| Literature DB >> 28090412 |
Boris B Demenou1, Olivier J Hardy1.
Abstract
PREMISE OF THE STUDY: Anthonotha macrophylla (Fabaceae) is a common tree species throughout the Guineo-Congolian forest that is sometimes confounded with other congeneric species; it is expected to be an interesting phylogeographical model to infer the history of the African dense forests. We developed 18 microsatellite markers from this species and tested their transferability in 15 congeneric species. METHODS ANDEntities:
Keywords: Anthonotha macrophylla; Fabaceae; microsatellites; next-generation sequencing; rainforest history
Year: 2017 PMID: 28090412 PMCID: PMC5231917 DOI: 10.3732/apps.1600120
Source DB: PubMed Journal: Appl Plant Sci ISSN: 2168-0450 Impact factor: 1.936
Characteristics of 18 polymorphic microsatellite loci for Anthonotha macrophylla.
| Locus | Primer sequences (5′–3′) | Fluorescent label | Repeat motif | Allele size range (bp) | GenBank accession no. |
| Multiplex 1 | |||||
| AntM-ssr22 | F: | Q2-NED | (AG)9 | 149–160 | KX865149 |
| R: TCGATCAGGTCGTAACGAGG | |||||
| AntM-ssr26 | F: | Q3-VIC | (GA)8 | 176–182 | KX865151 |
| R: AGGCAGAGCGTGATATCGTC | |||||
| AntM-ssr08 | F: | Q1-6-FAM | (CT)8 | 179–201 | KX865144 |
| R: TGCTCATTTCAGAGATGGTGTT | |||||
| AntM-ssr42 | F: | Q4-PET | (TC)7 | 166–203 | KX865157 |
| R: AAACAGAGTTGTCCTTCTCCG | |||||
| AntM-ssr15 | F: | Q2-NED | (TC)9 | 211–235 | KX865146 |
| R: AGATATGGAAGCCATGGACG | |||||
| AntM-ssr09 | F: | Q1-6-FAM | (CT)25 | 238–331 | KX865145 |
| R: GCTTAGGCATCAAATACGGG | |||||
| Multiplex 2 | |||||
| AntM-ssr36 | F: | Q3-VIC | (GA)11 | 117–135 | KX865154 |
| R: CGCTTTCATCATTCACTCAGA | |||||
| AntM-ssr27 | F: | Q3-VIC | (TC)7 | 166–192 | KX865152 |
| R: TCTTTAGGAGATGGGCTAGTGG | |||||
| AntM-ssr41 | F: | Q4-PET | (GA)7 | 176–194 | KX865156 |
| R: CTCTGCGCTAGAGGCTAGGA | |||||
| AntM-ssr24 | F: | Q2-NED | (GA)8 | 177–222 | KX865150 |
| R: TGAGAAATGGAAGTCCACCA | |||||
| AntM-ssr39 | F: | Q4-PET | (GA)14 | 201–227 | KX865155 |
| R: CCTTGTGATACACAGCCTGC | |||||
| AntM-ssr04 | F: | Q1-6-FAM | (GA)7 | 222–230 | KX865142 |
| R: CTCTTGCGTCCTGATCTTCC | |||||
| AntM-ssr02 | F: | Q1-6-FAM | (AG)10 | 349–387 | KX865141 |
| R: AATCCAGCTACTCCTGCTCC | |||||
| Multiplex 3 | |||||
| AntM-ssr33 | F: | Q3-VIC | (GA)12 | 146–166 | KX865153 |
| R: TGAATGGAACCATGGGTATGT | |||||
| AntM-ssr21 | F: | Q2-NED | (TC)7 | 158–160 | KX865148 |
| R: CACTCTCGCAAGATTTGCTT | |||||
| AntM-ssr43 | F: | Q4-PET | (CT)8 | 170–216 | KX865158 |
| R: TGAACCGGCAAAGATTGTGT | |||||
| AntM-ssr16 | F: | Q2-NED | (GA)9 | 307–363 | KX865147 |
| R: TCCCTTAGCCATCGATCTCA | |||||
| AntM-ssr06 | F: | Q1-6-FAM | (CT)8 | 345–377 | KX865143 |
| R: AACCTGTTTACTCGAGTTGGG |
Optimal annealing temperature was 55°C and 53°C for Phase 1 and 2.
The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined.
