Literature DB >> 28090412

Development, characterization, and cross-amplification of microsatellite markers in the understudied African genus Anthonotha (Fabaceae).

Boris B Demenou1, Olivier J Hardy1.   

Abstract

PREMISE OF THE STUDY: Anthonotha macrophylla (Fabaceae) is a common tree species throughout the Guineo-Congolian forest that is sometimes confounded with other congeneric species; it is expected to be an interesting phylogeographical model to infer the history of the African dense forests. We developed 18 microsatellite markers from this species and tested their transferability in 15 congeneric species. METHODS AND
RESULTS: A genomic library was obtained using the Illumina platform, and 18 polymorphic microsatellite loci were developed. The polymorphic microsatellites displayed two to 24 alleles (average: 11.9 alleles per locus, expected heterozygosity range: 0.18-0.91, mean: 0.64) in three populations of A. macrophylla from Benin, Liberia, and Cameroon. Cross-amplification in one to nine individuals of 15 congeneric Anthonotha species (A. acuminata, A. brieyi, A. cladantha, A. crassifolia, A. ferruginea, A. fragrans, A. gilletii, A. lamprophylla, A. mouandzae, A. noldeae, A. pellegrinii, A. pynaertii, A. stipulacea, A. wijmacampensis, and A. xanderi) showed successful amplification in six to 17 loci, making most of these markers useful at the generic level.
CONCLUSIONS: This set of markers will be useful to study species delimitation and the genetic structure of Anthonotha species, and thus to better understand the history of tropical African rainforests.

Entities:  

Keywords:  Anthonotha macrophylla; Fabaceae; microsatellites; next-generation sequencing; rainforest history

Year:  2017        PMID: 28090412      PMCID: PMC5231917          DOI: 10.3732/apps.1600120

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Anthonotha P. Beauv. (Fabaceae) is an African native genus belonging to the monophyletic tribe Detarieae. Anthonotha species are found in evergreen to deciduous tropical African forests. Breteler (2010) recognizes 17 species almost completely confined to the Guineo-Congolian region, but species distinction is not always easy without flowers. Among these 17 species, A. macrophylla P. Beauv. is the most common and frequently collected species of the genus. It is a shrub or tree that usually grows 4–20 m tall and is one of the forest tree species found in the Holocene Climate Optimum forest relics in the Dahomey Gap. Its wide and nearly continuous distribution from Guinea to the Democratic Republic of the Congo (west and central African rainforest) should be useful to study the impact of past climate change on tropical African forest from genetic diversity pattern and phylogeographic and demographic inferences. To date, no microsatellite resources have been developed for Anthonotha species. In this paper, we isolated and characterized a set of 18 polymorphic microsatellite markers for Anthonotha. These markers will complement the ones developed for Terminalia superba Engl. & Diels (Demenou et al., 2015) to study the history of fragmentation of the tropical African rainforest in the Dahomey Gap. We also attempted cross-amplification in 15 congeneric Anthonotha species.

