbonell 2000, 2001, Dantchenko 2000, Przybyłowicz 2000, 2014, ten Hagen and Eckweiler 2001, Skala 2001, Lukhtanov and Dantchenko 2002a, Kandul et al. 2002, 2004, 2007, Wiemers 2003, Schurian and ten Hagen 2003, Vila et al. 2010, Talavera et al. 2013a), a large number of unresolved taxonomic problems still persist in .

In most cases, species identification in is extremely difficult. The morphology of male genitalia is uniform throughout most of the species and, with a few exceptions (see Coutsis 1985, 1986), at most it can help to separate groups of species, e.g. the (Hübner, 1823) and (Esper, 1783) species groups (see Kolev 2005), but not individual species. The differences in wing pattern and coloration between many species are very subtle or nearly lacking (Eckweiler and Bozano 2016).

Despite morphological similarity, the taxonomic and identification problems within the subgenus can be solved if chromosomal (de Lesse 1960a,b, Lukhtanov 1989) or molecular markers (Wiemers 2003, Kandul et al. 2004, 2007, Lukhtanov , Stradomsky and Fomina 2013), or their combination (Lukhtanov et al. 2006, 2014, 2015a, Vila et al. 2010, Lukhtanov and Tikhonov 2015, Shapoval and Lukhtanov 2015a,b) are applied. Although chromosome numbers are invariable in many groups of (Robinson 1971, Lukhtanov 2014, Hernández-Roldán 2016), a few genera demonstrate chromosomal instability, a situation in which multiple closely related species differ drastically from each other by major chromosomal rearrangements, sometimes resulting in high variability in chromosome number (de Lesse 1960a,b, Talavera et al. 2013b). An unusual diversity of karyotypes is the most remarkable characteristic of the subgenus . Species of exhibit one of the highest ranges in chromosome numbers in the animal kingdom (Lukhtanov 2015). Haploid chromosome numbers in range from n=10 in (Staudinger, 1871) to n=134 in (Skala, 2001) (Lukhtanov and Dantchenko 2002a, Lukhtanov et al. 2005). Additionally, this subgenus demonstrates a high level of karyotypic differentiation with respect to chromosome size (Lukhtanov and Dantchenko 2002b) and variation in number of chromosomes bearing ribosomal DNA clusters (Vershinina et al. 2015). The karyotype is generally stable within species although differences between closely related taxa are often high and provide reliable characters for species delimitation, description and identification (de Lesse 1960a,b, Lukhtanov and Dantchenko 2002a,b).

Molecular studies revealed that subgenus consists of 10 monophyletic clades: the (Heyne, 1895) group, the (Staudinger, 1886) group, the (Lederer, 1869) group, the (Herrich-Schäffer, 1844) group, the group, the (Eversmann, 1841) group, the (Herrich-Schäffer, 1851) group, the (Denis & Schiffermüller, 1775) group, the group and the (Herrich-Schäffer, 1851) group (Kandul et al. 2002, 2004, 2007, Wiemers 2003). They also demonstrated that many species are clearly differentiated with respect to mitochondrial and nuclear DNA sequences. However, this is not a general rule, as the standard mitochondrial DNA barcodes are often identical or nearly identical between closely related taxa and even between morphologically distinct species (Kandul et al. 2004, 2007, Wiemers and Fiedler 2007). Generally, chromosomal characters in evolve more quickly than standard DNA barcodes, and because they are usually present as fixed differences, provide better markers for recently evolved taxa than nucleotide substitutions (Lukhtanov et al. 2015a).

Species delimitation is especially difficult within a group of so-called anomalous blue species (known also as ‘brown complex’ of the subgenus and as the species complex). This group is composed of multiple species in which both male and female butterflies have similar brown coloration on the upperside of the wings (Lukhtanov et al. 2003).

The group of anomalous blue species includes taxa belonging to two clearly monophyletic and most probably sister clades: the clade (comprises only monomorphic species – , , . , , ) and the clade (comprises both monomorphic – , , , , , ,PageBreak , , sp. n., , , , ; and dimorphic species – , , ). The anomalous blue butterflies represent a real stumbling block in the taxonomy (Lukhtanov et al. 2003, Przybyłowicz et al. 2014). According to Eckweiler and Bozano (2016), the group is distributed in West Palearctic from Spain in the west to Mongolia in the east. The majority of the species have very localized distribution areas concentrated in (1) the Iberian Peninsula, (2) the Balkan Peninsula and (3) west Asia (mostly in the Middle East and Caucasus). Vila et al. (2010) studied in detail the European taxa distributed west of the 17th meridian, using a combination of molecular and chromosomal markers (Vila et al. 2010). Chromosomal and molecular markers were also applied to study the taxonomy of the Asian taxa (Lukhtanov et al. 2015a). It is paradoxical that systematic studies based on combined analysis of molecular and chromosomal markers have never been applied to Balkan taxa of the species complex. However, some DNA data can be found in GenBank (Wiemers 2003, Wiemers et al. 2007, 2009, 2010, Lukhtanov et al. 2009, 2015a, Vila et al. 2010, Dincă et al. 2013, Przybyłowicz et al. 2014) and chromosome numbers are known for a few Balkan populations (Coutsis and De Prins 2005, 2007, Kolev 2005).

The goal of the present study is a simultaneous investigation of chromosomal, molecular and morphological diversity in the anomalous blue butterflies from the Balkan Peninsula and interpretation of this diversity in terms of taxonomy. To achieve this goal, the following tasks were set:

To collect specimens of all the taxa of the complex described from the territory of the Balkan Peninsula. To collect specimens from different populations of these taxa.

To study their karyotypes (chromosome number and structure) using standard protocols for staining.

To obtain data on the variability of molecular markers: mitochondrial DNA barcode ( gene fragment) and nuclear internal transcribed spacer 2 (). These markers were selected because the usefulness of mitochondrial barcodes in taxonomic studies on species-level is generally recognized (Hebert et al. 2004, but see Wiemers and Fiedler 2007), and despite some limitations (Shapoval and Lukhtanov 2015c), internal transcribed spacer 2 was found to be a useful nuclear marker in butterfly taxonomy (Wiemers et al. 2009).

To study the variability of the wing pattern characters which can be potentially useful for delimitation of species and populations (presence/reduction/absence of the white streak on the underside of the hindwings, the development of the marginal marking on the underside of the wings, presence or absence of a white stroke on the underside of the forewings).

To interpret the discovered chromosomal, molecular and morphological diversity in terms of taxonomy using two original methodologies: (1) detecting and taxonomic interpretation of cryptic entities found in sympatry and allopatry using combined analysis of mitochondrial and chromosomal markers (Lukhtanov et al. 2015a), and (2) critical evaluation of pre-existing morphology-based taxonomic hypotheses using DNA barcodes (Lukhtanov et al. 2016).

Material and methods

Taxon sampling

Butterflies for this study were collected in 2008 in the Balkan Peninsula by V.A. Lukhtanov, N.A. Shapoval and L. Rieppel, in 2016 in Hvoyna village (Bulgaria) by E.A. Pazhenkova and in the Tigirekskiy Reservation (the Altai Mountains, Russia) by M.S.Vishnevskaya in 2007 (Fig. 1, Table 1). We paid special attention to collecting the taxa in their type localities: mount Chelmos (Greece: Peloponnese) (type locality of Brown, 1976), mount Falakró near Granítis (Greece, Makedonía, Dráma district) (type locality of Coutsis & De Prins, 2005) and Hvoyna (south Bulgaria, the Rhodopi mts) (type locality of ). Unfortunately, in our research we did not have an opportunity to study the holotypes of these taxa. Taking into account a possibility of multiple cryptic species within a local area even in well-studied European butterflies (Dincă et al. 2011, 2013b), in each place we managed to collect (and then to study) as many individuals as possible paying special attention to the specimens with unusual or intermediate morphology.

Figure 1.

Localities of the species collected for the study (the species list is presented in Table 1). 1 Bulgaria: Dragoman () 2 Bulgaria: Hvoyna (, ) 3 Greece: Granitis (, ) 4 Greece: Smolikas () 5 Greece: Timfristos Mt (, ) 6 Greece: Parnassos Mt () 7 Greece: Kalavrita (, , ). Colored circles match different taxa. Blue circle: . Red circle: . Brown circle: . Lavender circle: . Yellow circle: sp. n. Grey circle: .

Table 1.