Genetic properties of the 18 polymorphic microsatellite loci for three populations of Anthonotha macrophylla.
| Benin (Pobè, | Liberia (Nimba, | Cameroon (Southeast, | ||||||||||||||
| Locus | ||||||||||||||||
| Multiplex 1 | ||||||||||||||||
| AntM-ssr22 | 6 | 4 | 0.26 | 0.33 | 0.21 | 0.08 ± 0.08 | 3 | 0.31 | 0.34 | 0.09 | 0.03 ± 0.03 | 5 | 0.50 | 0.58 | 0.14 | 0.06 ± 0.06 |
| AntM-ssr26 | 6 | 3 | 0.21 | 0.29 | 0.27 | 0.00 ± 0.00 | 4 | 0.29 | 0.63 | 0.55** | 0.26 ± 0.06 | 4 | 0.07 | 0.30 | 0.75*** | 0.32 ± 0.08 |
| AntM-ssr08 | 17 | 4 | 0.11 | 0.20 | 0.48* | 0.12 ± 0.12 | 8 | 0.37 | 0.42 | 0.12 | 0.00 ± 0.00 | 13 | 0.54 | 0.73 | 0.27** | 0.07 ± 0.05 |
| AntM-ssr42 | 20 | 9 | 0.63 | 0.86 | 0.27 | 0.10 ± 0.08 | 19 | 0.40 | 0.93 | 0.57*** | 0.33 ± 0.07 | 9 | 0.46 | 0.85 | 0.46*** | 0.28 ± 0.07 |
| AntM-ssr15 | 12 | 4 | 0.32 | 0.29 | −0.10 | 0.00 ± 0.00 | 4 | 0.31 | 0.28 | −0.11 | 0.00 ± 0.00 | 9 | 0.61 | 0.65 | 0.06 | 0.01 ± 0.03 |
| AntM-ssr09 | 24 | 9 | 0.53 | 0.74 | 0.29* | 0.11 ± 0.07 | 10 | 0.26 | 0.79 | 0.67*** | 0.33 ± 0.12 | 16 | 0.68 | 0.82 | 0.17 | 0.01 ± 0.04 |
| Multiplex 2 | ||||||||||||||||
| AntM-ssr36 | 11 | 6 | 0.53 | 0.54 | 0.03 | 0.00 ± 0.00 | 9 | 0.66 | 0.67 | 0.01 | 0.00 ± 0.00 | 10 | 0.64 | 0.79 | 0.19 | 0.06 ± 0.04 |
| AntM-ssr27 | 7 | 2 | 0.00 | 0.47 | 1.00*** | — | 6 | 0.29 | 0.35 | 0.19 | 0.08 ± 0.06 | 4 | 0.15 | 0.31 | 0.53** | 0.35 ± 0.27 |
| AntM-ssr41 | 7 | 2 | 0.05 | 0.05 | 0.00 | 0.00 ± 0.00 | 3 | 0.26 | 0.23 | −0.11 | 0.00 ± 0.00 | 4 | 0.61 | 0.45 | −0.35 | 0.00 ± 0.00 |
| AntM-ssr24 | 13 | 4 | 0.68 | 0.61 | −0.12 | 0.00 ± 0.00 | 11 | 0.57 | 0.84 | 0.32 | 0.17 ± 0.06 | 6 | 0.63 | 0.74 | 0.15 | 0.06 ± 0.07 |
| AntM-ssr39 | 13 | 7 | 0.53 | 0.49 | −0.08 | 0.00 ± 0.00 | 6 | 0.46 | 0.50 | 0.08 | 0.01 ± 0.04 | 9 | 0.75 | 0.84 | 0.19* | 0.08 ± 0.05 |
| AntM-ssr04 | 4 | 3 | 0.21 | 0.29 | 0.27 | 0.00 ± 0.00 | 3 | 0.14 | 0.37 | 0.61** | 0.25 ± 0.08 | 2 | 0.04 | 0.04 | 0.00 | 0.00 ± 0.00 |
| AntM-ssr02 | 17 | 8 | 0.74 | 0.89 | 0.17 | 0.04 ± 0.06 | 11 | 0.74 | 0.83 | 0.11 | 0.05 ± 0.04 | 13 | 0.68 | 0.89 | 0.23** | 0.11 ± 0.05 |
| Multiplex 3 | ||||||||||||||||
| AntM-ssr33 | 10 | 5 | 0.58 | 0.54 | −0.08 | 0.00 ± 0.00 | 6 | 0.31 | 0.60 | 0.47** | 0.22 ± 0.12 | 7 | 0.57 | 0.70 | 0.18 | 0.10 ± 0.07 |
| AntM-ssr21 | 2 | 2 | 0.26 | 0.31 | 0.15 | 0.04 ± 0.06 | 1 | 0.00 | 0.00 | 1.00*** | — | 2 | 0.25 | 0.31 | 0.14 | 0.06 ± 0.10 |
| AntM-ssr43 | 18 | 3 | 0.11 | 0.10 | −0.01 | 0.00 ± 0.00 | 13 | 0.86 | 0.89 | 0.04 | 0.00 ± 0.00 | 7 | 0.43 | 0.70 | 0.37*** | 0.21 ± 0.07 |
| AntM-ssr16 | 13 | 8 | 0.63 | 0.76 | 0.17 | 0.03 ± 0.04 | 8 | 0.80 | 0.82 | 0.02 | 0.02 ± 0.02 | 6 | 0.69 | 0.75 | 0.32** | 0.13 ± 0.12 |