METHODS AND RESULTS

Microsatellite development

Total genomic DNA of A. macrophylla was extracted (ca. 5 μg) from 30 mg of silica gel–dried leaf collected from a sample coded OH3840 (2.30018°N, 25.02499°E; Appendix 1) from the Democratic Republic of the Congo using a cetyltrimethylammonium bromide (CTAB) method (Fu et al., 2005). The extracted DNA was used to prepare a DNA genomic library without enrichment, following the protocol of Mariac et al. (2014), and sequenced using the Illumina (San Diego, California, USA) MiSeq platform (sequencing performed at CIRAD, Montpellier, France) as described in Demenou et al. (2015), which generated 28,902 150-bp-long paired-end reads. After assembling the paired reads with PANDAseq (Masella et al., 2012), the identification of simple sequence repeats (SSRs) and design of primers were performed with the bioinformatics pipeline QDD (Meglécz et al., 2014) following three steps: (1) selection of sequences containing SSRs, (2) elimination of redundant sequences, and (3) primer design. We detected 1109 loci (≥7 repeats) between 3246 reads containing microsatellite motifs. From these, we selected 48 primer pairs representing the longest dinucleotide repeats with PCR product length ≥100 bp and flanking region length of at least 15 bp from the microsatellite. Finally, using an M13-like protocol of Micheneau et al. (2011), we attached one of the four possible linkers (Q1–Q4) to the 5′ end of the forward primer of each locus to label PCR products with the distinct fluorochromes FAM, NED, VIC, and PET. Amplification for each pair of designed primers was evaluated in three individuals of A. macrophylla from Benin (EE271; 6.96013°N, 2.67641°E), Cameroon (BS102; 5.10500°N, 11.40056°E), and Côte d’Ivoire (GK1034; 6.42321°N, 7.48098°W) (Appendix 1). PCR reactions (13 μL) were performed using 1 μL of DNA (ca. 50 ng/μL), 1.5 μL PCR buffer (10×), 0.6 μL MgCl2 (25 mM), 0.45 μL dNTP (10 mM each), 0.3 μL of each primer (0.25 μM), 0.08 μL TopTaq DNA polymerase (5 U/μL; QIAGEN, Venlo, The Netherlands), and 8.77 μL H2O using the following conditions: an initial step at 94°C for 4 min; followed by 30 cycles of 30 s at 94°C, 45 s at a primer annealing temperature of 55°C, and 1 min at 72°C; and a final extension of 10 min at 72°C. PCR products were visualized on a 1% agarose gel and stained with SYBR Safe (Invitrogen, Merelbeke, Belgium). All but two of the 48 primer pairs amplified consistently. Polymorphism was assessed on the same three previously amplified individuals (Appendix 1). For this step, PCR amplification was performed for each of 46 loci with fluorescent labeling in a total volume of 15 μL, combining: 0.3 μL of the reverse (0.2 μM) and 0.1 μL of the forward (0.07 μM) microsatellite primers with a Q1–Q4 universal sequence at the 5′ end, 0.3 μL of Q1–Q4 labeled primer (0.2 μM each), 3 μL of Type-it Microsatellite PCR Kit (QIAGEN), H2O, and 1.5 µL of DNA. Cycling conditions were as described above with 30 cycles and primer annealing temperature of 55°C. A mix of 1 µL of each PCR product with 12 µL of Hi-Di Formamide (Life Technologies, Carlsbad, California, USA) and 0.3 µL of MapMarker 500 labeled with DY-632 (Eurogentec, Seraing, Belgium) was run on an ABI3730 Capillary Sequencer (Applied Biosystems, Lennik, The Netherlands). Electropherograms were analyzed with GeneMapper version 3.7 (Applied Biosystems). Twenty-eight loci were discarded because of lack of amplification, genotyping difficulties, or unreadable electropherograms. The remaining 18 selected polymorphic loci were combined into three multiplexed reactions (Table 1) using Multiplex Manager 1.0 software (Holleley and Geerts, 2009).
Table 1.

Characteristics of 18 polymorphic microsatellite loci for Anthonotha macrophylla.

