S S Thimoteo1, A Glogauer1,2, H Faoro1,3, E M de Souza1, L F Huergo1, B M Moerschbacher4, F O Pedrosa1. 1. Departmento de Bioquímica e Biologia Molecular, Universidade Federal do Paraná, Curitiba, PR, Brasil. 2. Agência de Inovação, Instituto de Tecnologia do Paraná - Tecpar, Curitiba, PR, Brasil. 3. Instituto Carlos Chagas, Fiocruz, Curitiba, PR, Brasil. 4. Institute for Biology and Biotechnology of Plants, WWU Münster University, Münster, Germany.
Abstract
Chitinases are hydrolases that degrade chitin, a polymer of N-acetylglucosamine linked β(1-4) present in the exoskeleton of crustaceans, insects, nematodes and fungal cell walls. A metagenome fosmid library from a wastewater-contaminated soil was functionally screened for chitinase activity leading to the isolation and identification of a chitinase gene named metachi18A. The metachi18A gene was subcloned and overexpressed in Escherichia coli BL21 and the MetaChi18A chitinase was purified by affinity chromatography as a 6xHis-tagged fusion protein. The MetaChi18A enzyme is a 92-kDa protein with a conserved active site domain of glycosyl hydrolases family 18. It hydrolyses colloidal chitin with an optimum pH of 5 and temperature of 50°C. Moreover, the enzyme retained at least 80% of its activity in the pH range from 4 to 9 and 98% at 600 mM NaCl. Thin layer chromatography analyses identified chitobiose as the main product of MetaChi18A on chitin polymers as substrate. Kinetic analysis showed inhibition of MetaChi18A activity at high concentrations of colloidal chitin and 4-methylumbelliferyl N,N'-diacetylchitobiose and sigmoid kinetics at low concentrations of colloidal chitin, indicating a possible conformational change to lead the chitin chain from the chitin-binding to the catalytic domain. The observed stability and activity of MetaChi18A over a wide range of conditions suggest that this chitinase, now characterized, may be suitable for application in the industrial processing of chitin.
Chitinases are hydrolases that degrade chitin, a polymer of N-acetylglucosamine linked β(1-4) present in the exoskeleton of crustaceans, insects, nematodes and fungal cell walls. A metagenome fosmid library from a wastewater-contaminated soil was functionally screened for chitinase activity leading to the isolation and identification of a chitinase gene named metachi18A. The metachi18A gene was subcloned and overexpressed in Escherichia coli BL21 and the MetaChi18Achitinase was purified by affinity chromatography as a 6xHis-tagged fusion protein. The MetaChi18A enzyme is a 92-kDa protein with a conserved active site domain of glycosyl hydrolases family 18. It hydrolyses colloidal chitin with an optimum pH of 5 and temperature of 50°C. Moreover, the enzyme retained at least 80% of its activity in the pH range from 4 to 9 and 98% at 600 mM NaCl. Thin layer chromatography analyses identified chitobiose as the main product of MetaChi18A on chitin polymers as substrate. Kinetic analysis showed inhibition of MetaChi18A activity at high concentrations of colloidal chitin and 4-methylumbelliferyl N,N'-diacetylchitobiose and sigmoid kinetics at low concentrations of colloidal chitin, indicating a possible conformational change to lead the chitin chain from the chitin-binding to the catalytic domain. The observed stability and activity of MetaChi18A over a wide range of conditions suggest that thischitinase, now characterized, may be suitable for application in the industrial processing of chitin.