List of butterflies collected for the present study*

Traditionally accepted name and combination	Proposed name and combination	Sample code	GenBank code COI	GenBank ITS2	Locality and date
Polyommatus admetus	Polyommatus admetus	08D109	KY050594		Greece, Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 17 July 2008
Polyommatus admetus	Polyommatus admetus	08D211	KY050595	KY066732	Greece, Kalavrita 38°02.097'N; 22°07.085'E, 1150 m, 19 July 2008
Polyommatus admetus	Polyommatus admetus	08D386	KY050596	KY066733	Greece, Smolikas, 40°03.175'N; 20°53.941'E, 1497 m, 22 July 2008
Polyommatus admetus	Polyommatus admetus	08D655	KY050597		Bulgaria, Dragoman, 42°56.320'N; 22°56.038'E, 753 m, 29 July 2008
Polyommatus aroaniensis	Polyommatus aroaniensis	08D102	KY050598	KY066734	Greece, Kalavrita, 38°00.699'N; 22°11.554'E, 1640, 16 July 2008
Polyommatus aroaniensis	Polyommatus timfristos	08D205	KY066724	KY081278	Greece, Parnassos, 38°33.311'N; 22°34.300'E, 1750m, 19 July 2008
Polyommatus aroaniensis	Polyommatus timfristos	08D247	KY066725	KY081279	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus aroaniensis	Polyommatus timfristos	08D255	KY066726	KY081280	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus aroaniensis	Polyommatus timfristos	08D258	KY066727	KY081281	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus aroaniensis	Polyommatus timfristos	08D273	KY066728	KY081282	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus aroaniensis	Polyommatus timfristos	08D274	KY066729	KY081283	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	08D546	KY066698	KY081246	Bulgaria, Hvoyna, Rodopi Mts, 41°52'14"N; 24°41'6"E, 800 m, 26 July 2008
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	08D560	KY066699	KY081247	Bulgaria, Hvoyna, Rodopi Mts, 41°52'14"N; 24°41'6"E, 800 m, 26 July 2008
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 002	KY066700	KY081266	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 003	KY066701	KY081267	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 006	KY066702	KY081268	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 010	KY066705	KY081271	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 011	KY066706	KY081272	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 012	KY066707	KY081273	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 013	KY066708	KY081274	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 014	KY066709	KY081275	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 015	KY066710	KY081276	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 016	KY066711	KY081277	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 007	KY066703	KY081269	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	PE 008	KY066704	KY081270	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 950 m, 3–7 July 2016
Polyommatus dantchenkoi orphicus	Polyommatus orphicus orphicus	08D545	KY066697	KY081245	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 800 m, 26 July 2008
Polyommatus eleniae	Polyommatus orphicus eleniae	08D431	KY050599	KY066735	Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008
Polyommatus eleniae	Polyommatus orphicus eleniae	08D433	KY050600	KY066736	Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008
Polyommatus eleniae	Polyommatus orphicus eleniae	08D434	KY050601	KY081243	Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008
Polyommatus eleniae	Polyommatus orphicus eleniae	08D437	KY050602	KY081244	Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D471	KY050603	KY081248	Greece, Granitis, 41°17.543'N; 23°56.265'E, 830 m, 23 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D483	KY050604	KY081249	Greece, Granitis, 41°13.485'N; 24°02.990'E, 1646 m, 23 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D485			Greece, Granitis, 41°13.485'N; 24°02.990'E 1646 m, 23 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D494	KY050605	KY081250	Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D496	KY050606	KY081251	Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D498	KY066694	KY081252	Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008
Polyommatus nephohiptamenos	Polyommatus nephohiptamenos	08D499	KY066695	KY081253	Greece, Granitis, 41°13.485'N; 24°02.990'E, 1450–1750 m, 24 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D249	KY066717	KY081258	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D252	KY066718	KY081259	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D257	KY066719	KY081260	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D260	KY066720	KY081263	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D291	KY066721	KY081261	Greece, Timfristos, 38°55.460'N; 21°47.605'E, 1267 m, 20 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D549	KY066722	KY081262	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 800 m
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D551			Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N; 24°41.6'E, 800m, 26 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D571	KY066723	KY081264	Bulgaria, Hvoyna, Rodopi Mts yna, 41°52.14'N; 24°41.6'E, 800 m, 26 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D085	KY066712	KY081254	Greece, Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 16 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D092	KY066713	KY081255	Greece, Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 16 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D120	KY066714	KY081256	Greece Kalavrita, 38°02.097'N; 22°07.085'E, 812 m, 17 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D144	KY066715	KY085933	Greece Kalavrita, 38°01.617'N; 22°13.411'E, 1610–1700 m, 17 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	08D145	KY066716	KY081257	Greece, Kalavrita, 38°01.617'N; 22°13.411'E 1610–1700 m, 17 July 2008
Polyommatus ripartii pelopi	Polyommatus ripartii pelopi	PE 009	KY066696	KY081265	Bulgaria, Hvoyna, Rodopi Mts, 41°52.14'N 24°41.6'E, 950 m
Plebejus damon	Plebejus damon	VM237	KY066730		Russia, Altai Mts, Tigirek, 51°0'N; 82°55'E, 28 July 2007
Plebejus damon	Plebejus damon	VM196	KY066731		Russia, Altai Mts, Tigirek, 51°0'N; 82°55'E, 19 July 2007

The samples 08D485 and 08D551 were not used for molecular analysis since the sequences obtained were too short.

Before processing butterflies were put in glassine envelopes and kept alive for less than one hour. Testes were removed and put into a vial with a fresh fixative (3:1, 96% PageBreakethanol: glacial acetic acid). The wings were removed and put into a glassine envelope, and the body was placed into a vial with 96% ethanol for further molecular analysis. All chromosome preparations, butterfly bodies in ethanol and wings in glassine envelopes are stored in the Department of Karyosystematics (Zoological Institute of the Russian Academy of Sciences, St. Petersburg).

Analysis of karyotype

Testes were stored in the 3:1 fixative for several months at +4 °C and then stained with 2% acetic orcein for 30 days at 20 °C. We used a two-phase method of chromosome analysis following Lukhtanov and Dantchenko (2002b). In the first phase, stained testes were placed into a drop of 40% lactic acid on a slide where spermatocysts were dissected from testis membranes using entomological pins. Intact spermatocytes were transferred into a new drop of 40% lactic acid and covered with a coverslip. A Carl Zeiss Amplival light microscope was used for cytogenetic analysis. During the metaphase I stage, each spermatocyst was observed as a regular sphere consisting of 64 spermatocytes. In the second phase, different degrees of chromosome spreading were observed by gradually increasing pressure on the coverslip. The second phase was useful for studying the bivalent structure and counting the bivalent number. By scaling up the pressure on the coverslip, we were able to manipulate chromosomes, e.g. change their position and orientation on the slide, and consequently to resolve controversial cases of contacting or overlapping bivalents. Haploid chromosome numbers were counted in metaphase I (MI) and/or metaphase II (MII) of meiosis.

DNA extraction and sequencing

We used a 657-bp fragment within the mitochondrial gene and a 440-bp fragment within the region. DNA was extracted using phenol-chloroform method according to the standard protocol (Sambrook and Russel 2006). The first two abdominal segments were homogenized in lysis buffer [25 mM EDTA, 75 mM NaCl, 10 mM Tris (pH 7.5)]. Then proteinase K (20 mg/ml) and 10% SDS were added and the samples were incubated for 2 h at 60 °C. DNA was extracted from lysate first with phenol/chloroform (1:1) and then with chloroform to remove any remaining phenol. DNA was precipitated with isopropyl alcohol in the presence of 0.1 M NaCl and pelleted by centrifugation. The pellets were washed with 70% ethanol, dried and dissolved in ddH2O. The extracted DNA was stored at -20 °C.

For amplification we used the self-designed primers F1 (5’-CCACAAATCATAAAGATATTGGAAC-3’) and R1 (5’-TGATGAGCTCATACAATAAATCCTA-3’). For amplification we used the self-designed primers F (5’-CATATGCCACACTGTTCGTCTG-3’) and R (5’-GATATCCGTCAGCGCAACG-3’).

The polymerase chain reaction (PCR) was carried out with Taq-polymerase (Sileks) in 20 µl of PCR buffer containing MgCl2 [2.5 mM], dNTP [200 mM] and forward and reverse primers [20 pmol each]. Amplification of gene fragment was carried out with the following conditions: initial denaturation at 94 °C for 3 min, followed by 30 cycles of 30 sec at 94 °C, 30 sec at 51 °C (the annealing temperature) and 30 sec at 72 °C, and then final elongation 5 min for 72 °C. Amplification of region fragment was carried out with the following conditions: initial denaturation at 94 °C for 2 min, followed by 30 cycles of 30 sec at 94 °C, 30 sec at 60 °C (the annealing temperature) and 30 sec at 72 °C, and then final elongation 5 min for 72 °C.

After amplification, PCR mix was loaded in 1% agarose gel and specific product was separated by gel electrophoresis (Fig. 2). Pieces of gel containing the DNA fragment of required length were cut out and then double-stranded DNA was purified using the method of ‘DNA purification from agarose gels with MP@SiO2 magnetic particles’ according to the manufacturer’s protocol (Sileks). Purified DNA fragments were extracted with ddH2O from magnetic particles pelleted with a magnetic rack and collected in a fresh tube. The concentration of purified DNA was estimated via gel electrophoresis (by comparing the brightness of the sample fragment to the brightness of the DNA marker (in our case 100 bp DNA Ladder, Thermo Fisher Scientific).

Figure 2.

Gel electrophoresis with and PCR products showing the length of the fragments.

All the preparations for sequencing were held in “The Laboratory of Animal Genetics” of Saint-Petersburg State University and “Chromas” Core Facility, Saint-Petersburg State University Research Park. Sequencing was carried out in the Research Resource Center for Molecular and Cell Technologies. GenBank codes of the studied samples are provided in Tables 1 and 2.

Table 2.

List of samples and haplogroups used for the present study.

