Literature DB >> 26697276

Development and characterization of microsatellite markers in the African deciduous tree Terminalia superba (Combretaceae).

Boris B Demenou1, Jérémy Migliore1, Felicien Tosso2, Esra Kaymak1, Olivier J Hardy1.   

Abstract

PREMISE OF THE STUDY: Microsatellites were designed and characterized in the African timber forest tree Terminalia superba (Combretaceae). Due to their high variability, these markers are suitable to investigate gene flow patterns and the structure of genetic diversity. METHODS AND
RESULTS: From a genomic library obtained by next-generation sequencing, seven monomorphic and 14 polymorphic microsatellite loci were developed. The polymorphic microsatellites displayed two to 27 alleles (mean 11.4; expected heterozygosity range 0.283-0.940, mean 0.736) in one population from southeastern Cameroon. Genotypes were typical of an outbreeding diploid species, although null alleles explain a significant heterozygote deficit in three loci. Cross-amplification in three congeneric species (T. ivorensis, T. avicennioides, and T. mantaly) failed, suggesting that T. superba is rather divergent.
CONCLUSIONS: This set of newly developed microsatellite markers will be useful for assessing the genetic diversity, population structure, and demographic history of T. superba in tropical African forests.

Entities:  

Keywords:  Combretaceae; Terminalia superba; microsatellites; next-generation sequencing; rainforest history

Year:  2015        PMID: 26697276      PMCID: PMC4683041          DOI: 10.3732/apps.1500070

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Terminalia superba Engl. & Diels (Combretaceae) is a Guineo-Congolese African tree naturally distributed from Sierra Leone to the Democratic Republic of the Congo. This pioneer tree is representative of tropical secondary semideciduous forests with an average annual rainfall exceeding 1500 mm and a dry season of less than four months (Orwa et al., 2009). Commonly called limba or fraké, T. superba has been planted for economic purposes in several other countries in Africa, the Americas, and Asia. With its widespread distribution, T. superba is well suited for studying the response of the African rainforest to past climate changes, especially during the Pleistocene glacial oscillations, during which the rainforest underwent cycles of range contraction and expansion (Plana, 2004). Investigating the phylogeographic pattern, genetic diversity, and demographic history of natural populations requires the development of molecular markers with a high level of polymorphism, such as microsatellites (Frankham et al., 2004). However, to date, no microsatellite resources have been developed in T. superba to decipher its evolutionary history. In this paper, we describe the isolation and properties of 14 new polymorphic microsatellite markers, developed with a low-cost procedure and next-generation sequencing on T. superba. We also attempted cross-amplification in other Terminalia L. species, but without success.