Chitin provides structural support and protection for numerous organisms. It is a common
constituent of insect exoskeletons, crustacean shells, some algae cell walls and many
agronomically important pathogens and pests including fungi and nematodes, but it is
absent in higher plants and animals. Chitin is the second most abundant biopolymer on
Earth, exceeded only by cellulose (1). It is
composed of linear chains of β-1,4-linked N-acetylglucosamine (GlcNAc) residues that can
assemble in a crystalline structure by many intramolecular hydrogen bonds turning
insoluble, similar to cellulose.Annually, about 6 to 8 million tonnes of crustacean shells are wasted worldwide, from
which 15–40% corresponds to chitin (2). The
enormous amount of chitin and chitosan continuously generated in nature and from human
consumption requires disposal and recycling on a formidable scale. The complete
enzymatic hydrolysis of chitin to free GlcNAc involves lytic polysaccharide
monooxygenases (3) and glycoside hydrolases
[EC.3.2.1.14]; the latter are classified by amino acid sequence homology into families
18, 19 and 20. The chitinases of glycosyl hydrolases in family 20 (GH-20) are
β-(1,4)-N-acetyl-glucosaminidases that release GlcNAc monomers (4).Families 18 (GH-18) and 19 (GH-19) chitinases differ in their structure and catalytic
mechanism. Family 19 chitinases have predominance of α-helix fold and an inverting,
single-displacement catalytic mechanism, whereas family 18 chitinases have a
(β/α)8-barrel fold as the catalytic domain and may have additional
carbohydrate binding modules (CBM) or fibronectin type III-like domains (Fn3). Their
catalytic mechanism is a substrate-assisted double displacement with retention of
substrate conformation (5).The catalytic domain of family 18 chitinases has conserved sequences SXGG for binding
and DXDXE for hydrolysis, with the glutamate residue participating as proton donor at
the -1 catalytic subsite. The catalytic domains of family 18 can be divided into three
subfamilies, A, B and C, with family A containing an additional (α+β) fold inserted
between the seventh and eighth β-strand. This additional domain creates a deeper
catalytic cleft facilitating longer chitin chain hydrolyses (6).Accessibility to the chitin chain is facilitated by the chitin-binding domains, such as
the CBM and Fn3 domain. Substrate binding may occur at the reducing or non-reducing ends
of the chitin chain for exochitinases, or randomly along the chain for endochitinases.
Both types of chitinases can display a processive mode of action, releasing a series of
oligomers (mostly dimers) before dissociating from the substrate. Usually, processive
chitinases have a deep catalytic cleft and a path of aromatic amino acid residues from
the chitin-binding domain to the catalytic domain. This path helps in the correct
positioning of substrate on the catalytic subsites, and the hydrophobic interactions
give a strong but flexible binding to guide the chitin chain into the active site (1,7).Traditionally, the enzymes used by the industry are derived from cultivable
microorganisms. This has certainly limited the discovery of novel enzymes with potential
for industrial applications (8), since more than
99% of microorganisms present in the environment cannot be cultivated using available
methods (9). To overcome this limitation, a
strategy that involves the direct cloning of the total microbial genomes (metagenome)
from the environment into a cultivable host such as Escherichia coli
was developed (10). The metagenomic strategy has
been successfully employed to isolate and identify enzymes through functional screening,
PCR approaches or DNA sequencing followed by homology searches.The presence and diversity of chitinases have been investigated in some metagenome
libraries from diverse environments such as soil (11), aquatic habitats (12) and extreme
habitats (13) using PCR or sequencing approaches.
However, only a few works went further on the characterization of found chitinases.In this study, a metagenomic fosmid library was functionally screened for chitinase
activity, and a chitinase coding gene, named metachi18A, was identified
and cloned into an expression vector. The purified recombinant chitinase was active on a
range of chitin polymers over a wide range of physico-chemical conditions, suggesting
that this novel chitinase may be suitable for biotechnological applications.
Material and Methods
Bacterial strains and plasmids
Escherichia coli EPI300TM-T1R and pCC2FOS fosmid vector (CopyControl
Fosmid Library Production Kit, Epicentre Biotechnologies, USA) were used in the
metagenomic library. E. coli DH10B and the vectors pUC18 and pCR2.1
(Invitrogen Life Technologies, USA) were used for subcloning steps. E.
coli BL21(DE3) and vector pET-28a(+) (Novagen, USA) were used as the
recombinant protein expression system.