| AntM-ssr06 | 14 | 8 | 0.47 | 0.78 | 0.39** | 0.17 ± 0.12 | 11 | 0.26 | 0.86 | 0.70*** | 0.43 ± 0.06 | 4 | 0.00 | 0.53 | 1.00*** | — |
Note: A = number of alleles; AT = total numbers of alleles observed among all three populations; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; r = null allele frequency.
Voucher and locality information are provided in Appendix 1.
Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.
Results of cross-amplification (allele size ranges) of microsatellite loci isolated from Anthonotha macrophylla tested in 15 other Anthonotha taxa.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| |
| Locus | |||||||||||||||
| Multiplex 1 | |||||||||||||||
| AntM-ssr22 | 149–153 | 149–152 | 151 | 153–158 | 151–153 | 151 | 152 | 149–154 | 155–162 | 151–152 | — | 151–153 | 151–155 | 151 | 149–151 |
| AntM-ssr26 | — | — | 189 | — | 180 | — | — | — | 184 | — | — | 178–189 | — | — | — |
| AntM-ssr08 | 177–178 | 181–195 | 188–202 | 179–183 | 179–190 | 179–183 | 200–204 | 184–216 | 183–186 | 175–189 | 184–191 | 177–188 | 171–195 | 184–193 | 177–199 |
| AntM-ssr42 | — | 172 | — | 164–193 | 171 | 171–193 | — | — | — | — | — | 174–185 | 172–193 | — | 166 |
| AntM-ssr15 | 213–222 | 213–220 | 220–228 | 211–233 | 213–215 | 213–224 | 213 | 215–233 | 213–215 | 215–220 | 220–224 | 213–218 | 215–220 | 215–222 | 222–228 |
| AntM-ssr09 | 250 | — | 250 | — | 250 | 248–252 | — | 250 | 250 | — | — | 248–262 | 250 | — | 250 |
| Multiplex 2 | |||||||||||||||
| AntM-ssr36 | 117–125 | 115–117 | 117–123 | 123–135 | 121–127 | 121 | 140–144 | 123–146 | 127–144 | 131–135 | 123–125 | 117–129 | 123–138 | 115 | 125–131 |
| AntM-ssr27 | 172 | 172–194 | 180 | 170–174 | — | — | — | 172 | 212 | 172–186 | — | 172 | — | — | 182–220 |
| AntM-ssr41 | 176 | 176 | 176 | 176–183 | 176 | 176 | 176 | 176 | 176 | 176 | 176 | 176 | 176 | 176 | 176 |
| AntM-ssr24 | 185–187 | 212–214 | — | 183–199 | 185 | 183–209 | 189 | — | — | 187–191 | — | 183–216 | — | — | — |
| AntM-ssr39 | 199–221 | 205–219 | 207–215 | 203–217 | 203–229 | 203–221 | 211 | 205–213 | 207 | 203–215 | — | 205–221 | 205–215 | 207 | 203–205 |
| AntM-ssr04 | 217–228 | 226–228 | 228 | 222–228 | 228 | 228 | 230 | 228 | 228–230 | 228–230 | — | 228 | 228 | 228 | 226–230 |
| AntM-ssr02 | 359 | 351–359 | 357–392 | 348–371 | 351–355 | 346–371 | — | 351–363 | 359–361 | — | — | 355–382 | 351–355 | — | 353–359 |
| Multiplex 3 | |||||||||||||||
| AntM-ssr33 | 146–154 | 151–157 | 147–149 | 144–146 | 146–150 | 146–158 | 151–152 | 150–151 | 151 | 147–159 | 173–196 | 143–152 | 150–168 | 152 | 146–152 |