LocusaPrimer sequences (5′–3′)bFluorescent labelRepeat motifAllele size range (bp)GenBank accession no.
Multiplex 1
    AntM-ssr22F: TAGGAGTGCAGCAAGCATTATGTGCTAAGAAGAGCCTTAGCTTQ2-NED(AG)9149–160KX865149
R: TCGATCAGGTCGTAACGAGG
    AntM-ssr26F: CACTGCTTAGAGCGATGCGCCATAAAGAAGATGAGGACAAQ3-VIC(GA)8176–182KX865151
R: AGGCAGAGCGTGATATCGTC
    AntM-ssr08F: TGTAAAACGACGGCCAGTGTGCAAAGGATAGCAGCGTGQ1-6-FAM(CT)8179–201KX865144
R: TGCTCATTTCAGAGATGGTGTT
    AntM-ssr42F: CTAGTTATTGCTCAGCGGTTTGCAGGCAAACATGAGCQ4-PET(TC)7166–203KX865157
R: AAACAGAGTTGTCCTTCTCCG
    AntM-ssr15F: TAGGAGTGCAGCAAGCATGAGACTCAAAGTCCCTACGAAAQ2-NED(TC)9211–235KX865146
R: AGATATGGAAGCCATGGACG
    AntM-ssr09F: TGTAAAACGACGGCCAGTAAGGAAGGATGAGAGGGAAAQ1-6-FAM(CT)25238–331KX865145
R: GCTTAGGCATCAAATACGGG
Multiplex 2
    AntM-ssr36F: CACTGCTTAGAGCGATGCAAAGGCAGAAACACAATGGCQ3-VIC(GA)11117–135KX865154
R: CGCTTTCATCATTCACTCAGA
    AntM-ssr27F: CACTGCTTAGAGCGATGCAAGGGAAATCGTAAAGCTCGQ3-VIC(TC)7166–192KX865152
R: TCTTTAGGAGATGGGCTAGTGG
    AntM-ssr41F: CTAGTTATTGCTCAGCGGTGGGTAGTAATCCGCAAGAAGGQ4-PET(GA)7176–194KX865156
R: CTCTGCGCTAGAGGCTAGGA
    AntM-ssr24F: TAGGAGTGCAGCAAGCATTTTACCAACCCAGAAAGCAAQ2-NED(GA)8177–222KX865150
R: TGAGAAATGGAAGTCCACCA
    AntM-ssr39F: CTAGTTATTGCTCAGCGGTTCCAACAGCTTCCTACTAACTAGCQ4-PET(GA)14201–227KX865155
R: CCTTGTGATACACAGCCTGC
    AntM-ssr04F: TGTAAAACGACGGCCAGTGAGGAAACGAGCTCTCCATCQ1-6-FAM(GA)7222–230KX865142
R: CTCTTGCGTCCTGATCTTCC
    AntM-ssr02F: TGTAAAACGACGGCCAGTTACTCAGAGGTGAGCTAAGCCGQ1-6-FAM(AG)10349–387KX865141
R: AATCCAGCTACTCCTGCTCC
Multiplex 3
    AntM-ssr33F: CACTGCTTAGAGCGATGCTGGAAGTCCTCTGGCAGATTQ3-VIC(GA)12146–166KX865153
R: TGAATGGAACCATGGGTATGT
    AntM-ssr21F: TAGGAGTGCAGCAAGCATTATGGGTGCAGATTCCAGTGQ2-NED(TC)7158–160KX865148
R: CACTCTCGCAAGATTTGCTT
    AntM-ssr43F: CTAGTTATTGCTCAGCGGTTAAAGTACCAGCACGCAGCAQ4-PET(CT)8170–216KX865158
R: TGAACCGGCAAAGATTGTGT
    AntM-ssr16F: TAGGAGTGCAGCAAGCATATGCAGGTTCCCAAGGTATGQ2-NED(GA)9307–363KX865147
R: TCCCTTAGCCATCGATCTCA
    AntM-ssr06F: TGTAAAACGACGGCCAGTGATTCTGACTGACCAATGGGAQ1-6-FAM(CT)8345–377KX865143
R: AACCTGTTTACTCGAGTTGGG

Optimal annealing temperature was 55°C and 53°C for Phase 1 and 2.

The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined.

Characteristics of 18 polymorphic microsatellite loci for Anthonotha macrophylla. Optimal annealing temperature was 55°C and 53°C for Phase 1 and 2. The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined.

Microsatellite marker data analysis

We evaluated the quality of these 18 microsatellite markers in three populations of A. macrophylla from southern Benin (N = 19), southern Liberia (N = 35), and eastern Cameroon (N = 28) (Appendix 1). Multiplex PCR reactions were carried out as described above to check polymorphism except that we added 3 μL of 5× Q-solution and readjusted the quantity of H2O for a total volume of 15 μL. Multiplex PCR programs consisted of 94°C (5 min); followed by 22 cycles of 95°C (30 s), 56°C (90 s), and 72°C (1 min); followed by 10 cycles of 94°C (30 s), 53°C (90 s), and 72°C (1 min); and a final extension of 10 min at 72°C. We computed the parameters of allele size range, observed number of alleles (A) per locus, observed (Ho) and expected (He) heterozygosities, inbreeding coefficient (F), and null allele frequencies (r) with INEst 1.0 (Chybicki and Burczyk, 2009) for each locus and population. We also tested deviation from Hardy–Weinberg equilibrium (HWE) for each locus with SPAGeDi (Hardy and Vekemans, 2002). The number of alleles per locus ranged from two to 24 (average of 11.9 alleles per locus; Table 2). Ho and He ranged from 0 to 0.74 (average: 0.38) and from 0.05 to 0.89 (average: 0.48) for the Benin population, from 0 to 0.86 (average: 0.41) and from 0 to 0.93 (average: 0.58) for the Liberia population, and from 0 to 0.75 (average: 0.43) and from 0.04 to 0.89 (average: 0.63) for the Cameroon population (Table 2), repectively. Significant deviation from HWE (Table 2) was observed for four loci (AntM-ssr08, AntM-ssr09, AntM-ssr27, and AntM-ssr06) in the Benin population, for seven loci (AntM-ssr26, AntM-ssr42, AntM-ssr09, AntM-ssr04, AntM-ssr33, AntM-ssr21, and AntM-ssr06) in the Liberia population, and for nine loci (AntM-ssr26, AntM-ssr08, AntM-ssr42, AntM-ssr27, AntM-ssr39, AntM-ssr02, AntM-ssr43, AntM-ssr16, and AntM-ssr06) in the Cameroon population due to the presence of null alleles. After accounting for the effect of null alleles, INEst inferred no inbreeding across populations (F = 0.00 ± 0.00), indicating an outcrossing mating system. The sequences of the developed microsatellite loci have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (Bioproject ID PRJNA352928).
Table 2.