METHODS AND RESULTS

Microsatellite development

Using a cetyltrimethylammonium bromide (CTAB) method (Fu et al., 2005), total DNA was extracted from 30 mg of the leaf of one individual of T. superba (BoD597), from Ghana (Kakum National Park, collected in 2014) (Appendix 1). A DNA genomic library was then prepared, without enrichment, following the protocol of Mariac et al. (2014) and using the Illumina MiSeq platform (San Diego, California, USA) to generate 150-bp paired-end reads (Centre de coopération internationale en recherche agronomique pour le développement [CIRAD] facilities, Montpellier, France). A total of 472,566 reads were obtained, assembled by pair with PANDAseq (Masella et al., 2012), and then analyzed with the software QDD (Meglécz et al., 2014), which detected 7146 loci containing a microsatellite motif, of which 1397 loci had a microsatellite of at least 10 repeats and surrounded by flanking regions suitable to define pairs of PCR primers. From these, we selected 48 loci containing pure (i.e., not compound) microsatellites with at least 10 dinucleotide repeats, with primers situated at least 20 bp from the microsatellite region, and with PCR product length longer than 150 bp. We added to the 5′ end of the forward primer of each locus one of the four possible linkers (Q1–Q4) to label PCR products with distinct fluorochromes (FAM, NED, VIC, and PET; M13-like protocol [Micheneau et al., 2011]). First amplification tests were performed for each locus on three samples of T. superba: BoD459 (Togo), BoD556 (Ghana), and BoD713 (Nigeria) (Appendix 1). PCR reactions (15 μL) were performed using 1.5 μL buffer (10×), 0.6 μL MgCl2 (25 mM), 0.45 μL dNTPs (10 mM each), 0.3 μL of each primer (0.2 μM), 0.08 μL TopTaq DNA Polymerase (5 U/μL; QIAGEN, Venlo, The Netherlands), 1.5 μL of template DNA (of ca. 10–50 ng/μL), and H2O. PCR conditions were: 94°C (4 min); 30 cycles of 94°C (30 s), 55°C (45 s), and 72°C (1 min); and a final extension at 72°C (10 min). PCR products were visualized on a 1% agarose gel and stained with SYBR Safe (Invitrogen, Merelbeke, Belgium). Forty-four loci amplified consistently. Their polymorphism was then assessed on seven individuals of T. superba from the Democratic Republic of the Congo, Gabon, Cameroon, Nigeria, Benin, Togo, and Ghana (Appendix 1). Fluorescent labeling was performed by PCR amplification in a total volume of 15 μL, combining: 0.3 μL of the reverse (0.2 μM) and 0.1 μL of the forward (0.07 μM) microsatellite primers with a Q1–Q4 universal sequence at the 5′ end, 0.3 μL of Q1–Q4 labeled primer (0.2 μM each), 3 μL of Type-it Microsatellite PCR Kit (QIAGEN), H2O, and 1.5 μL of DNA. PCR program conditions were: 5-min initial denaturation at 95°C, followed by 30 cycles of denaturation/annealing/extension (95°C for 30 s, 55°C for 90 s, 72°C for 1 min), and a final elongation step at 60°C for 30 min. For each PCR product, 1.5 μL were directly added to 12 μL of Hi-Di Formamide (Life Technologies, Carlsbad, California, USA) and 0.3 μL of MapMarker 500 labeled with DY-632 (Eurogentec, Seraing, Belgium) and genotyped on an ABI3730 sequencer (Applied Biosystems, Lennik, The Netherlands). We selected 14 polymorphic and readable loci (seven loci were monomorphic, 17 loci failed to amplify, and six loci were polymorphic but showed uninterpretable amplification patterns). The 14 polymorphic loci were combined in three multiplexed reactions (Table 1) using Multiplex Manager 1.0 software (Holleley and Geerts, 2009). Preliminary population genetic analyses were performed on 42 individuals of T. superba from southeastern Cameroon (Appendix 1). Multiplexed PCRs were carried out using the Type-it Microsatellite PCR Kit (QIAGEN) as follows: 7.5 μL of Multiplex Master Mix, 0.1 μL (0.07 μM) of forward primer and 0.3 μL (0.2 μM) of reverse primer labeled with Q-tailed fluorescent Q1–Q4, 0.3 μL (0.2 μM) of Q1–Q4 primer labeled with 6-FAM, NED, VIC, and PET, 3 μL of 5× Q-solution, H2O, and 1.5 μL of DNA extract. Multiplex PCR conditions were identical to those above, with 27 cycles and annealing temperature of 56°C.
Table 1.

Characterization of 14 polymorphic and seven monomorphic nuclear microsatellite loci isolated from Terminalia superba.