Taxon and field code	COI GenBank code	ITS2 GenBank code	COI haplogroup
Polyommatus admetus 08D109	KY050594		ad_1
Polyommatus admetus 08D211	KY050595	KY066732	ad_2
Polyommatus admetus 08D386	KY050596	KY066733	ad_3
Polyommatus admetus	AY556867	AY556733	ad_4
Polyommatus admetus	AY556986		ad_5
Polyommatus admetus	KC581753		ad_6
Polyommatus admetus	KC581754		ad_7
Polyommatus alcestis alcestis	AY557008	AY556641	alc_3
Polyommatus aroaniensis 08D102	KY050598	KY066734	ar_1
Polyommatus aroaniensis	AY556856	AY556725	ar_2
Polyommatus dantchenkoi	AY557072	AY556678	dan_1
Polyommatus dantchenkoi	AY557081	AY556685
Polyommatus dantchenkoi	AY557073	AY556679
Polyommatus demavendi belovi	KR265493		dem_1
Polyommatus demavendi belovi	KR265494		dem_2
Polyommatus demavendi belovi	EF104630		dem_3
Polyommatus demavendi lorestanus	AY557142	AY556743	dem_4
Polyommatus dolus virgilius	HM210162	HM210180	dol_1
Polyommatus dolus vittatus	AY496740		dol_2
Polyommatus fabressei	AY496744		fab_1
Polyommatus fabressei	AY556952	AY556608
Polyommatus fabressei	AY556869	AY556734	fab_1
Polyommatus fulgens	AY556941	AY556601
Polyommatus fabressei	EF104605	HM210186	fab_4
Polyommatus fulgens	AY556963	AY556615	ful_1
Polyommatus fulgens	AY496746
Polyommatus fulgens	AY496712
Polyommatus fulgens	AY556954	AY556610	ful_2
Polyommatus fulgens	AY556958		ful_4
Polyommatus humedasae	AY557127	AY556710	hum_1
Polyommatus humedasae	AY557128	AY556711	hum_2
Polyommatus humedasae	HM210169	HM210192
Polyommatus humedasae	HM210170	HM210193	hum_4
Polyommatus karacetinae	AY556906		alc_1
Polyommatus karacetinae	AY556907	AY556574	alc_1
Polyommatus karacetinae	AY557090		alc_4
Polyommatus karacetinae urmiaensis	EF104631		urm
Polyommatus khorasanensis	AY557138	AY556737	khor
Polyommatus menalcas	AY556982		men_1
Polyommatus menalcas	AY557111		men_2
Polyommatus menalcas	AY557001	AY556635	men_3
Polyommatus nephohiptamenos 08D471	KY050603	KY081248	ne_1
Polyommatus nephohiptamenos 08D483	KY050604	KY081249
Polyommatus nephohiptamenos 08D499	KY066695	KY081253
Polyommatus nephohiptamenos 08D496	KY050606	KY081251
Polyommatus nephohiptamenos 08D494	KY050605	KY081250	ne_3
Polyommatus nephohiptamenos 08D498	KY066694	KY081252	ne_5
Polyommatus nephohiptamenos	KC581745		ne_7
Polyommatus nephohiptamenos	AY556860
Polyommatus nephohiptamenos	AY556859	AY556728
Polyommatus orphicus eleniae 08D431	KY050599	KY066735	orph_1
Polyommatus orphicus eleniae 08D433	KY050600	KY066736
Polyommatus orphicus eleniae 08D437	KY050602	KY081244
Polyommatus orphicus eleniae 08D434	KY050601	KY081243	orph_3
Polyommatus orphicus orphicus 08D545	KY066697	KY081245	orph_5
Polyommatus orphicus orphicus 08D560	KY066699	KY081247
Polyommatus orphicus orphicus PE 003	KY066701	KY081267	orph_5
Polyommatus orphicus orphicus PE 011	KY066706	KY081272
Polyommatus orphicus orphicus PE 013	KY066708	KY081274
Polyommatus orphicus orphicus PE 014	KY066709	KY081275
Polyommatus orphicus orphicus PE 015	KY066710	KY081276
Polyommatus orphicus orphicus PE 007	KY066703	KY081269
Polyommatus orphicus orphicus PE 006	KY066702	KY081268
Polyommatus orphicus orphicus PE 012	KY066707	KY081273	orph_6
Polyommatus orphicus orphicus PE 008	KY066704	KY081270
Polyommatus orphicus orphicus 08D546	KY066698	KY081246
Polyommatus orphicus orphicus PE 002	KY066700	KY081266	orph_8
Polyommatus orphicus orphicus PE 010	KY066705	KY081271	orph_11
Polyommatus orphicus orphicus PE 016	KY066711	KY081277
Polyommatus pseudorjabovi	KR265487		pse_1
Polyommatus pseudorjabovi	KR265489
Polyommatus pseudorjabovi	KR265490
Polyommatus pseudorjabovi	KR265491		pse_1
Polyommatus pseudorjabovi	KR265484
Polyommatus pseudorjabovi	KR265480
Polyommatus pseudorjabovi	KR265496		pse_2
Polyommatus pseudorjabovi	KR265483
Polyommatus pseudorjabovi	KR265481
Polyommatus pseudorjabovi	KR265488		pse_3
Polyommatus pseudorjabovi	KR265482		pse_9
Polyommatus pseudorjabovi	KR265500		pse_12
Polyommatus ripartii pelopi 08D249	KY066717	KY081258	rip_1
Polyommatus ripartii pelopi 08D252	KY066718	KY081259
Polyommatus ripartii pelopi 08D257	KY066719	KY081260	rip_3
Polyommatus ripartii pelopi 08D260	KY066720	KY081263	rip_4
Polyommatus ripartii pelopi 08D291	KY066721	KY081261
Polyommatus ripartii pelopi 08D549	KY066722	KY081262
Polyommatus ripartii pelopi 08D085	KY066712	KY081254
Polyommatus ripartii pelopi 08D145	KY066716	KY081257
Polyommatus ripartii ripartii	AY556858	AY556727
Polyommatus ripartii ripartii	KC581746
Polyommatus ripartii ripartii	KC581747
Polyommatus ripartii ripartii	KC581748
Polyommatus ripartii ripartii	KC581749
Polyommatus ripartii ripartii	KC581750
Polyommatus ripartii ripartii	KC581751
Polyommatus ripartii ripartii	KC581752
Polyommatus ripartii pelopi 08D571	KY066723	KY081264
Polyommatus ripartii paralcestis	KC581715		rip_8
Polyommatus ripartii paralcestis	KC581716		rip_9
Polyommatus ripartii pelopi	AY557042		rip_10
Polyommatus ripartii pelopi 08D092	KY066713	KY081255	rip_12
Polyommatus ripartii pelopi 08D120	KY066714	KY081256	rip_13
Polyommatus ripartii pelopi 08D144	KY066715	KY085933	rip_14
Polyommatus ripartii pelopi PE 009	KY066696	KY081265	rip_82
Polyommatus ripartii ripartii	HM210164		rip_16
Polyommatus ripartii ripartii	HM210172
Polyommatus ripartii riparii	HM210163	HM210197
Polyommatus ripartii ripartii	AY556944	AY556603	rip_18
Polyommatus ripartii ripartii	KC581717		rip_19
Polyommatus ripartii ripartii	KC581718
Polyommatus ripartii ripartii	AY556957
Polyommatus ripartii ripartii	AY556962		rip_20
Polyommatus ripartii ripartii	EF104603		rip_21
Polyommatus ripartii ripartii	FJ663243		rip_22
Polyommatus ripartii ripartii	FJ663244		rip_23
Polyommatus ripartii ripartii	FJ663245
Polyommatus ripartii ripartii	FJ663246
Polyommatus ripartii ripartii	JN276883		rip_26
Polyommatus ripartii ripartii	GU675760
Polyommatus ripartii ripartii	GU676039		rip_27
Polyommatus ripartii ripartii	GU676152
Polyommatus ripartii ripartii	GU677012
Polyommatus ripartii ripartii	GU677029
Polyommatus ripartii ripartii	HM901559
Polyommatus ripartii ripartii	HM901664
Polyommatus ripartii ripartii	KC581736
Polyommatus ripartii ripartii	KC581737
Polyommatus ripartii ripartii	KC581738
Polyommatus ripartii ripartii	KC581739
Polyommatus ripartii ripartii	KC581740
Polyommatus ripartii ripartii	GU676158
Polyommatus ripartii ripartii	GU676213		rip_30
Polyommatus ripartii ripartii	KC617793		rip_31
Polyommatus ripartii ripartii	KC617794
Polyommatus ripartii ripartii	GU676220		rip_31
Polyommatus ripartii ripartii	HM210167		rip_35
Polyommatus ripartii ripartii	KC581741		rip_36
Polyommatus ripartii ripartii	KC581742
Polyommatus ripartii ripartii	KC581743
Polyommatus ripartii ripartii	HM210168
Polyommatus ripartii ripartii	KC581723		rip_37
Polyommatus ripartii ripartii	KC581724
Polyommatus ripartii ripartii	KC581725
Polyommatus ripartii ripartii	HM210171
Polyommatus ripartii ripartii	KC567885		rip_42
Polyommatus ripartii ripartii	KC581719
Polyommatus ripartii ripartii	KC567883
Polyommatus ripartii ripartii	KC567884		rip_43
Polyommatus ripartii ripartii	KC581720		rip_48
Polyommatus ripartii ripartii	KC581721		rip_49
Polyommatus ripartii ripartii	KC581722		rip_50
Polyommatus ripartii ripartii	KC581726		rip_54
Polyommatus ripartii ripartii	KC581727		rip_55
Polyommatus ripartii ripartii	KC581728
Polyommatus ripartii ripartii	KC581729		rip_57
Polyommatus ripartii ripartii	KC581730
Polyommatus ripartii ripartii	KC581731
Polyommatus ripartii ripartii	KC581732
Polyommatus ripartii ripartii	KC581733
Polyommatus ripartii ripartii	KC581734		rip_62
Polyommatus ripartii ripartii	KC581735
Polyommatus ripartii ripartii	KC581744		rip_72
Polyommatus rjabovianus rjabovianus	KR265475		rja_1
Polyommatus rjabovianus rjabovianus	KR265476
Polyommatus rjabovianus rjabovianus 2014A10
Polyommatus rjabovianus rjabovianus	KR265477
Polyommatus rjabovianus masul	KR265497		rja_4
Polyommatus rjabovianus masul	KR265485
Polyommatus rjabovianus masul	KR265498
Polyommatus rjabovianus masul	AY954006
Polyommatus rjabovianus masul	KR265499
Polyommatus rjabovianus rjabovianus	KR265478		rja_5
Polyommatus rjabovianus rjabovianus	AY954019
Polyommatus timfristos 08D205	KY066724	KY081278	tim_1
Polyommatus timfristos 08D247 Holotype	KY066725	KY081279	tim_2
Polyommatus timfristos 08D273	KY066728	KY081282
Polyommatus timfristos 08D274	KY066729	KY081283
Polyommatus timfristos 08D255	KY066726	KY081280
Polyommatus timfristos 08D258	KY066727	KY081281	tim_4
Polyommatus valiabadi	KR265495		val_1
Polyommatus valiabadi	KR265486
Polyommatus valiabadi	AY556934	AY556594
Polyommatus valiabadi	AY556882	AY556557
Polyommatus violetae subbaeticus	EF104604	HM210188	viol_1
Polyommatus violetae subbaeticus	HM210166	HM210187	viol_2
Polyommatus violetae violetae	HM210173	HM210200	viol_3
Polyommatus violetae violetae	HM210174	HM210201
Polyommatus violetae violetae	HM210175	HM210202	viol_5
Polyommatus yeranyani malyevi	KJ906515		ad_8
Polyommatus yeranyani yeranyani	KR265492		ad_9

Phylogenetic analysis

The analysis involved 221 sequences (169 GenBank sequences and 52 own material) and 117 sequences (66 GenBank and 51 own data).