Genetic properties of the 18 polymorphic microsatellite loci for three populations of Anthonotha macrophylla.

Benin (Pobè, N = 19)Liberia (Nimba, N = 35)Cameroon (Southeast, N = 28)
LocusATAHoHeFbrAHoHeFbrAHoHeFbr
Multiplex 1
    AntM-ssr22640.260.330.210.08 ± 0.0830.310.340.090.03 ± 0.0350.500.580.140.06 ± 0.06
    AntM-ssr26630.210.290.270.00 ± 0.0040.290.630.55**0.26 ± 0.0640.070.300.75***0.32 ± 0.08
    AntM-ssr081740.110.200.48*0.12 ± 0.1280.370.420.120.00 ± 0.00130.540.730.27**0.07 ± 0.05
    AntM-ssr422090.630.860.270.10 ± 0.08190.400.930.57***0.33 ± 0.0790.460.850.46***0.28 ± 0.07
    AntM-ssr151240.320.29−0.100.00 ± 0.0040.310.28−0.110.00 ± 0.0090.610.650.060.01 ± 0.03
    AntM-ssr092490.530.740.29*0.11 ± 0.07100.260.790.67***0.33 ± 0.12160.680.820.170.01 ± 0.04
Multiplex 2
    AntM-ssr361160.530.540.030.00 ± 0.0090.660.670.010.00 ± 0.00100.640.790.190.06 ± 0.04
    AntM-ssr27720.000.471.00***60.290.350.190.08 ± 0.0640.150.310.53**0.35 ± 0.27
    AntM-ssr41720.050.050.000.00 ± 0.0030.260.23−0.110.00 ± 0.0040.610.45−0.350.00 ± 0.00
    AntM-ssr241340.680.61−0.120.00 ± 0.00110.570.840.320.17 ± 0.0660.630.740.150.06 ± 0.07
    AntM-ssr391370.530.49−0.080.00 ± 0.0060.460.500.080.01 ± 0.0490.750.840.19*0.08 ± 0.05
    AntM-ssr04430.210.290.270.00 ± 0.0030.140.370.61**0.25 ± 0.0820.040.040.000.00 ± 0.00
    AntM-ssr021780.740.890.170.04 ± 0.06110.740.830.110.05 ± 0.04130.680.890.23**0.11 ± 0.05
Multiplex 3
    AntM-ssr331050.580.54−0.080.00 ± 0.0060.310.600.47**0.22 ± 0.1270.570.700.180.10 ± 0.07
    AntM-ssr21220.260.310.150.04 ± 0.0610.000.001.00***20.250.310.140.06 ± 0.10
    AntM-ssr431830.110.10−0.010.00 ± 0.00130.860.890.040.00 ± 0.0070.430.700.37***0.21 ± 0.07
    AntM-ssr161380.630.760.170.03 ± 0.0480.800.820.020.02 ± 0.0260.690.750.32**0.13 ± 0.12
    AntM-ssr061480.470.780.39**0.17 ± 0.12110.260.860.70***0.43 ± 0.0640.000.531.00***

Note: A = number of alleles; AT = total numbers of alleles observed among all three populations; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; r = null allele frequency.

Voucher and locality information are provided in Appendix 1.

Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.

Genetic properties of the 18 polymorphic microsatellite loci for three populations of Anthonotha macrophylla. Note: A = number of alleles; AT = total numbers of alleles observed among all three populations; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; r = null allele frequency. Voucher and locality information are provided in Appendix 1. Significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.