Chemicals and enzymes
FideliTaq PCR Master Mix (USB, USA) was used for DNA amplification. T4 DNA ligase, T4
DNA polymerase, Klenow fragment, T4 polynucleotide kinase, shrimp alkaline
phosphatase (SAP), restriction enzymes and the protein molecular mass marker were
purchased from Fermentas (USA). The HiTrap Chelating HP column was purchased from GE
Healthcare (Uppsala, Sweden). Chitin from crab shells and Fluorimetric Chitinase
Assay Kit were purchased from Sigma-Aldrich (USA). Polyglucosamine (DA 0%) used for
the preparation of partially acetylated chitosans as well as α- and β-chitin were
kindly provided by Mahtani Chitosan (India). All other chemicals used for chitinase
analysis were of analytical grade.
Colloidal chitin preparation
Colloidal chitin was prepared according to the protocol described by Hsu and Lockwood
(14) with some modifications. Chitin from
crab shells was ground in a ball mill and selected for 40 mesh. Twenty grams of
chitin powder were gently stirred with 200 mL of 85% phosphoric acid and allowed to
rest for 24 h at 4°C. Colloidal chitin was washed with tap water four times. The pH
was adjusted to 7 for the last wash, and the material obtained was stored at 4°C.
Metagenomic library and screening for chitinolytic activity
The metagenomic library constructed by Glogauer et al. (15) in fosmid pCC2FOS (around 500,000 clones) was manually
screened for chitinase activity using Luria-Bertani Agar (LA) with 2% colloidal
chitin. The metagenomic library clones were collected into a single pool, which was
serial diluted and plated on LA-chitin, comprising 50,000 colonies distributed in 50
Petri dishes (Ø=150 mm). After incubation at 37°C for 7 days and at room temperature
for another 10 days, clones with hydrolysis halos were selected. Fosmids were
purified by the alkaline lysis method and the restriction cut patterns of
EcoRI and BamHI were analyzed. Single-pattern
fosmids were retransformed into E. coli EPI300 and their
chitinolytic activity on LA-chitin plates was reevaluated.
Subcloning and identification of the chitinase gene
The FosChit DNA was isolated and mechanically fragmented. The fragments were
separated by agarose gel electrophoresis and the fragments of 3 and 5 Kb were
purified and cloned in pUC18 or pCR2.1 plasmid. This sublibrary of the FosChit was
screened for chitinolytic activity on modified LA-chitin plates. Both ends of the
inserts of active subclones were sequenced on an ABI 3500xL Genetic Analyzer (Applied
Biosystems, USA) automated sequencer using Big Dye Terminator Kit and pUC M13 primers
(Applied Biosystems). The plasmids of active clones were also submitted to a random
insertion of EZ-Tn5 obtained by in vitro transposon
insertion reaction with the EZTn5 Insertion Kit (Epicentre). Both ends
of the insertion regions of 96 subclones were also sequenced using the transposon
forward and reverse primers provided with the insertion kit. Sequence assembly and
editing were performed with the Phred-Phrap-Consed software (16). The amino acid sequences were compared with the
non-redundant sequence database deposited at NCBI using BLAST.
Chitinase sequence analyses
Predictions of signal peptide sequences were performed using SignalP 3.0 (17). The ProtParam tool was used to calculate the
theoretical parameters of the protein (18). A
multiple sequence alignment was performed using ClustalW algorithm (19). Predicted domains were analyzed by BLASTp
(NCBI).Structures of proteins with sequences similar to MetaChi18A were acquired on Protein
Data Bank (PDB) (20). The sequence and
secondary structure of two chitinases were compared with sequence MetaChi18A. A
multiple sequence alignment was performed using ClustalW algorithm (19) and the assignments of secondary structures
were performed with the DSSP program (21)
using PDB entries. The visualization and edition of sequences and secondary
structures were performed on ALINE software (22).