Sequences of different length (from 415 to 657 bp in case of and from 415 to 440 bp in case of ) were included into the final dataset alignment. We used BioEdit 7.2.5 software (Hall 1999) to align the sequences and then edited them manually. The final alignment included 657 sites, with 137 variable sites and 112 parsimony-informative sites. The final alignment included 440 sites, with 52 variable sites and 22 parsimony-informative sites.

Previously, no significant conflict was detected between the mitochondrial and nuclear data sets (Vila et al. 2010). Thus, we combined mitochondrial and nuclear sequences to improve phylogenetic signal. This resulted in a concatenated alignment with a total of 1039 bp.

Phylogenetic relationships were inferred using Bayesian Inference (BI), maximum likelihood (ML) and maximum parsimony (MP) analyses. jModelTest was used to determine optimal substitution models for ML inference (Posada 2008).

Bayesian analyses were conducted using MrBayes, version 3.2 (Ronquist et al. 2012). Datasets were partitioned by codon position. Substitution models used for each partition were chosen according to jModelTest (Posada 2008): nst=2 and rates=invgamma for the first position, nst=2 and rates=gamma for the second position, and nst=6 and rates=gamma for the third position of barcodes. Substitution model nst=6 and rates=invgamm was chosen for . In evolution of sequences, the mono, bi- and mullti-nucleotide insertions/deletions are frequent and contain phylogenetically important information. To account for this, each indel event was coded as a binary character (1/0, presence/absence of the gap independently of its length) and PageBreakPageBreakPageBreakPageBreakPageBreakPageBreakthen used in the Bayesian analyses of and concatenated data sets. Two runs of 10 000 000 generations with four chains (one cold and three heated) were performed. Chains were sampled every 10 000 generations, and burn-in was determined based on inspection of log likelihood over time plots using TRACER, version 1.4 (available from http://beast.bio.ed.ac.uk/Tracer).

The ML trees were inferred using MEGA6 under the GTR+G+I model. MP analysis was performed using a heuristic search as implemented in MEGA6 (Tamura et al. 2013). A heuristic search was carried out using the close-neighbor-interchange algorithm with search level 3 (Nei and Kumar 2000) in which the initial trees were obtained with the random addition of sequences (100 replicates). We used nonparametric bootstrap values (Felsenstein 1985) to estimate branch support for ML and MP trees. The bootstrap consensus tree was inferred from 500 replicates.

Haplotype network

Median network was constructed using the program Network 4.6.1.3. (Fluxus Technology, fluxus-engineering.com), with the Median Joining algorithm (Bandelt 1999). The algorithm picks close haplotype groups and finds hypothetical ancestors, to join the haplotypes in a common parsimony network. The program shows each haplotype with a colored circle. When the haplotypes are identical, they are united in one bigger circle under one name. Similar haplotypes then are combined in haplogroups (Table 2). The network was constructed on the base of alignment, with 191 sequences. The length of the sequences was 612 bp with 116 parsimony-informative sites. The final alignment included only sequences of equal length. Short and ambiguous sequences were excluded.

Karyotypes of the studied samples

Table 3

Table 3.

Chromosome numbers of the studied samples.

Code	Species	Chomosome number	Country	Locality	Elevation	Date
LR08D109	Polyommatus admetus	n=80	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E	812m	2008.VII.17
LR08D211	Polyommatus admetus	n=80	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D386	Polyommatus admetus	n=caca80	Greece	Smolikas Mt, Pades, 40°03.175'N; 20°53.941'E	1497m	2008.VII.22
LR08D655	Polyommatus admetus	n=ca80	Bulgaria	Dragoman, 42°56.320'N; 22°56.038'E	753m	2008.VII.29
LR08D085	Polyommatus ripartii pelopi	2n=ca180	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E	812m	2008.VII.16
LR08D092	Polyommatus ripartii pelopi	n=90	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E	812m	2008.VII.16
LR08D120	Polyommatus ripartii pelopi	2n=ca180	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°02.097'N; 22°07.085'E	812m	2008.VII.17
LR08D144	Polyommatus ripartii pelopi	n=90	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°01.617'N; 22°13.411'E	1610–1700m	2008.VII.17
LR08D145	Polyommatus ripartii pelopi	n=90	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°01.617'N; 22°13.411'E	1610–1700m	2008.VII.17
LR08D249	Polyommatus ripartii pelopi	n=90	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D252	Polyommatus ripartii pelopi	n=ca90	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D257	Polyommatus ripartii pelopi	n=90	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D260	Polyommatus ripartii pelopi	2n=ca180	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D291	Polyommatus ripartii pelopi	n=ca90	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D549	Polyommatus ripartii pelopi	n=ca90	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D571	Polyommatus ripartii pelopi	n=90	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D562	Polyommatus ripartii pelopi	n=90	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D471	Polyommatus nephohiptamenos	n=90	Greece (North)	Granitis, 41°17.543'N; 23°56.265'E	830m	2008.VII.23
LR08D483	Polyommatus nephohiptamenos	n=ca90	Greece (Northern)	Falakro Mt, 41°13.485'N; 24°02.990'E	1646m	2008.VII.23
LR08D485	Polyommatus nephohiptamenos	n=ca90	Greece (North)	Falakro Mt, 41°13.485'N; 24°02.990'E	1646m	2008.VII.23
LR08D494	Polyommatus nephohiptamenos	n=90	Greece (North)	Falakro Mt, 41°13.485'N; 24°02.990'E	1450–1750m	2008.VII.24
LR08D496	Polyommatus nephohiptamenos	n=ca90	Greece (North)	Falakro Mt, 41°13.485'N; 24°02.990'E	1450–1750m	2008.VII.24
LR08D498	Polyommatus nephohiptamenos	n=ca90	Greece (North)	Falakro Mt, 41°13.485'N; 24°02.990'E	1450–1750m	2008.VII.24
LR08D102	Polyommatus aroaniensis	n=47	Greece (South)	Mt. Chelmos (Aroania), Kalavrita, 38°00.699'N; 22°11.554'E	1640m	2008.VII.16
LR08D247 Holotype	Polyommatus timfristos	n=38	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D255	Polyommatus timfristos	n=38	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D258	Polyommatus timfristos	n=38	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D273	Polyommatus timfristos	n=38	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D274	Polyommatus timfristos	n=38	Greece (Central)	Timfristos Mt, Karpenisi, 38°55.460'N; 21°47.605'E	1267m	2008.VII.20
LR08D205	Polyommatus timfristos	n=38	Greece (Central)	Parnassos Mt, 38°33.311'N; 22°34.300'E	1750m	2008.VII.19
LR08D545	Polyommatus orphicus orphicus	n=ca41–42	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D546	Polyommatus orphicus orphicus	n=ca41–42	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D560	Polyommatus orphicus orphicus	n=41, n=42	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D561	Polyommatus orphicus orphicus	n=41, n=42	Bulgaria	Rodopi Mts, Hvoyna, 41°15'N; 24°32'E	800m	2008.VII.26
LR08D431	Polyommatus orphicus eleniae	n=42	Greece (North)	Granitis, 41°17.543'N; 23°56.265'E	830m	2008.VII.23
LR08D433	Polyommatus orphicus eleniae	n=41, n=42	Greece (North)	Granitis, 41°17.543'N; 23°56.265'E	830m	2008.VII.23
LR08D434	Polyommatus orphicus eleniae	n=ca42	Greece (North)	Granitis, 41°17.543'N; 23°56.265'E	830m	2008.VII.23
LR08D437	Polyommatus orphicus eleniae	n=ca42	Greece (North)	Granitis, 41°17.543'N; 23°56.265'E	830m	2008.VII.23

Fig. 3a–c

Figure 3.

karyotypes. Bar =10 µ. a–b , sample LR08D109, Greece, MI, n=80. One large bivalent in the centre of the plate can be seen c , sample LR08D109, Greece, MII, n=80. One large chromosome in the centre of the plate can be seen d , sample LR08D249, Greece, MI, n=90. Two large bivalents in the centre of the plate can be seen e , sample LR08D144, Greece, MI, n=90. Two large bivalents in the centre of the plate can be seen f , sample LR08D145, Greece, MI, n=90. Two large bivalents in the centre of the plate can be seen g , sample LR08D92, Greece, MII, n=90. Two large chromosomes in the centre of the plate can be seen h , sample LR08D494, Northern Greece, MI, n=90. All the bivalents are situated in a plane with the largest elements in the centre of the circular metaphase plate. Bivalents are clearly separated from each other by gaps. Two bivalents are larger than the rest. i , sample LR08D102, Greece, MI, n=47.

The haploid chromosome number n=80 was found in MI and MII cells of two studied individuals from South and Central Greece. In two specimens (Greece, Smolikas Mt and Bulgaria) we counted approximately n=ca80 at MI. The last count was performed with an approximation due to the overlapping of some bivalents. The karyotype displayed one larger bivalent in the centre of the MI plate and one larger univalent in the centre of the MII plate.