Cross-amplification in 15 congeneric Anthonotha species

The selected loci were then tested in one to nine individuals of 15 other Anthonotha species (Table 3) using the PCR conditions described above to check their transferability. Among the 18 loci, six to 17 (mean: 13) successfully amplified depending on the species and displayed one to nine alleles per locus (results not shown). The allelic size varies among species for a given locus, but a few alleles are shared by up to 10 species (e.g., alleles 158 and 160 for locus AntM-ssr21, alleles 205 and 207 for locus AntM-ssr39, alleles 213 and 215 for AntM-ssr15). Private allelic richness (average over loci) computed with HP-rare 1.1 (Kalinowski, 2005) for each species indicated that A. pellegrinii Aubrév. shows the highest value (0.28), followed by A. gilletii (De Wild.) J. Léonard (0.18), A. cladantha (Harms) J. Léonard (0.17), and A. noldeae (Rossberg) Exell & Hillc. (0.17); therefore, these species are likely the most divergent with A. macrophylla. According to the data of this study, no allele of a given locus is shared by all species.
Table 3.

Results of cross-amplification (allele size ranges) of microsatellite loci isolated from Anthonotha macrophylla tested in 15 other Anthonotha taxa.

A. acuminata (N = 8) A. brieyi (N = 8) A. cladantha (N = 2) A. crassifolia (N = 9) A. ferruginea (N = 3) A. fragrans (N = 7) A. gilletii (N = 1) A. lamprophylla (N = 4) A. mouandzae (N = 3) A. noldeae (N = 3) A. pellegrinii (N = 1) A. pynaertii (N = 4) A. stipulacea (N = 9) A. wijmacampensis (N = 1) A. xanderi (N = 3)
Locus
Multiplex 1
    AntM-ssr22149–153149–152151153–158151–153151152149–154155–162151–152151–153151–155151149–151
    AntM-ssr26189180184178–189
    AntM-ssr08177–178181–195188–202179–183179–190179–183200–204184–216183–186175–189184–191177–188171–195184–193177–199
    AntM-ssr42172164–193171171–193174–185172–193166
    AntM-ssr15213–222213–220220–228211–233213–215213–224213215–233213–215215–220220–224213–218215–220215–222222–228
    AntM-ssr09250250250248–252250250248–262250250
Multiplex 2
    AntM-ssr36117–125115–117117–123123–135121–127121140–144123–146127–144131–135123–125117–129123–138115125–131
    AntM-ssr27172172–194180170–174172212172–186172182–220
    AntM-ssr41176176176176–183176176176176176176176176176176176
    AntM-ssr24185–187212–214183–199185183–209189187–191183–216
    AntM-ssr39199–221205–219207–215203–217203–229203–221211205–213207203–215205–221205–215207203–205
    AntM-ssr04217–228226–228228222–228228228230228228–230228–230228228228226–230
    AntM-ssr02359351–359357–392348–371351–355346–371351–363359–361355–382351–355353–359
Multiplex 3
    AntM-ssr33146–154151–157147–149144–146146–150146–158151–152150–151151147–159173–196143–152150–168152146–152
    AntM-ssr21158–172160–190146–158158–164158–160158–160162158–168160158–174178–194158–162158–174160–188160–182
    AntM-ssr43164160–164164172–200164–184177–204164164164164164–194160–177164164
    AntM-ssr16311309–325
    AntM-ssr06353–355355357355355–361
Private allelic richness (avg. over loci)0.100.090.170.110.030.050.180.130.030.170.280.030.060.130.08

Note: N = number of individuals used.

Voucher and locality information are provided in Appendix 1.

Results of cross-amplification (allele size ranges) of microsatellite loci isolated from Anthonotha macrophylla tested in 15 other Anthonotha taxa. Note: N = number of individuals used. Voucher and locality information are provided in Appendix 1.

CONCLUSIONS

In this study, 18 polymorphic microsatellite markers were developed for A. macrophylla. This set of microsatellite markers showed its tranferability in most of 15 congeneric species. These microsatellite markers and those published on T. superba will be useful for investigating phylogeographic patterns, dispersal patterns, and demographic history of Anthonotha species to provide a better understanding of the fragmentation history of tropical African rainforests in the Dahomey Gap. With them, one can start to disseminate, for example, paleovegetative information for this region.
Appendix 1.

Voucher and collection locality information of the samples used in this study.