LocusPrimer sequences (5′–3′)Fluorescent labelRepeat motifAllele size range (bp)GenBank accession no.
Multiplex 1
 TS-08F: TGTAAAACGACGGCCAGTTTGACAAGTGTTGCAGGAGAQ1-6-FAM(CT)36179–248KT222788
R: GTTTGACTGGGATGGCTGAG
 TS-25F: TAGGAGTGCAGCAAGCATCGTTTGAAGTGGGAGACCATQ2-NED(AC)15281–301KT222793
R: TTCCCTCTTGATTCTTCCTAGA
 TS-30F: CACTGCTTAGAGCGATGCAGATCACCCGAGATCACCCQ3-VIC(GT)17202–302KT222795
R: TTCTCTTCCAACTGGTCCTCTT
 TS-37F: CTAGTTATTGCTCAGCGGTGTGGTGGGTGCTTGAATTGQ4-PET(GA)15177–250KT222798
R: TAGCAGCTAAGGAAGCTGGG
Multiplex 2
 TS-5F: TGTAAAACGACGGCCAGTGGGCATTCAGGGACTACCTTQ1-6-FAM(GA)24174–272KT222787
R: ACCACTCAGCCACCACTACC
 TS-12F: TGTAAAACGACGGCCAGTTCACGGACGAGAAATCTCAAQ1-6-FAM(AG)13308–310KT222789
R: GCATCATTGGACAAGGAAGAA
 TS-17F: TAGGAGTGCAGCAAGCATGGCCCATATCGAATGAGTTTQ2-NED(TA)14157–213KT222790
R: GTTCATCGAACATGGGCTG
 TS-28F: CACTGCTTAGAGCGATGCTAACGAGCAGCAACCATGTCQ3-VIC(AT)10181–197KT222794
R: TGCACATCAAAGACCCATCT
 TS-42F: CTAGTTATTGCTCAGCGGTTCCCATGATTAGCTGTCATCCQ4-PET(TA)10214–220KT222799
R: TGAGTCCAGTAGTTTAGGAGTGGT
Multiplex 3
 TS-22F: TAGGAGTGCAGCAAGCATCGAGCTTAGCACTTTCCTCCQ2-NED(GA)10224–240KT222791
R: GCTCAGTTCGTTTGCACCTT
 TS-24F: TAGGAGTGCAGCAAGCATATCACCTCGCCTCACTGTCTQ2-NED(AC)12303–321KT222792
R: TTTACCTTCCGCTACACGAA
 TS-32F: CACTGCTTAGAGCGATGCCAAGTTTGATTCCTGCCCTTQ3-VIC(AG)16222–254KT222796
R: ATCCCGTTTGGTTGTTTGAA
 TS-34F: CACTGCTTAGAGCGATGCACCTCAATGGGTGGAATTGAQ3-VIC(AG)23243–286KT222797
R: GCTCTCCTCGCCTGAGTAAA
 TS-44F: CTAGTTATTGCTCAGCGGTCCATATTCAACTTCAAGCTCCACQ4-PET(TC)16196–271KT222800
R: AAGCTAGGAGCTTCGTCGG
Monomorphic loci
 TS-03F: TGTAAAACGACGGCCAGTTTGGTGAAATTGAGAGCCAAQ1-6-FAM(TA)10167KT250550
R: GCATATGAACATAAGGTGTTAGGG
 TS-06F: TGTAAAACGACGGCCAGTCAAAGACCCTTATTTCTAGTCCTCAQ1-6-FAM(AT)10187KT250551
R: TACTTCGCCCAATTCCACCT
 TS-10F: TGTAAAACGACGGCCAGTTTGTTATGGTTATCCTTTCGGGQ1-6-FAM(TG)10225KT250552
R: TGCTCGCATGTCATACAAATG
 TS-20F: TAGGAGTGCAGCAAGCATCGATTAGTGGGCAAGGGTTAQ2-NED(AT)12205KT250553
R: TCTGATGCTTGTGTTCGCTC
 TS-33F: CACTGCTTAGAGCGATGCGCATTCATTTCTCTACCTTGAGCQ3-VIC(AT)12218KT250554
R: AGACCTGCTCGCTCCATAAA
 TS-43F: CTAGTTATTGCTCAGCGGTCGCACCAAATTTCACTCCTTQ4-PET(TC)17228KT250555
R: TCATTAAGTCCATCTCACGGC
 TS-47F: CTAGTTATTGCTCAGCGGTTGAAGGAGGAAGAAGATGAATGQ4-PET(GA)21373KT250556
R: CAGTTGCAATGTTTCACGAT

Annealing temperature for all reactions was 56°C. The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined.

Characterization of 14 polymorphic and seven monomorphic nuclear microsatellite loci isolated from Terminalia superba. Annealing temperature for all reactions was 56°C. The linkers (Q1, Q2, Q3, Q4) attached to the forward primers are underlined. Cross-amplification was also tested on three congeneric species (Appendix 1), including another African forest tree species (T. ivorensis A. Chev., n = 7), an African savanna tree (T. avicennioides Guill. & Perr., n = 2), and a Madagascar native tree (T. mantaly H. Perrier, n = 2), but all of these tests failed (no amplification), indicating that our microsatellites are probably not transferable.