Fig. 3d–g

The haploid chromosome number was determined to be n=90 in MI and MII cells of seven studied individuals from different localities (Greece, Bulgaria). At MI, two bivalents were especially large and were situated in the centre of the metaphase plates. Bivalent 1 was 1.4–1.6 times larger than bivalent 2. The sizes of the remaining 88 bivalents decreased more or less linearly. At MII, two univalents were especially large and were situated in the centre of the metaphase plates. Chromosome 1 was 1.4–1.6 times larger than chromosome 2. The sizes of the remaining 88 chromosomes decreased more or less linearly. In three specimens we counted approximately n=ca 90 at MI. The last count was an approximation due to the overlapping of some bivalents. In three specimens, the diploid chromosome number was estimated as 2n=ca180 in male asynaptic meiosis.

Fig. 3h

The haploid chromosome number was determined to be n=90 in MI and MII cells of two studied individuals. At MI, two bivalents (one big and one medium-sized) were larger than the others. At MII, two univalents (one big and one medium-sized) were larger than the rest. The sizes of the remaining 88 bivalents and univalents decreased more or less linearly. In four specimens we counted approximately n=ca90 at MI. The last count was an approximation due to the overlapping of some bivalents.

Fig. 3i

In the single studied specimen collected in the type locality (Greece, Mt. Chelmos) haploid chromosome number n=47 was found in MI cells. Bivalents were fairly well PageBreakPageBreakPageBreakdifferentiated with respect to their size. However, it was difficult to subdivide them objectively into size groups because the sizes of the 47 bivalents decrease more or less linearly.

Lukhtanov, Vishnevskaya & Shapoval, sp. n.

Figs 4a–h, 5a–d

Figure 4.

karyotypes. Bar = 10 µ. a , sample LR08D205, Central Greece, Parnassos, first prometaphase of meiosis, n=38 b , sample LR08D205, Central Greece, Parnassos, MI, n=38 c , holotype, sample LR08D247, Central Greece, Timfristos, MI, n=38 d , sample LR08D255, Central Greece, Timfristos, MI, n=38 e , sample LR08D258, Central Greece, Timfristos, MI, n=38 f , sample LR08D258, Central Greece, Timfristos, MI, n=38 g , sample LR08D273, Central Greece, Timfristos, MI, n=38 h , sample LR08D274, Central Greece, Timfristos, MII, n=38.

Figure 5.

karyotypes. Bar = 10 µ. a , sample LR08D205, Central Greece, Parnassos, MII, n=38 b , sample LR08D205, Central Greece, Parnassos, MII, n=38 c , sample LR08D205, Central Greece, Parnassos, MII, n=38 d , sample LR08D258, Central Greece, Timfristos, MII, n=38 e , sample LR08D433, Northern Greece, MI, n=41 f , sample LR08D431, Northern Greece, MI, n=42 g , sample LR08D431, Northern Greece, MI, n=ca42 h , sample LR08D437, Northern Greece, MII, n=41 i , sample LR08D437, Northern Greece, MII, n=41 j , sample LR08D431, Northern Greece, MII, n=42.

The haploid chromosome number was determined to be n=38 in prometaphase, MI and MII cells of the holotype and six studied paratypes. Bivalents at MI and prometaphase and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the 47 elements decrease more or less linearly.

Two different haploid chromosome numbers (n=41 and n=42) were observed in MI and MII cells of the four specimens studied. This variation was most likely caused by polymorphism for one chromosome fussion/fission. This polymorphism resulted in three types of MI karyotype: n=41 (homozygous for chromosomal fusion/fission, one pair of fused chromosomes), n=42 (homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes) and n=41 (heterozygous for chromosomal fusion/fission, 40 bivalents and one trivalent). Bivalents at MI and univalents at MII were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly.

Fig. 5e–j

Chromosome numbers (n=41 and n=42) were observed in MI and MII cells of the four specimens studied. This variation was most likely caused by polymorphism for one chromosome fussion/fission. This polymorphism resulted in three types of MI karyotype: n=41 (homozygous for chromosomal fusion/fission, one pair of fused chromosomes), n=42 (homozygous for chromosomal fusion/fission, two pairs of unfused chromosomes) and n=41 (heterozygous for chromosomal fusion/fission, 40 bivalents and one trivalent). Bivalents and univalents were fairly well differentiated with respect to their size; however, it was difficult to subdivide them objectively into size groups because the sizes of the elements decrease more or less linearly.

Phylogenetic reconstruction

Bayesian analysis of the 657-bp region of gene resulted in a phylogram, showing a high level of posterior probability for the majority of the revealed clades. Analysis of PageBreakthe 221-specimen dataset recovered the and species groups as distinct monophyletic lineages. This is consistent with the previous conclusions (Wiemers 2003, Kandul et al. 2004, 2007, Lukhtanov et al. 2005, 2015, Vila et al. 2010, Dincă et al. 2013a). The tree divided into two parts ( and groups) is shown in Figures 6–8.

Figure 6.

Fragment of the Bayesian tree of and complexes based on analysis of barcodes and focused on , and . clade is not shown in details, for its composition see Lukhtanov et al. (2015a). The West-European and the “mixed” (Eurasian) clades of are shown in Fig. 7. group is shown in Fig. 8. Numbers at nodes indicate Bayesian posterior probability.

Figure 8.

Fragment of the Bayesian tree based on analysis of barcodes and focused on details of the group. and clades are not shown in details, for their composition see Lukhtanov et al. (2015a). Numbers at nodes indicate Bayesian posterior probability.

Figure 7.

Fragment of the Bayesian tree of and complexes based on analysis of barcodes and focused on details of the West-European and the “mixed” (Eurasian) clades of . Numbers at nodes indicate Bayesian posterior probability.

Within the group, the species appeared as a polyphyletic assemblage consisting of four monophyletic lineages: the “Balkan” clade, including specimens from Greece and Bulgaria, “West-European” clade, including butterflies from France, Italy and Spain, “mixed” (or Eurasian) clade, including butterflies distributed from Spain to Mongolia, and Turkish-Transcaucasian clade, including butterflies from Turkey and Armenia. The last clade formed an independent lineage, sister to the species (Pfeiffer, 1938) from east Turkey, Transcaususus and Iran.

sensu auctorum formed two independent clades: one consisting of European and west Turkish specimens and another consisting of specimens from east Turkey, Armenia and Azerbaijan. appeared on the Bayesian tree as a paraphyletic group consisting of nine weakly differentiated individuals. On the PageBreakMP and ML trees (Figs 18 and 21 in Appendix 2), tended to form a monophyletic clade, but the bootstrap support of this clade was very low.

Figure 18.

Fragment of the ML tree of and complexes based on analysis of barcodes and focused on , and . clade is not shown in details, for its composition see Lukhtanov et al. (2015a). Details of the West-European and the “mixed” (Eurasian) clades of are shown in Fig. 19. Details of the group are shown in Fig. 20. Numbers at nodes indicate bootstrap support.

Figure 21.

Fragment of the MP tree of and complexes based on analysis of barcodes and focused on , and . clade is not shown in details, for its composition see Lukhtanov et al. (2015a). The West-European and the “mixed” (Eurasian) clades of are shown in Fig. 22. group is shown in Fig. 23. Numbers at nodes indicate bootstrap support.

The group is interesting for its Balkan species position. formed an independent clade separate from sp. n., which formed a monophyletic clade as well. Specimens of and were closely related and formed together a paraphyletic cluster.

Because of low variability, it was difficult to use as a single marker to construct the phylogeny of . Therefore, we decided to combine the sequence PageBreakPageBreakPageBreakdata on and and constructed a tree on the base of these two markers (Fig. 9). We used 75 specimens for which we had data on both markers. Total length of the combined sequence was 1039 bp. The Bayesian tree constructed on the base of the concatenated alignment revealed generally the same topology as in the case of tree, however with a higher support for few clades, and + formed a monophyletic clade with a posterior probability value 77.

Figure 9.

Bayesian tree of and complexes based on analysis of concatenated alignment (+). Numbers at nodes indicate Bayesian posterior probability

Haplotype network analysis

The complicated relationships between species of and groups were also reflected by a haplotype network (Figs 10 and 11) constructed on the base of . PageBreakTo construct the network we used 191 specimens that were collapsed in 96 haplotypes representing 26 haplogroups (Table 2): 10 haplogroups for group and 16 haplogroups for group.

Figure 10.

Haplotype network of species group. Colored circles represent different taxa. Each line segment represents a mutation step, and white small circles represent “missing” haplotypes.

Figure 11.

Haplotype network of species group. Colored circles represent different taxa. Each line segment represents a mutation step, and white small circles represent “missing” haplotypes.

was represented by 82 specimens divided in 38 haplotypes and four haplogroups which corresponded completely with the four clades revealed on the Bayesian tree (Fig. 10). sensu auctorum was found to include two haplogroups. One haplogroup was represented by specimens from the Balkan and west Turkey (), and the other haplogroup was represented by specimens from Armenia and Azerbaijan ( + ). These two haplogoups were clearly distinct from one another as can be seen in the number of PageBreaknucleotide substitutions between them. was represented by a distinct haplogroup most close to haplogroup.

As a by-product of our study, we also discovered that within our samples comprised two haplogroups. One haplogroup was represented by specimens of , whilst the other was represented by . PageBreak was represented by a single differentiated haplogroup. A distinct haplogroup represented by a single haplotype was found within .

Concerning group (Fig. 11) we would like to mention that all recognized species, except for and , were represented by clearly distinct haplogroups. and were closely related and even shared one haplotype, despite clear differences in butterfly wing color and karyotypes.