SpeciesnVoucher no.aCollection localityLatitudeLongitude
Anthonotha macrophylla P. Beauv.1OH3840bDRC2.3001825.02499
1BS102cCameroon5.1050011.40056
1GK1034cCôte d’Ivoire6.42321−7.48098
19BoD306, BoD314, BoD315, BoD317, BoD318,  BoD322, BoD323, BoD324, EE0271c, EE0272,  EE0273, EE0274, EE0275, MH476, MH2278,  MH2281, MH2282, MH2283, MH2284Pobè–Etchéde, Benin6.92.6
35Bod1724, Bod1726, Bod1745, Bod1767, Bod1783,  Bod1798, Bod1896, Bod1800, Bod1809, Bod1813,  Bod1849, Bod1857, Bod1858, Bod1916, Bod1933,  Bod1946, Bod1968, Bod1996, Bod2019, Bod2039,  Bod2049, Bod2076, Bod2083, Bod2089, Bod2097,  Bod2100, Bod2105, Bod2113, Bod2115, Bod2117,  Bod1577, Bod1579, Bod1581, Bod1596, Bod1607Nimba, Liberia7.4−8.6
28BS0077, BS0078, JFG0411, JFG0500, LD0044,  LD0045, LD0046, LD0116, LD0125, LD0153,  LD0179, LD0184, LD0231, MH1290, MH1360,  MH1407, MH1444, MH1848, MH1849, OH1009,  OH1020, OH1055, OH1061, RP0013, RP0015,  RP0192, SVO0077, SVO0155Southeastern Cameroon313
Anthonotha acuminata  (De Wild.) J. Léonardd 8WAG0355893eDRC−2.9173328.49783
WAG0360982eDRC−1.2000028.21667
WAG0161175eDRC−3.5000028.43333
WAG0380740eDRC−0.8666718.13333
WAG0161180eCameroon2.8166711.13333
WAG0160988eCameroon2.3833311.28333
TOD1242Cameroon4.824759.70107
WAG0161181eGabon1.5833311.58333
Anthonotha brieyi  (De Wild.) J. Léonardd 8WAG0161089eCameroon2.8166710.63333
WAG0235096eGabon−0.8966713.84667
WAG0128248eGabon0.5833310.43333
WAG0161169eGabon−2.6000010.58333
WAG0251111eGabon−0.7025012.97783
WAG0123291eGabon0.9000010.51667
GiD0318, GiD1602Gabon−1.7910010.17100
Anthonotha cladantha (Harms)  J. Léonardd 2WAG0161261eCameroon3.3000014.00000
BS0064Cameroon2.2276013.95950
Anthonotha crassifolia (Baill.)  J. Léonard d 9WAG0157486eBenin6.883332.63333
WAG0161136eCôte d’Ivoire5.04926−7.04879
WAG0250767eGabon0.4166711.91667
WAG0250767eGabon−0.7840013.78550
WHA0052Ghana5.58833−2.43976
WAG0012833eGuinea Bissau12.38333−13.78333
WAG0060575eGuinea Conakry10.41667−9.30000
WAG0323828eLiberia5.65683−8.17467
WAG0060577eSierra Leone9.85000−11.31667
Anthonotha ferruginea (Harms)  J. Léonardd 3WAG0161150eGabon−1.3633310.61333
WAG0122594eGabon−2.215339.66750
GiD2141Gabon−0.7600010.54250
Anthonotha fragrans (Baker f.)  Exell & Hillc.d 7WAG0204481eCameroon5.016678.80000
WAG0235123eGabon−0.8566713.26167
WAG0152975eCôte d’Ivoire5.74500−4.12500
Bod1667Liberia7.47875−8.64761
Bod1866, Bod1908, Bod2184Liberia7.55824−8.63344
Anthonotha gilletii (De Wild.)  J. Léonardd1WAG0161147eDRC−4.0666715.56667
Anthonotha lamprophylla (Harms)  J. Léonardd 4WAG0021831eCameroon2.8000010.01667
PM5206Cameroon5.062008.85400
WAG0103899eGabon0.4735010.25717
WAG0127962eGabon0.5000010.36667
Anthonotha mouandzae Bretelerd 3WAG0161237eGabon−2.3333310.41667
WAG0028668eGabon−2.255839.70806
WAG0161177eGabon−2.5500010.53333
Anthonotha noldeae (Rossberg)  Exell & Hillc.d 3WAG0161248eGabon6.5666710.68333
WAG0161263eCameroon4.083339.10000
WAG0161090eBurundi−2.7000029.25000
Anthonotha pellegrinii Aubrév.d1WAG0161250eGabon0.750009.83333
Anthonotha pynaertii (De Wild.)  Exell & Hillc.d 4WAG0250507eDRC−7.2166717.96667
WAG0281070eGabon−0.8083313.86833
WAG0323827eLiberia5.64733−8.18133
WAG0409718eLiberia5.30617−8.75117
Anthonotha stipulacea J. Léonardd 9WAG0394765eGabon0.588199.33542
WAG0416743eGabon−2.0125310.48131
WAG0122464eGabon0.8166710.23333
WAG0061693eGabon−0.5883310.46833
WAG0161258eGabon−1.933339.83333
GiD0264Gabon−1.7300010.19900
GiD0283Gabon−1.7330010.20800
GiD0396Gabon−1.4205910.30705
GiD1849Gabon−0.8315510.46154
Anthonotha wijmacampensis Bretelerd1WAG0161128eCameroon3.0000011.35000
Anthonotha xanderi Bretelerd 3WAG0161217eCameroon2.650009.90000
WAG0237446eCameroon4.3520010.42450
WAG0204351eCameroon4.983338.83333