Microsatellite marker data analysis

Genotypes were analyzed with GeneMapper version 3.7 (Applied Biosystems). Microsatellite profiles were typical of a diploid species, displaying at most two alleles per individual and locus. For each of the 14 loci, allele size range, number of alleles (A) per locus, observed (Ho) and expected (He) heterozygosities, inbreeding coefficient (F), and null allele frequencies (r) were calculated with INEst 1.0 (Chybicki and Burczyk, 2009). Deviation from Hardy–Weinberg equilibrium (HWE) was tested for each locus with SPAGeDi (Hardy and Vekemans, 2002), and linkage disequilibrium tests were performed with GENEPOP 4.1 (Rousset, 2008). The southeastern Cameroon population of T. superba revealed a high degree of polymorphism, with the number of alleles per locus ranging from two to 27 (mean of 11.43 alleles per locus; Table 2). Regarding the indices of heterozygosity, Ho ranged between 0.143 and 0.902 (Ho was higher than 0.5 for nine of 14 loci) and He ranged between 0.283 and 0.940 (Table 2). Four loci (TS-5, TS-28, TS-42, and TS-44) significantly departed from HWE (Table 2), generally due to the presence of null alleles or a large amount of missing data. After accounting for the effect of null alleles, INEst inferred a global inbreeding coefficient (F = 0.026 ± 0.089) not significantly different from zero, indicative of an outbreeding species. Significant linkage disequilibrium was detected between four pairs of loci (P < 0.05) after Bonferroni correction (TS-17 and TS-22, TS-37 and TS-25, TS-28 and TS-32, TS-42 and TS-32).
Table 2.

Genetic properties of 14 polymorphic nuclear microsatellite loci developed in Terminalia superba for 42 individuals sampled in southeastern Cameroon.

LocusNAHoHeFr
Multiplex 1
 TS-0840190.8500.9130.0690.022 ± 0.055
 TS-254090.5750.5860.0190.000 ± 0.000
 TS-3040170.7800.8610.0940.033 ± 0.049
 TS-3741270.9020.9400.0400.010 ± 0.046
Multiplex 2
 TS-532150.3750.8220.544*0.369 ± 0.093
 TS-124120.4150.4930.1580.042 ± 0.062
 TS-1742100.5950.6270.0500.013 ± 0.052
 TS-2842120.7380.8410.123*0.055 ± 0.056
 TS-423540.1430.5700.749*0.407 ± 0.066
Multiplex 3
 TS-224160.6590.7230.0890.043 ± 0.047
 TS-243050.2670.2830.0580.000 ± 0.000
 TS-323890.5790.7530.2310.090 ± 0.058
 TS-3431170.8060.8950.0990.037 ± 0.057
 TS-4428100.3930.8070.513*0.320 ± 0.068

Note: A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals successfully genotyped on 42 individuals; r = frequency of null alleles.

*Significant deviation from Hardy–Weinberg equilibrium (P < 0.001).

Genetic properties of 14 polymorphic nuclear microsatellite loci developed in Terminalia superba for 42 individuals sampled in southeastern Cameroon. Note: A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals successfully genotyped on 42 individuals; r = frequency of null alleles. *Significant deviation from Hardy–Weinberg equilibrium (P < 0.001).

CONCLUSIONS

We developed the first set of microsatellite markers for the Guineo-Congolese Combretaceae species T. superba. These 14 microsatellite markers display a high level of polymorphism at the intrapopulation scale. These markers will help to estimate a reliable and informative panel of genetic diversity parameters for the reconstruction of the population history of African rainforests, still rarely conducted in tropical timber tree species.
Appendix 1.

Locality information for the samples used in this study.

SpeciesSample no.CountryLocalityLatitudeLongitude
Terminalia superbaBoD597bGhanaKakum National Park5.34833−1.38444
BoD459cTogoAgou Nyogbo6.872040.72110
BoD556c (BRLU herbarium sample Demenou 63)GhanaSagyimasi6.20716−0.52927
BoD713cNigeriaOndo state7.115684.80733
MP309dDRCLuki−5.6213313,10709
GiD1654dGabonRégion du Mayumbe−3.4098211.41850
NB669dCameroonUFA 09-0242.3253710.4336
BoD721dNigeriaBolorunduro, Owena Forest7.21615.01921
BOD335dBeninPobè6.988912.66840
BoD476dTogoTomégbé7.419840.60108
AD815, AD816, AD817, AD818, AD819, AD820, AD821, AD822, AD823, AD824, AD825, AD826, AD827, AD828, AD829, AD830, AD831, AD832, AD833, AD834, AD835, AD836, AD837eCameroonMindourou3.2714.34
JFG0468, OH3472, OH3473eCameroonBarrière Mbang3.4523014.07680
JFG0504, CM5, OH3778eCameroonCarrefour Bali3.7635014.81470
JFG0406eCameroonForêt communautaire de Mbol3.4423014.62310
JMR0022, JMR0029eCameroonSFID-Mbang 10.0383.8233613.97913
OH3781eCameroonUFA 09.0213.5233314.49806
JFG0306, JFG0313, JFG0348, JFG0374, JFG0453eCameroonUFA 10.026 Alpicam3.5503014.63600
OH3780eCameroonUFA 10.044-Pallisco3.6972213.49667
JFG0401, JFG0472eCameroonUFA 10.052 Decolvenaere3.7680014.56470
RP0132, RP0278, RP0334eCameroonUFA 10031, Boumba3.1900414.25405
NB779, NB814, NB800, OH3468, OH3469eCameroonUFA Lorema (SFID)3.3133513.02998
Terminalia avicennioidesBoD387, BoD388BeninManigri8.904561.77053
Terminalia ivorensisNB398, NB407, NB411, NB412CameroonUFA 11.005 Wijma5.490828.95034
NB439CameroonVillage d’Ogurang5.489988.95359
NB457Cameroon5.586509.05916
PE15LiberiaNimba7.48599−8.63453
OH3197Ghananear Yegue8.29590.60137
Terminalia mantalyBoD00467TogoKpalimé6.910050.63224
BoD00470TogoBadou7.582490.61276