Haplotypes of our target taxa (, sp. n., and ) formed together a single cluster. However, all these taxa were distinct, and they did not share any common haplotypes. Therefore, this cluster could be subdivided into four haplogroups: ar (), tim (), orph () and hum () (Table 2, Fig. 11).

Despite presumed conspecifity (Kolev 2005), and were found to be in the opposite parts of the recovered net, being separated by a number of other species (, , , ). The chromosomally distinct taxa and were found to be also distinct with respect to their haplotypes. These two taxa were already treated as different species by Wiemers et al. (2009).

Butterfly morphology

One of the main characteristic features of the anomalous blue butterflies is the upperside wing color. All males and females have brown upper side of the wings, and therefore the group is also called “brown” complex. As for the underside (Fig. 12), there are some differentiated characters of the wing pattern that allow the defining of seven morphological types.

Figure 12.

collected in the type locality (Bulgaria, Hvoyna, 3 July 2016). Photo by E. Pazhenkova. White postdiscal streak between discal spot and submarginal marking on the forewing underside (character 1), prominent white streak on the hindwing underside (character 2) and additional white short streak between postdiscal and submarginal areas of the hind wing underside (character 3) are shown.

type: hindwing underside with well-developed white streak (character 2 in Fig. 12), spots are small or medium-sized, marginal marking is reduced. This type is found in different species of both and complexes, e.g. in (Fig. 13g), (Fig. 13j), (Fig. 14e), (Figs 15a, f, g, h, j, k, 16a, b, c) and (Fig. 16e, h).

Figure 13.

The coloration and wing pattern of , and . The letters correspond to the following sample numbers: a LR-08-D109 upperside and underside b LR-08-386 c LR-08-655 d LR-08-211 e LR-08-433 upperside and underside f LR-08-434 g LR-08-437 h LR-08-545 i LR-08-546 j LR-08-560. Scale bar corresponds to 10 mm in all figures.

Figure 14.

The coloration and wing pattern of , and . The letters correspond to the following sample numbers: a LR-08-D561 b LR-08-431 c LR-08-483 upperside and underside d LR-08-496 e LR-08-498 f LR-08-499 upperside and underside g LR-08-485 upperside and underside h LR-08-494 upperside and underside, white postdiscal streak between discal spot and submarginal marking on the forewing underside is shown by arrow. Bar = 10 mm.

Figure 15.

The coloration and wing pattern of . The letters correspond to the following sample numbers: a LR-08-D257 upperside and underside b LR-08-471 c LR-08-085 d LR-08-092 e LR-08-120 f LR-08-144 g LR-08-145 h LR-08-249 i LR-08-252 j LR-08-260 k LR-08-291. Bar = 10 mm.

Figure 16.

The coloration and wing pattern of , sp. n. and . The letters correspond to the following sample numbers: a LR-08-D549 b LR-08-551 c LR-08-571 d LR-08-273 e LR-08-205 f LR-08-274 upperside and underside g LR-08-258 h LR-08-247 (Holotype) i LR-08-255 j LR-08-102 upperside and underside. White postdiscal streak between discal spot and submarginal marking on the forewing underside is shown by arrow. Bar = 10 mm.

type: the wing underside with exaggerated spots, white streak on the hindwing underside is clearly visible and sharp. This type is found in , and from Iran and Azerbaijan (Lukhtanov et al. 2015). This type is not found in European species.

type: the hindwing has no white streak, marginal marking is very well pronounced. This type is found in (Fig. 13a, b, c, d).

type: White streak is well pronounced and very broad on the hindwing, consisting of the main streak and an additional short streak between postdiscal and submarginal areas, just under the main streak. This type is common in (Fig. 14c, d, f, g, h), not rare in (Fig. 15b,d,i) and also found in (Fig. 14a) and (Fig. 16g).

type: no white streak on the hindwing, marginal marking is pale. This type is quite common in , (Fig. 16f) and (Fig. 14b). It is typical for some populations of from West Europe (Vila et al. 2010) (but not from the Balkan Peninsula).

type: the white streak on the hindwing underside demonstrates different level of reduction. This type is found in (Fig. 16j), (Fig. 16d, e, i), (Fig. 14h, i) and (Fig. 13e, g). It is also found in the population of from the Crimea (Vila et al. 2010) (but not from the Balkan Peninsula).

type: forewing underside with clear white postdiscal streak between discal spot and submarginal marking, white streak on hindwing underside is prominent, often with additional small white streak (Fig. 12). This type is common in (Fig. 14a); nevertheless, the most characteristic feature (the white postdiscal streak between discal spot and submarginal marking on the forewing underside) can be found in other species, e.g. (Fig. 16j) and (Fig. 14h).

Species level monophyly, paraphyly and polyphyly

The studied taxa were found to demonstrate a relatively low level of and differentiation in terms of genetic distances between species and numbers of evolutionary steps between the taxa on haplotype network (Figs 10 and 11). This result is not unexpected in light of our previous knowledge of this group (Wiemers and Fiedler 2007).

The low genetic differentiantion results in relatively low support for some recovered clades (e.g. for , Figs 8 and 9) and in non-monophyly of some taxa (, ) with respect to gene or to combination of and . Species-level non-monophyly in DNA barcode gene trees can have multiple explanations (Mutanen et al. 2016). In our case, combination of low interspecific differentiation with low level of intraspecific variation indicates that preservation of ancestral polymorphism and incomplete lineage sorting (rather than interspecific hybridization) is the most likely mechanism explaining the pattern observed. This finding is also in agreement with the previous conclusion that the subgenus itself and its species represent young evolutionary entities (Kandul et al. 2004). We should also stress that despite the obvious paraphyly, the taxa and are distinct with respect to the barcodes, and this can be seen on both Bayesian tree (Figs 6–8) and haplotype network (Figs 10 and 11).

An entirely different situation was found in and sensu auctorum. In these taxa polyphyly in trees arises as a result of deep intraspecific divergence. There are two theoretically possible explanations for this kind of non-monophyly. First, each taxon can be a mix of unrecognized multiple species (Dincă et al. 2011, 2013b). Second, a profound irregularity in barcodes can be caused by reasons other than speciation resulting in extraordinary intra-specific barcode variability (Pazhenkova and Lukhtanov 2016). Among these reasons, interspecific mitochondrial introgression (Lukhtanov et al. 2015b) and blending of deeply diverged mitochondrial lineages which evolved in allopatry in different Pleistocene refugia (Pazhenkova and Lukhtanov 2016) are most likely ones. The first explanation could be applied to sensu auctorum which most probably comprises two allopatric species, sensu stricto and (see the section Taxonomy below). The situation with sensu lato seems to be much more complicated. A combination of the first and the second explanations could be applied to sensu lato, and West-European and Eurasian clades could represent sympatric (parapatric?) intraspecific lineages (Dinca et al. 2013) whereas Turkish-Transcaucasian clade could represent an allopatric species. Additioanl studies are required to solve this problem.

Chromosomal diversity

The chromosome number of was first established by H. de Lesse who discovered n=80 in populations from Bulgaria (Kalotina) and W Turkey, and n=78-80 (with PageBreakpredominance of n=79) in populations from the eastern part of Turkey (de Lesse 1960a,b). The last count (n=78-80 with predominance of n=79) was later confirmed for populations from Armenia (Lukhtanov and Dantchenko 2002a), Turkey and Azerbaijan (Dantchenko and Lukhtanov 2005, Lukhtanov et al. 2015a). Here we confirm the haploid chromosome number n=80 for Dragoman near Kalotina (Bulgaria) and demonstrate that this karyotype occurs in other localities in Greece. The karyotype of the European samples (with predominance of n=80) seems to be similar, but not completely identical to the karyotype of samples from east Turkey, Armenia and Azerbaijan (with predominance of n=79).

This transpalearctic species has been known to have a stable karyotype (n=90, including one large, one medium and 88 small elements) throughout its whole distribution range from Spain in the west to the Altai in the east (de Lesse 1960a,b, Kandul 1997, Lukhtanov and Datchenko 2002, Vila et al. 2010, Vershinina and Lukhtanov 2010, Przybyłowicz et al. 2014). The number n=90 was also found in (Coutsis et al. 1999), and we confirmed this count for samples from South and Central Greece and from Bulgaria.

The haploid chromosome number was erroneously given for this taxon as n=8-11 by Brown and Coutsis (1978), and later corrected by Coutsis and De Prins (2007) who established the chromosome number with an approximation due bivalents overlaps as n=ca84-88. Here we were able to make a precise count of chromosome elements in this taxon and to demonstrate that n=90, exactly as in . We do not confirm the proposed difference between and in number of large chromosomes (Coutsis and De Prins 2007). In our squash preparations, both species demonstrate one big and one medium-sized element in the haploid chromosome set.

The haploid chromosome number for this taxon was erroneously given as n=15-16 by Brown (1976a), and later corrected to be n=48 in few studied metaphase plates by Coutsis et al. (1999). In the single studied sample we were able to make a precise count of chromosome elements and found the haploid chromosome number to be n=47. Both counts (previous n=48 and n=47 in this study), are essentially different from those found in closely related and (Kolev 2005, this work) and (Troiano et al. 1979, Vila et al. 2010).

and

The chromosome number of was first established by Kolev (2005) who discovered n=41-42 in population from Hvoyna (Bulgaria), thus, similar to the karyotype found in from remote east Turkey (Lukhtanov et al. 2003).

The chromosome number of was established first by Coutsis and De Prins (2005) who discovered n=41 in population from Falakro Mt near Granitis (Greece). Coutsis and De Prins reported that despite identical chromosome number, karyotypes of and were different in respect to their structure. Karyotype of was reported to be more asymmetrical than karyotype of (that is, the chromosomes were more differentiated with respect to their size).