Note: DRC = Democratic Republic of the Congo; n = number of individuals.

Vouchers are deposited at the Herbarium of the Université Libre de Bruxelles (BRLU), Brussels, Belgium, silica gel collection of Dr. Olivier Hardy.

Individual used to create a DNA genomic library.

Individuals used for the first amplification test and for polymorphism testing.

Individuals used for cross-amplification.

Specimen codes for samples collected from material deposited in the National Herbarium of The Netherlands (WAG), Leiden, The Netherlands.

  7 in total

1.  Development and characterization of microsatellite loci in Pericopsis elata (Fabaceae) using a cost-efficient approach.

Authors:  Claire Micheneau; Gilles Dauby; Nils Bourland; Jean-Louis Doucet; Olivier J Hardy
Journal:  Am J Bot       Date:  2011-09-16       Impact factor: 3.844

2.  Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR.

Authors:  Clare E Holleley; Paul G Geerts
Journal:  Biotechniques       Date:  2009-06       Impact factor: 1.993

3.  QDD version 3.1: a user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate.

Authors:  Emese Meglécz; Nicolas Pech; André Gilles; Vincent Dubut; Pascal Hingamp; Aurélie Trilles; Rémi Grenier; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2014-05-26       Impact factor: 7.090

4.  Simultaneous estimation of null alleles and inbreeding coefficients.

Authors:  Igor J Chybicki; Jaroslaw Burczyk
Journal:  J Hered       Date:  2008-10-20       Impact factor: 2.645

5.  Cost-effective enrichment hybridization capture of chloroplast genomes at deep multiplexing levels for population genetics and phylogeography studies.

Authors:  Cédric Mariac; Nora Scarcelli; Juliette Pouzadou; Adeline Barnaud; Claire Billot; Adama Faye; Ayite Kougbeadjo; Vincent Maillol; Guillaume Martin; François Sabot; Sylvain Santoni; Yves Vigouroux; Thomas L P Couvreur
Journal:  Mol Ecol Resour       Date:  2014-04-23       Impact factor: 7.090

6.  PANDAseq: paired-end assembler for illumina sequences.

Authors:  Andre P Masella; Andrea K Bartram; Jakub M Truszkowski; Daniel G Brown; Josh D Neufeld
Journal:  BMC Bioinformatics       Date:  2012-02-14       Impact factor: 3.169

7.  Development and characterization of microsatellite markers in the African deciduous tree Terminalia superba (Combretaceae).

Authors:  Boris B Demenou; Jérémy Migliore; Felicien Tosso; Esra Kaymak; Olivier J Hardy
Journal:  Appl Plant Sci       Date:  2015-12-09       Impact factor: 1.936

  7 in total
  2 in total

1.  Resprouters Versus Reseeders: Are Wild Rooibos Ecotypes Genetically Distinct?

Authors:  J Brooks; N P Makunga; K L Hull; M Brink-Hull; R Malgas; R Roodt-Wilding
Journal:  Front Genet       Date:  2021-12-20       Impact factor: 4.599

2.  Genome-wide characterization of microsatellites and genetic diversity assessment of spinach in the Chinese germplasm collection.

Authors:  Shu-Fen Li; Bing-Xiao Wang; Yu-Jiao Guo; Chuan-Liang Deng; Wu-Jun Gao
Journal:  Breed Sci       Date:  2018-08-23       Impact factor: 2.086

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.