Cloning of gene metachi18A
A pair of primers was designed based on the assembled sequence of the active
subclones to amplify gene metachi18A with restriction sites at both
ends and to generate a chitinase with a C-terminal His-tag when expressed in the
pET28 vector. Forward primer MetaChi18AFor (5′ TACAACCATGGCAAGTCCAAAACCT 3′) and reverse primer MetaChi18ARev
(5′ AGCGGAAGCTTGTACTTGCAGCTG 3′)
were used in a PCR reaction (FideliTaq PCR Master Mix, USB, USA) for the
amplification of a 2637 bp fragment. The amplified gene was first cloned into the pCR
2.1 vector (TA Cloning Kit, Invitrogen, USA) according to the manufacturer’s
recommendations, and recombinant plasmids were transformed into E.
coli DH10B competent cells by electroporation. The inserts were sequenced
with M13 forward and reverse primers and with designed primers, internal to the
chitinase gene, to confirm the absence of mutations in MetaChi18A. Recombinant
plasmid was then digested with NcoI (cut at the MetaChi18A
translation start codon) and HindIII. The insert was ligated into
vector pET28a(+), which had been previously digested with the same restriction
enzymes and dephosphorylated by SAP, yielding plasmid pET28a-MetaChi18A – the insert
of which was confirmed by end-sequencing using T7 promoter and T7 terminator primers.
Plasmid pET28a-MetaChi18A was then transformed into E. coliBL21(DE3) cells to express the recombinant C-terminal (His)6-tagged MetaChi18Achitinase.
Overexpression and purification of recombinant MetaChi18A chitinase
E. coliBL21(DE3) cells carrying the pET28a-MetaChi18A plasmid were
grown in 200 mL of LB medium at 37°C until an OD600 of 0.5, and induced by the
addition of isopropyl-β-D thiogalactopyranoside (IPTG) to a final concentration of
0.3 mM. The induced culture was incubated for a further 3 h at 30°C before the
harvesting of the cells by centrifugation (10,000 g for 5 min) at
4°C. The cell pellet was suspended in 20 mL of lysis buffer (20 mM Tris-HCl, pH 8.0,
150 mM NaCl) and disrupted by ultrasonication in an ice bath (10 cycles of 40 s
pulses, 90 W, with 20 s intervals), using a Sonicator® XL 2020 (Heat
Systems-Ultrasonics Inc., USA). The crude extract was then centrifuged at 20,000
g for 30 min at 4°C to pellet the cell debris. The supernatant
containing the His-tagged protein was loaded onto a HiTrap Chelating HP 5 mL column
(GE Healthcare, USA), previously loaded with NiCl2 100 mM and equilibrated
with lysis buffer, using an ÄKTA basic chromatography system (GE Healthcare). The
column was washed with 5 volumes of the lysis buffer. The His-tagged protein was
eluted with an increasing gradient of imidazole up to 500 mM in elution buffer. The
elution of protein was monitored at 280 nm and protein fractions were analyzed by
SDS-PAGE, pooled, dialyzed (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 50% (v/v) glycerol)
and stored at −24°C until use.
Protein content determination, electrophoresis and zymogram analyses
Protein content was determined using Bradford Protein Assay Reagent, following the
manufacturer’s protocol (Bio-Rad, Brazil) with bovine serum albumin as the standard.
Electrophoresis of protein samples was done with 10% (w/v) SDS-PAGE and the gel was
stained with Coomassie brilliant blue R-250 and destained with
methanol/acetic-acid/water (5/1/4 v/v/v). Densitometry analysis of the stained
SDS-PAGE gel was performed with LabWorks Image Acquisition and Analysis Software 4.0
(UVP BioImaging Systems, USA).For zymogram analyses, the purified protein was mixed with a loading buffer without
reducing agent, heated at 90°C for 5 min, and applied onto two wells of the gel.
After separation, the gel was sliced in two. One part was submerged in Coomassie
brilliant blue R-250 for protein bands visualization and the other part was
renatured. The protein was renatured by removing SDS with two washes of 20 mM sodium
acetate buffer, pH 5.0, and incubation in 50 mL of 20 mM sodium acetate buffer with
2.5% Triton X-100 (v/v) for 3 h, with gentle agitation. The gel was then rinsed in 50
mM sodium acetate buffer, pH 5.0, and incubated in the same buffer for 20 min. A
substrate layer was prepared with 1% agar supplemented with 1% colloidal chitin in 20
mM sodium acetate buffer, pH 5.0, (23). Enzyme
activity was detected by overlaying the substrate gel onto the polyacrylamide gel, in
a Petri plate, followed by incubation at 37°C overnight. Bands exhibiting
chitinolytic activity were visualized as clearing zones on substrate gel.