Here we reinvestigated the karyotypes of and originating directly from their type-localities. Our data confirm previous chromosome number counts, but do not confirm the differences in karyotype structures. In our opinion, the presumed differences could appear because of differences in staining techniques used by Kolev (2005) for and Coutsis and De Prins (2005) for (see Wiemers and De Prins 2004). In our study, we used the same technique for both taxa, and we did not find any differences in the karyotype structure.

The haploid chromosome number of this taxon is established first here as n=38 and thus differs by at least three fixed chromosome fussions/fixions from and (n=41-42). This number is similar (but not identical) to that found in (n=39, Vila et al. 2010). We are not sure that the karyotypes of and are related in their origin because they are not found in proximity and separated by an area where with n=41–42 is distributed.

Taxonomy

The Balkan and west Turkish populations of have a unique hindwing underside pattern ( type, Fig. 13a, b, c, d) and can be easily separated on the basis of morphology from other species. However, some taxonomic and identification problems appear if oriental populations of sensu lato are considered. In 2004, from Armenia and from Azerbaijan were described (Dantchenko and Lukhtanov 2005). The two last taxa differ from the nominative subspecies morphologically. They usually have a distinct white streak on the underside of the hindwing, and the marginal pattern of the wing underside is not as prominent as in . In fact, and are phenotypically similar to and , and their identification is not always easy. Karyological analysis revealed a minor difference between the western and oriental forms (see above), and molecular analysis demonstrated that they were differentiated with respect to barcodes and did not constitute together a monophyletic entity. This barcode distinctness is especially clearly expressed in the haplotype network (Fig. 10). Therefore, in accordance with the criterion of avoiding non-monophyletic groups in taxonomy (Vila et al. 2013), they should be treated as distinct species and .

The distribution of haplotypes in demonstrates a very complex picture. This taxon is represented by several clades on the phylogenetic reconstructions. The West-European clade includes butterflies from France, Italy and Spain. Another clade (a “mixed”, or Eurasian clade) includes butterflies from the whole Western Palaearctic region from Spain to Mongolia. Eastern Turkish-Caucasian clade () is strongly differentiated and appears as a group close to . Complicated taxonomy and phylogeography of have recently been topics of several specific studies and publications (Vila et al. 2010, Vodolazhsky et al. 2011, Dincă et al. 2013a, Przybyłowicz et al. 2014) and are out of the focus of the present paper. The sequences obtained in our study confirm that Balkan samples represent one of the major clades within populations, thus is confirmed as a valid subspecies.

Taxonomic interpretation of this local Balkan endemic is difficult since it is morphologically very similar and chromosomally seems to be identical to the close species . However, distinct barcodes in combination with ecological differentiation ( is a high altitude species, whereas can be found usually at middle and low elevations) do not allow us to reject the pre-existing taxonomic hypotheis that represents a distinct taxonomic entity. The fact that retains its homogeneity with respect to being surrounded by closely related is additional indirect evidence for a presence of genetic boundaries between them. Further molecular and genetic studies are required to understand the real taxonomic status of .

was described (Kolev 2005) and later considered (Tshikolovets 2011, Eckweiler and Bozano 2016) as a subspecies of , a species known from east Turkey, because and shared a similar phenotype and number of chromosomes (Lukhtanov et al. 2003, Kolev 2005). At times, has been considered as a distinct species (e.g. Van Swaay et al. 2010); however, its species level status was not justified.

Our molecular data demonstrate that, despite similarity in number of chromosomes, and are not closely related as was previously thought. In the haplotype network, these taxa were found to be placed in the opposite parts of the recovered net, being separated by a number of other species (Fig. 11). Their merging would result in a polyphyletic assemblage (Fig. 8). Avoiding non-monophyletic groups is a preferable option in practical taxonomy (Talavera et al. 2013a). Therefore, and should be considered as two distinct species. We should also note that the barcodes alone (as in our study) can provide PageBreakweak evidence for monophyly or non-monophyly of taxa since trees inferred from single markers sometimes display relationships that reflect the evolutionary histories of individual genes rather than of the species being studied. In case of , barcodes showing such a discrepancy between species and gene trees may be a result of interspecific mitochondrial introgression (Lukhtanov et al. 2008, 2015b). Despite this limitation, we argue that monophyletic clusters resulting from the DNA barcode analysis are better primary taxonomic hypotheses than para- or polyphyletic ones (Lukhtanov et al. 2016).

was described from a place located 80 km south-west from the type locality of . and have the same number of chromosomes, but it was supposed that they were different in karyotype structure (Coutsis and De Prins 2005). Additionally, it was supposed that differed from by the constant lack of a white postdiscal streak on the forewing underside (character 1 on Fig. 12) and by strong reduction or total lacking of a white streak on the hindwing underside (character 2 on Fig. 12) (Coutsis and De Prins 2005). In these streaks are supposed to be always sharply defined (Kolev 2005). Our study does not support the difference in karyotypes (see above). Our analyses showed that the supposed differences in morphology disappeared if individual variations were taken into account. Although the “typical” phenotype of (Figs 12 and 14a) often present in in Hvoyna, the individuals with different level of reduction of white streak on both fore- and hindwing underside are very common (Fig. 13h, i, j). These individuals with confidence can be identified as as they have the same karyotype and do not differ in mitochondrial haplotypes. Thus, the morphological difference between individuals from Hvoyna () and Falakro Mt () is not clear and is not based on fixed characters. The difference in karyotypes was also not confirmed in our analysis (see the section Chromosomal diversity above). Therefore, we conclude that the population from Falakro Mt is most probably conspecific with and can be treated as a subspecies .

This taxon was first described by Brown (1976a) as a subspecies of and two years later was raised to species rank (Brown and Coutsis 1978). Despite its similarity to other taxa of the brown complex, especially with , and , it differs by its karyotype and barcodes. Its species distinctness confirmed by chromosomal analysis (Coutsis et al. 1999) has never been questioned. Thus, there has been no problem with treatment of as a separate species. However, there are numerous identification problems associated with because several populations from Central and Northern Greece, as well as from other countries of the Balkan Peninsula were identified as (see the section Distribution areas below), but their karyotypes were not studied. In our work, we discovered that two of these populations (from Timfristos Mt and Parnassos Mt) represented a previously unrecognized species. Below we name it and provide its formal description.

Lukhtanov, Vishnevskaya & Shapoval sp. n.

http://zoobank.org/58B77480-1FD0-423B-8FF9-BF39E79F177C

Holotype

(Fig. 16h). male, field code LR-08-247, GenBank accession number KY066725 for and KY081279 for ; Greece, Timfristos Mt, Karpenisi, , 1270 m, 20 July 2008, V.A. Lukhtanov and N.A. Shapoval leg., deposited in Zoological Institute of the Russian Academy of Science (St. Petersburg).

, 657 base pairs.

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTAAGAATTTTAATTCGTATGGAATTAAGAACTCCTGGATCCTTAATTGGAAATGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCCTTAATATTAGGAGCACCTGATATAGCTTTTCCACGATTAAATAATATGAGATTTTGATTATTACCGCCATCATTAATACTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCACATGGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAGCGGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTGGGAATTACAGCATTATTATTACTTTTATCATTGCCTGTATTAGCTGGGGCAATTACCATATTATTAACAGATCGAAATCTTAATACCTCATTCTTTGACCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Haploid chromosome number of the holotype n=38 (Fig. 4c).

Paratypes.

Four males, field codes LR-08-255, LR-08-258, LR-08-273, LR-08-274, forewing length 17–18 mm, the same data as holotype. Male: field code LR-08-205, Greece, Parnassos, , 1750 m, 19 July 2008, V.A. Lukhtanov and N.A.Shapoval leg. Five females: forewing length 15–16 mm; Greece, Timfristos Mt, Karpenisi, , 1490 m, 21 July 2008, V.A. Lukhtanov and N.A. Shapoval leg. Two females: forewing length 14.5–15.5 mm; Greece, Parnassos, , 1750 m, 19 July 2008, V.A. Lukhtanov and N.A. Shapoval leg.. All paratypes are deposited in Zoological Institute of the Russian Academy of Science (St. Petersburg).

Males

(Fig. 16d–i). Forewing length 16.2–18.2 mm. Upperside: ground color completely brown. Discoidal, submarginal and antemarginal marking absent on both fore- and hindwings. Forewings with a developed sex brand and scaletuft. Fringe brown as ground color.

Underside: ground color light brown with yellowish coffee-milk tint. Greenish blue basal suffusion very slight, nearly lacking. One basal black spot is present only on hindwings. Discoidal black spot is present on the forewings, but can be slightly seen on the hindwings (absent or vestigial). Postdiscal black ocelli are encircled by a whitish border. They are prominent on the forewings, forming a strongly curved row. Postdiscal black ocelli on the hindwing small. Submarginal and antemarginal markPageBreaking is absent on the forewings, and absent or vestigial on the hindwings. White streak on hindwings clearly visible. In one specimen the white streak is vestigial, in one the white streak is almost absent (can be slightly distinguished), and in one specimen there is an additional short streak between postdiscal and submarginal areas of the wing, straight under the main white streak. Fringe brown, slightly darker than the underside ground color.

Genitalia: the male genitalia have a structure typical for other species of the subgenus (Coutsis, 1986).

Females

(Fig. 17a–g). Forewing length 15.8–17.5 mm.Upperside: ground color as in males, but lighter dark brown and without sex brand and scaletuft. Fringe greyish brown. Underside: ground color and general design as in males but fringes lighter-colored. Greenish blue basal suffusion almost invisible. White streak on hindwing underside is present in all paratypes and demonstrates a variable level of reduction.

Figure 17.

Paratypes of sp. n. (females). a, b samples from Parnassos Mt c–g samples from Timfristos Mt.

Diagnosis.

(n=38) differs by at least three fixed chromosome fusions/fissions from the most closely related and allopatric and (n=41-42). (n=38) differs by at least nine fixed chromosome fusions/fissions from allopatric (n=47). From the closely related and , differs also by a number of nucleotide substitutions within the studied 657-bp fragment of the mitochondrial gene.