| AntM-ssr21 | 158–172 | 160–190 | 146–158 | 158–164 | 158–160 | 158–160 | 162 | 158–168 | 160 | 158–174 | 178–194 | 158–162 | 158–174 | 160–188 | 160–182 |
| AntM-ssr43 | 164 | 160–164 | 164 | 172–200 | 164–184 | 177–204 | 164 | 164 | 164 | 164 | — | 164–194 | 160–177 | 164 | 164 |
| AntM-ssr16 | — | — | — | — | 311 | 309–325 | — | — | — | — | — | — | — | — | — |
| AntM-ssr06 | — | — | 353–355 | — | 355 | 357 | — | — | — | — | — | 355 | 355–361 | — | — |
| Private allelic richness (avg. over loci) | 0.10 | 0.09 | 0.17 | 0.11 | 0.03 | 0.05 | 0.18 | 0.13 | 0.03 | 0.17 | 0.28 | 0.03 | 0.06 | 0.13 | 0.08 |
Note: N = number of individuals used.
Voucher and locality information are provided in Appendix 1.
Voucher and collection locality information of the samples used in this study.
| Species | Voucher no. | Collection locality | Latitude | Longitude | |
| 1 | OH3840 | DRC | 2.30018 | 25.02499 | |
| 1 | BS102 | Cameroon | 5.10500 | 11.40056 | |
| 1 | GK1034 | Côte d’Ivoire | 6.42321 | −7.48098 | |
| 19 | BoD306, BoD314, BoD315, BoD317, BoD318, BoD322, BoD323, BoD324, EE0271 | Pobè–Etchéde, Benin | 6.9 | 2.6 | |
| 35 | Bod1724, Bod1726, Bod1745, Bod1767, Bod1783, Bod1798, Bod1896, Bod1800, Bod1809, Bod1813, Bod1849, Bod1857, Bod1858, Bod1916, Bod1933, Bod1946, Bod1968, Bod1996, Bod2019, Bod2039, Bod2049, Bod2076, Bod2083, Bod2089, Bod2097, Bod2100, Bod2105, Bod2113, Bod2115, Bod2117, Bod1577, Bod1579, Bod1581, Bod1596, Bod1607 | Nimba, Liberia | 7.4 | −8.6 | |
| 28 | BS0077, BS0078, JFG0411, JFG0500, LD0044, LD0045, LD0046, LD0116, LD0125, LD0153, LD0179, LD0184, LD0231, MH1290, MH1360, MH1407, MH1444, MH1848, MH1849, OH1009, OH1020, OH1055, OH1061, RP0013, RP0015, RP0192, SVO0077, SVO0155 | Southeastern Cameroon | 3 | 13 | |
|
| 8 | WAG0355893 | DRC | −2.91733 | 28.49783 |
| WAG0360982 | DRC | −1.20000 | 28.21667 | ||
| WAG0161175 | DRC | −3.50000 | 28.43333 | ||
| WAG0380740 | DRC | −0.86667 | 18.13333 | ||
| WAG0161180 | Cameroon | 2.81667 | 11.13333 | ||
| WAG0160988 | Cameroon | 2.38333 | 11.28333 | ||
| TOD1242 | Cameroon | 4.82475 | 9.70107 | ||
| WAG0161181 | Gabon | 1.58333 | 11.58333 | ||
|
| 8 | WAG0161089 | Cameroon | 2.81667 | 10.63333 |
| WAG0235096 | Gabon | −0.89667 | 13.84667 | ||
| WAG0128248 | Gabon | 0.58333 | 10.43333 | ||
| WAG0161169 | Gabon | −2.60000 | 10.58333 | ||
| WAG0251111 | Gabon | −0.70250 | 12.97783 | ||
| WAG0123291 | Gabon | 0.90000 | 10.51667 | ||
| GiD0318, GiD1602 | Gabon | −1.79100 | 10.17100 | ||
|
| 2 | WAG0161261 | Cameroon | 3.30000 | 14.00000 |
| BS0064 | Cameroon | 2.22760 | 13.95950 | ||
|
| 9 | WAG0157486 | Benin | 6.88333 | 2.63333 |
| WAG0161136 | Côte d’Ivoire | 5.04926 | −7.04879 | ||
| WAG0250767 | Gabon | 0.41667 | 11.91667 | ||