MALDI-TOF/MS analysis of purified MetaChi18A
Matrix-assisted laser desorption/ionization (MALDI) time-of-flight (TOF) mass spectra
(MS) were acquired on a MALDI-TOF/TOF Autoflex II spectrometer (Bruker Daltonics,
Germany) in the reflector positive ion mode with an acceleration voltage of 20 kV, a
delay time of 150 ns and an acquisition mass range of 800 to 3200 Da. Spots were
manually excised from SDS-PAGE and digested in-gel with sequencing grade modified
trypsin (Promega, USA) as described elsewhere (24). The sample was desalted using a ZipTipC18 pipette tip (Millipore
Corporation, USA) and eluted directly onto the MALDI target plate using MALDI matrix
(saturated solution of a-cyano-4-hydroxycinnamic acid in 50% (v/v) acetonitrile and
0.1% TFA). Mass profiles were identified by comparing the peptide masses obtained
with in silico digestion of the His-tagged protein sequence using
PeptideCutter and MS- Digest tools (18).
Chitinase activity assay using 4-MUF-chitooligosaccharides
Chitinase activity was tested using a fluorimetric assay following the manufacturer’s
protocol (Sigma CS1030). Forty nanograms of enzyme were added to 90 µL of assay
buffer containing as a substrate 0.2 mg/mL 4-MUF-GlcNAc, 4-MUF-(GlcNAc)2
or 4-MUF-(GlcNAc)3. Reactions were carried out in 96-well plates for 30
min at 37°C and were terminated by adding a stop solution (400 mM sodium carbonate).
Fluorescence was measured at an excitation wavelength of 360 nm and an emission
wavelength of 450 nm, in an Infinite Series M200 microplate spectrophotometer (Tecan
Trading AG, Switzerland), no later than 30 min after ending the reaction. One unit of
chitinase activity was defined as the release of 1 µmol of 4-MUF per minute at assay
conditions. Effects of pH on activity were determined from pH 3–11 at standard
conditions using 25 mM of each buffer, sodium citrate (pH 3), sodium acetate (pH
4–5), sodium phosphate (pH 6–7), Tris-HCl (pH 8–9) and sodium carbonate (pH 10–11).
The effects of temperature on activity were determined between 20° and 70°C for 10 to
30 min at pH 5.
Chitinase activity assay using colloidal chitin
Reactions consisted of 400 µL of 10 g/L colloidal chitin in sodium acetate buffer, pH
5, and 40 µg of enzyme. Standard conditions of incubation were pH 5 and 37°C for 30
min. After incubation, the samples were centrifuged at 12,000 g for
5 min, 100 µL of supernatant was added to 100 µL of DNS reagent (25), boiled for 20 min, cooled at room
temperature and read at 550 nm. The standard curve was determined with
N-acetylglucosamine from 50 to 800 nM. One unit of chitinase activity was defined as
the release of 1 µmol of reducing sugar per minute at assay conditions. The pH range
used in activity and stability tests was from 3 to 11 and the temperature range was
from 20° to 70°C. Standard conditions were used for activity tests, with varying pH
or temperature values in the respective assays. After enzyme incubation for 1, 3 or
24 h at varying pH or temperature values, the remaining activity of MetaChi18A was
detected using standard conditions. All buffers used were at a concentration of 25
mM: sodium carbonate (pH 11 and 10), Tris-HCl (pH 9 and 8), sodium phosphate (pH 7
and 6), sodium acetate (pH 5 and 4), and sodium citrate (pH 3). Metal ions were added
at 1, 5, or 10 mM final concentrations and chloride salts of Al3+,
Ca2+, Co2+, Cu2+, Fe3+,
Li+, Mg2+, Mn2+, Sn2+, and
Zn2+ were used.