Note: DRC = Democratic Republic of the Congo.

Herbarium sample of individual BoD556 (Demenou 63) is available at the Herbarium of the Université Libre de Bruxelles (BRLU), Brussels, Belgium. Leaf or cambium silica gel samples for all other samples are deposited at BRLU (silica gel collection of Dr. Olivier Hardy).

Individual used for DNA bank enriched in microsatellite markers.

Individuals used for first amplification test.

Individuals used for testing the polymorphism of loci.

Individuals from southeastern Cameroon used to compute population genetic polymorphism.

  8 in total

Review 1.  Mechanisms and tempo of evolution in the African Guineo-Congolian rainforest.

Authors:  Vanessa Plana
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2004-10-29       Impact factor: 6.237

2.  Development and characterization of microsatellite loci in Pericopsis elata (Fabaceae) using a cost-efficient approach.

Authors:  Claire Micheneau; Gilles Dauby; Nils Bourland; Jean-Louis Doucet; Olivier J Hardy
Journal:  Am J Bot       Date:  2011-09-16       Impact factor: 3.844

3.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

4.  Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR.

Authors:  Clare E Holleley; Paul G Geerts
Journal:  Biotechniques       Date:  2009-06       Impact factor: 1.993

5.  QDD version 3.1: a user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate.

Authors:  Emese Meglécz; Nicolas Pech; André Gilles; Vincent Dubut; Pascal Hingamp; Aurélie Trilles; Rémi Grenier; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2014-05-26       Impact factor: 7.090

6.  Simultaneous estimation of null alleles and inbreeding coefficients.

Authors:  Igor J Chybicki; Jaroslaw Burczyk
Journal:  J Hered       Date:  2008-10-20       Impact factor: 2.645

7.  Cost-effective enrichment hybridization capture of chloroplast genomes at deep multiplexing levels for population genetics and phylogeography studies.

Authors:  Cédric Mariac; Nora Scarcelli; Juliette Pouzadou; Adeline Barnaud; Claire Billot; Adama Faye; Ayite Kougbeadjo; Vincent Maillol; Guillaume Martin; François Sabot; Sylvain Santoni; Yves Vigouroux; Thomas L P Couvreur
Journal:  Mol Ecol Resour       Date:  2014-04-23       Impact factor: 7.090

8.  PANDAseq: paired-end assembler for illumina sequences.

Authors:  Andre P Masella; Andrea K Bartram; Jakub M Truszkowski; Daniel G Brown; Josh D Neufeld
Journal:  BMC Bioinformatics       Date:  2012-02-14       Impact factor: 3.169

  8 in total
  2 in total

1.  Development, characterization, and cross-amplification of microsatellite markers in the understudied African genus Anthonotha (Fabaceae).

Authors:  Boris B Demenou; Olivier J Hardy
Journal:  Appl Plant Sci       Date:  2017-01-05       Impact factor: 1.936

2.  History of the fragmentation of the African rain forest in the Dahomey Gap: insight from the demographic history of Terminalia superba.

Authors:  Boris B Demenou; Jean-Louis Doucet; Olivier J Hardy
Journal:  Heredity (Edinb)       Date:  2017-12-27       Impact factor: 3.821

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.