| WAG0250767 | Gabon | −0.78400 | 13.78550 | ||
| WHA0052 | Ghana | 5.58833 | −2.43976 | ||
| WAG0012833 | Guinea Bissau | 12.38333 | −13.78333 | ||
| WAG0060575 | Guinea Conakry | 10.41667 | −9.30000 | ||
| WAG0323828 | Liberia | 5.65683 | −8.17467 | ||
| WAG0060577 | Sierra Leone | 9.85000 | −11.31667 | ||
|
| 3 | WAG0161150 | Gabon | −1.36333 | 10.61333 |
| WAG0122594 | Gabon | −2.21533 | 9.66750 | ||
| GiD2141 | Gabon | −0.76000 | 10.54250 | ||
|
| 7 | WAG0204481 | Cameroon | 5.01667 | 8.80000 |
| WAG0235123 | Gabon | −0.85667 | 13.26167 | ||
| WAG0152975 | Côte d’Ivoire | 5.74500 | −4.12500 | ||
| Bod1667 | Liberia | 7.47875 | −8.64761 | ||
| Bod1866, Bod1908, Bod2184 | Liberia | 7.55824 | −8.63344 | ||
| 1 | WAG0161147 | DRC | −4.06667 | 15.56667 | |
|
| 4 | WAG0021831 | Cameroon | 2.80000 | 10.01667 |
| PM5206 | Cameroon | 5.06200 | 8.85400 | ||
| WAG0103899 | Gabon | 0.47350 | 10.25717 | ||
| WAG0127962 | Gabon | 0.50000 | 10.36667 | ||
|
| 3 | WAG0161237 | Gabon | −2.33333 | 10.41667 |
| WAG0028668 | Gabon | −2.25583 | 9.70806 | ||
| WAG0161177 | Gabon | −2.55000 | 10.53333 | ||
|
| 3 | WAG0161248 | Gabon | 6.56667 | 10.68333 |
| WAG0161263 | Cameroon | 4.08333 | 9.10000 | ||
| WAG0161090 | Burundi | −2.70000 | 29.25000 | ||
| 1 | WAG0161250 | Gabon | 0.75000 | 9.83333 | |
|
| 4 | WAG0250507 | DRC | −7.21667 | 17.96667 |
| WAG0281070 | Gabon | −0.80833 | 13.86833 | ||
| WAG0323827 | Liberia | 5.64733 | −8.18133 | ||
| WAG0409718 | Liberia | 5.30617 | −8.75117 | ||
|
| 9 | WAG0394765 | Gabon | 0.58819 | 9.33542 |
| WAG0416743 | Gabon | −2.01253 | 10.48131 | ||
| WAG0122464 | Gabon | 0.81667 | 10.23333 | ||
| WAG0061693 | Gabon | −0.58833 | 10.46833 | ||
| WAG0161258 | Gabon | −1.93333 | 9.83333 | ||
| GiD0264 | Gabon | −1.73000 | 10.19900 | ||
| GiD0283 | Gabon | −1.73300 | 10.20800 | ||
| GiD0396 | Gabon | −1.42059 | 10.30705 | ||
| GiD1849 | Gabon | −0.83155 | 10.46154 | ||
| 1 | WAG0161128 | Cameroon | 3.00000 | 11.35000 | |
|
| 3 | WAG0161217 | Cameroon | 2.65000 | 9.90000 |
| WAG0237446 | Cameroon | 4.35200 | 10.42450 | ||
| WAG0204351 | Cameroon | 4.98333 | 8.83333 |
Note: DRC = Democratic Republic of the Congo; n = number of individuals.
Vouchers are deposited at the Herbarium of the Université Libre de Bruxelles (BRLU), Brussels, Belgium, silica gel collection of Dr. Olivier Hardy.
Individual used to create a DNA genomic library.
Individuals used for the first amplification test and for polymorphism testing.
Individuals used for cross-amplification.
Specimen codes for samples collected from material deposited in the National Herbarium of The Netherlands (WAG), Leiden, The Netherlands.