Substrate specificity
MetaChi18A activity was determined towards chitosans with a degree of acetylation
(DA) of 10% (MW∼82 kDa), 20% (MW∼85 kDa), 35% (MW∼88 kDa), 50% (MW∼91 kDa), and 60%
(MW∼93 kDa); all chitosan polymers had an average degree of polymerization (DP) of
500. And also towards colloidal chitin (DP∼1000, MW∼161 kDa), α- and β-chitin,
activity was determined following the method of Horn and Eijsink (26). Reactions consisted of 40 µL of 1 g/L
substrate in sodium acetate buffer (pH 5), 1 ng/µL of enzyme and incubation at pH 5
and 50°C for 1.5 h.
HP-TLC was used to analyze the oligomers resulting from the enzymatic hydrolysis of
commercial dimers to hexamers of GlcNAc A2-A6 (Megazyme, Ireland). Reactions were
performed with 1.25 mg/mL of each oligomer as a substrate (in 10 mM ammonium acetate
buffer pH 5) and 0.75 mg/mL of MetaChi18A, for 5 to 60 min at 50°C. Mixtures
containing the hydrolyzed products were loaded onto silica gel coated HP-TLC plates
(Merck, Germany), carefully dried, run against the solvent (n-butanol, methanol, 25%
ammonia, and water in a ratio of 5:4:2:1) in a chromatography chamber until the
solvent front reached 3/4 of the TLC plate. The plate was dried and dipped into the
staining solution (30% ammonium bisulphate in water) followed by heating at 180°C
(hot air gun, Black and Decker, Germany) to develop the spots on the TLC plate.
Commercial glucosamine and N-acetylglucosamine oligomers (Carbosynth, UK and
Megazyme, Ireland) were used as standards.
Product analysis by mass spectrometry
Standard reactions were incubated for 15 min, 30 min, 1, 5, and 24 h. Matrix-assisted
laser desorption/ionization (MALDI) MS analysis was carried out using the protocol of
Price and Naumann (27). Equal volumes of
matrix [saturated 2,5-dihydroxybenzoic acid (2,5-DHB) in acetonitrile] and reaction
supernatant were spotted onto the MALDI plaque and left to dry. Mass spectra were
recorded on a Bruker Daltonic OmniF instrument (USA) operating in reflection mode of
positive ions, with an acceleration voltage of 20 kV, 150 ns. The MS spectra were
recorded in triplicates with matrix suppression from m/z 200 to m/z 800. Excitation
was set at circa 50% of maximum output and 250 shots were accumulated.
Kinetic parameters determination
Steady-state kinetic data for MetaChi18A were obtained using as substrate colloidal
chitin from 0.5 to 10 mg/mL or 4-MUF-(GlcNAc)2 from 1.25 to 20 µM and 1 µM
of enzyme. Kinetic parameters were determined by measuring the initial rates of
reaction from the increase of reducing sugar concentration, as determined using the
DNS reaction, using colloidal chitin as substrate, and from the increase of MUF
concentration using 4-MUF-(GlcNAc)2 as substrate. The values of the
kinetic constants were calculated by non-linear least-square regression, fitting the
data to equation 1, for a multiple substrate enzyme complex (28).where v0 is the reaction rate, k2 a rate constant, [E] enzyme
concentration, [S] substrate concentration, and K and Ki are dissociation
constants. GraphPadPrism 5 software was used to calculate regressions, including
allosteric kinetics (V0=Vmax*[S]h/(K+ [S]h), where h
is the Hill slope, Michaelis-Menten (V0 = Vmax*[S]/(Km + [S]) and MM with
substrate inhibition (V0=Vmax*[S]/(Km + [S]*(1+[S]/Ki).
Statistical analysis
All experiments were performed with technical and biological triplicates. Data are
reported as means and standard deviations.
Nucleotide sequence accession number
The nucleotide sequence of metachi18A was deposited at the GenBank
database under accession No. KJ160494.
Results
Activity screening and sequence analysis
A metagenomic library (approximately 500,000 clones), hosted in E.
coli and constructed with DNA isolated from a wastewater treatment plant
(15), was screened for chitinase activity.