The chromosome number in (n=38) is similar (but not identical) to that found in (n=39, Vila et al. 2010). However, we are not sure that these karyotypes are related in their origin because they are not found in proximity and separated by an area where with n=41-42 is distributed. With respect to barcodes, the pair / is more differentiated than pairs / and /.

From sympatric and syntopic the new species can usually be distinguished by the absence of submarginal marking and strong reduction of greenish blue basal suffusion. These characteristics are usually (but not always) better expressed in specimens. In doubtful cases, the separation is only possible on the base of chromosomal and molecular markers since these species are different: the chromosome number of is n=90; they also have fixed differences in 33 positions within the studied 657-bp fragment of gene.

Ecology.

sp. n. inhabits xerothermic and xeromontane localities and dry meadows from 1200 to 1800 m altitude (Figs 32–35). It was found in complete syntopy with and .

Figure 32.

Habitat of . Central Greece, Mt. Timfristos, near Karpenisi, 1200 m, 20 July 2008. Photo by V.A. Lukhtanov.

Figure 35.

Habitat of . Central Greece, Mt. Parnassos, 19 July 2008. Photo by V.A. Lukhtanov.

Etymology.

Timfristos is a mountain in the eastern part of Evrytania and the western part of Phthiotis in Central Greece. The name is a noun.

Distribution areas

Figs 24–26

Figure 24.

Habitat of . Greece, Peloponnesse Peninsula, Mt. Chelmos, near Kalavrita, 800 m, 16 july 2008. Photo by V.A. Lukhtanov.

Figure 26.

Habitat of . W Bulgaria, near Dragoman, 700 m, 29 July 2008. Photo by V.A. Lukhtanov.

This species is widespread in the Balkan Peninsula. It is local in the northern part of Hungary (Ilonczai and Bálint 2001, Bálint et al. 2006) and recorded in Slovakia (Kulfan and Kulfan 1992, Eckweiler and Bozano 2016). It has been shown to be widely distributed in the western part of Romania, but no exact localities were provided (Eckweiler and Bozano 2016). It is common in Greece and found in Croatia, Bosnia and Herzegovina, Montenegro, Serbia, Bulgaria, The Republic of Macedonia, Albania and European Turkey (Sijaric and Mihljevic 1972, Hesselbarth et al. 1995, Abadjiev 2001, Tolman and Lewington 2008, Eckweiler and Bozano 2016).

Fig. 27

Figure 27.

Habitat of . Greece, Peloponnesse Peninsula, Mt. Chelmos, near Kalavrita, 800 m, 17 July 2008. Photo by V.A. Lukhtanov.

is widespread in the southern part of the Balkan Peninsula (Greece and Bulgaria); however, it is more local in the north. It is known from Albania, the Republic of Macedonia, south Serbia (Kudrna et al. 2011, Eckweiler and Bozano 2016), Bosnia and Herzegovina (Koren 2010). It was mentioned for European Turkey (Hesselbarth et al. 1995, Tolman and Lewington 2008) and recently found in Croatia (Koren 2010, Dincă et al. 2013a).

Figs 28–30

Figure 28.

. Northern Greece, Falakro Mt, near Granitis, 1700 m, 23 July 2008. Photo by V.A. Lukhtanov.

Figure 30.

Habitat of . Northern Greece, Falakro Mt, near Granitis, 1700 m, 24 July 2008. Photo by V.A. Lukhtanov.

has a dot-like distribution area and is known from the high altitudes of north-east Greece (Mt Pangeon, Mt Phalakro and Mt Orvilos) and south-west Bulgaria (Mt Orvilos, also known as Mt Slavyanka, Mt Alibotush and Kitka Planina) (Kolev 1994, Tolman and Lewington 2008, Eckweiler and Bozano 2016).

Fig. 31

Figure 31.

Habitat of in its type locality. Greece, Peloponnesse Peninsula, Mt. Chelmos, near Kalavrita, 1600 m, 16 July 2008. Photo by V.A. Lukhtanov.

has been considered as a relatively widespread species (Kolev and van der Poorten 1997). Apart from its type-locality (South Greece, Peloponnese), it has been recorded in different parts of Central and Northern Greece (Brown 1976a, Wakeham-Dawson and Spurdens 1994, Wakeham-Dawson 1998, Pamperis 2009), from a few areas in south Macedonia (Kolev and van der Poorten 1997, Melovski and Bozhinovska 2014) and from some localities in south-west Bulgaria and one isolated place in the central part of the country (Abadjiev 2001, Kolev 1994, Kolev and van der Poorten 1997). Tshikolovets (2011) and Eckweiler and Bozano (2016) show its distribution extending into Albania, although the species has not been recorded from this country in recent surveys (Verovnik and Popović 2013). Verovnik et al. (2015) recorded it in Bosnia and Herzegovina. Koren and Laus (2015) recorded it in Croatia; however, this record was not confirmed by molecular data (Lovrenčić et al. 2016).

Our chromosomal data confirm in South Greece (Peloponnese), but cannot confirm it in Central and Northern Greece and in Bulgaria where it is replaced by the closely related allopatric species and . In the light of the data obtained, the occurrence of in Bulgaria, Albania, Macedonia and Bosnia and Herzegovina seems to be doubtful and requires a confirmation based on chromosomal analysis. We cannot exclude that the populations from Albania, Macedonia and Bosnia and Herzegovina could represent or even undescribed taxa of the subgenus .

Figs 32–35

This species is known from Timfristos and Parnassos Mts in Central Greece only.

Figs 36–39

Figure 36.

Hvoyna, Bulgaria, type locality of , 2 July 2016. Photo by E. Pazhenkova.

Figure 39.

Habitat of in its type locality. Northern Greece, Makedonía, Dráma district, near Granítis, 900 m, 23 July 2008. Photo by V.A. Lukhtanov.

This species is known from South Bulgaria and Northern Greece only. However, its occurrence in other countries in the northern Balkan is theoretically possible (see above).

An alternative classification and conservation

Theoretically, the main groupings in the – – – subcomplex can be interpreted as subspecies-level taxa, if the polytypic species concept is applied. None of them appears to be sympatric in distribution, and taken together they form a moderately supported monophyletic lineage on the + tree (Fig. 9). Under this scenario, this subcomplex would be considered a diverse array of allopatric populations, each of which possesses unique genetic attributes (karyotypes and molecular markers) and is distributed in a particular area within the Alp-Balkan region. As possible theoretical support for this alternative classification, one can argue that differences in chromosome numbers in do not necessarily result in complete reproductive isolation, and, at least in some particular cases, do not prevent interspecific hybridization and genetic introgression (Lukhtanov et al. 2015b).

However, even if the last statement is true, it does not mean that chromosomal rearrangements are irrelevant to formation of genetic barriers between populations. Chromosome changes have been shown to be important in speciation in the blue butterflies (Lukhtanov et al. 2005, 2015b, Kandul et al. 2007, Talavera et al. 2013b). Even a weak decrease in fertility in heterozygotes for multiple chromosomal rearrangenments can result in selection against them and in formation of a boundary between chromosomally diverged homozygous populations. Additional studies are required to shed light on this topic. Recent studies have treated , and as species-level taxa (Eckweiler and Bozano 2016), which our study suggests is a reasonable interpretation although distribution areas of and should be corrected. Based on our current knowledge, if , and are considered species-level taxa, should be treated as a species-level taxon as well.

Regardless of its taxonomic status as a species or subspecies, represents a unique entity within the genus that deserves additional study. A better understanding of its evolutionary history may be helpful in understanding mechanisms of chromosomal diversification within the genus, and may further elucidate the biogegraphy of the south Balkan and Aegean regions. As a distinct taxonomic entity occupying a very restricted area in Central Greece it should be considered a candidate on the list of protected species in Greece and the whole of Europe.

Biogeography

Analysis of distribution areas and phylogeny of the lineage shows that the phylogeograpic history of this complex involved a combination of dispersal and vicariance events with a clear general trend of dispersal from the East (Iran), where the group most likely arose, to the West: to the Mediterranean area and to the Iberian Peninsula (Vila et al. 2010). The Europe was estimated to be colonized approximately 1.24 Mya (range 0.88–1.64 Mya). Approximately 1.15 Mya (range 0.80–1.51 Mya), the EuroPageBreakpean lineage was divided into three subclades located (1) in the Balkan Mountains and Alps ( sensu auctorum: the Balkans; : the Alps), (2) southern Spain (), and (3) the Iberian-Italian region ( + ), respectively (Vila et al. 2010).

Three chromosomal sublineages discovered in our study ( sensu stricto + +) represent late Pleistocene splits of the Balkan subclade that evolved in allopatry within the Balkan refugium. Given the deep level of chromosomal divergence between these sublineages, we assume that there was a long period of allopatric differentiation when they were separated by geographic or/and ecological barriers. In our opinion, this is evidence for presence of three separate Balkan subrefugia in the past (Pelonnese, Central Greece and Northern Grecee/South Bulgaria).

Greece, as a part of the Balkan Peninsula, has been already reported to harbor genetically differentiated lineages from the rest of the Balkans for a number of animal species as a result of evolution in multiple separate refugia (Kasapidis et al. 2005, Alexandri et al. 2012, Karaiskou et al. 2014). Thus, our data provide a chromosomal evidence for this refugia-within-refugia concept (Gòmez and Lunt 2007, Karaiskou et al. 2014), and the discovery of a new, chromosomally diverged species stresses the biogeographic importance of Central Greece as a separate Pleistocene refugium within the Balkans.

Taxonomic conclusion

We propose the following taxonomic arrangement of the and lineages (chromosome numbers are in parentheses when known, the Balkan taxa are in bold):