A pool of the E. coli cells harboring the whole metagenomic library
was plated on LB Agar containing 2% colloidal chitin (Figure 1A). Fifteen of 50,000 screened colonies presented chitinolytic
activity, their fosmids were purified, and the restriction cut analyses showed one
single pattern. After re-transformation of E. coli EPI300 with the
single fosmid, the clone kept the chitinolytic activity.
Figure 1
Screening and purification of chitinase MetaChi18A. A,
Hydrolysis halo produced by MetaChi18A metagenomic clone (arrow) on colloidal
chitin agar plate. B, SDS-PAGE of purified MetaChi18A. MM:
molecular weight marker (kDa); Chi: purified MetaChi18A stained with Coomassie
blue; Zymog: zymogram showing chitinolytic activity of purified MetaChi18A on
colloidal chitin.
The fosmid clone conferring chitinase activity was purified, mechanically fragmented
by nebulization, and fragments of 3 and 5 kb were separated and subcloned into the
vector pUC18. A chitin-hydrolyzing subclone with a 3 kb insert was sequenced
revealing an open reading frame (ORF) of 2594 nucleotides coding for a protein with a
theoretical pI of 5.12 and molecular weight of 92 kDa. This ORF, named
metachi18A, shares 99% amino acid identity with a glycosyl
hydrolase from Aeromonas jandaei [RefSeq: WP_042029877.1] not yet
characterized biochemically. The closest characterized enzyme is a chitinase from
Aeromonas hydrophila [DBJ: BAE87051.1] with 83% amino acid
identity (29).Phylogenetic analysis (Neighbor-Joining method) placed MetaChi18A in the
Aeromonaschitinases group of glycosyl hydrolases family 18
(GH-18) (data not shown). Serratia marcescens ChiA is the closest,
structurally related, characterized enzyme (74% identity on amino acid level in the
N-terminal and catalytic domain) (GenBank: ABI79317.1; Figure 2). The metagenomic MetaChi18A possesses an N-terminal chitin
binding domain E_set_chitinase_N, that is a fibronectin type 3-like domain (Fn3),
followed by the GH-18 domain and two C-terminal chitin-binding domains (ChiC_BD)
joined to the GH-18 domain by a Polycystic Kidney Disease-like domain (PKD) (Figure 2). The N-terminus contains a 23 amino acid
signal peptide with a predicted cleavage site between residues Ala23 and Ala24. The
modeling of MetaChi18A on the basis of the known crystal structure of S.
marcescens ChiA (data not shown) predicts that it has a deep tunnel-like
active site groove with an additional (α+β) domain typical for subfamily A of GH-18
catalytic domains.
Figure 2
Amino acid sequence alignment, secondary structure estimation and domains
schematic representation of MetaChi18A and most similar available chitinases
structures. A, The triangle (pointing down) indicates the
cleavage site of the signal peptide, diamonds indicate the conserved aromatic
residues binding the substrate, circles indicate disulfide bonds and the star
indicates the glutamate residue involved in the hydrolysis. Dark blue boxes
indicate the conserved sequences in the catalytic domain from glycosyl
hydrolases family 18. The sequence background is colored according to the
convention ALSCRIPT Calcons. Representations of secondary structures are given
above the sequences: arrows for β-strands and cylinders for α-helix. Light blue
is the E_set_chitinase_N, N-terminal domain, pink is the catalytic domain, and
green is the (α+β) insertion in catalytic domain. B, Domain
representations follow the same colors with the addition of: orange - PKD
(polycystic kidney disease)-like domain with Ig-like fold, which probably
functions as a ligand-binding site in protein-protein or protein-carbohydrate
interactions and yellow - ChiC_BD (chitin-binding domain related to ChiC of
Streptomyces griseus). The N-terminal domain and the GH-18
catalytic domain from MetaChi18A [Genbank: KJ160494] have 74% identity with
ChiA from Serratia marcescens [GenBank: ABI79317.1] and 54%
identity with the chitinase from Vibrio harveyi [GenBank:
AIV07901.1].
Overexpression and purification of the recombinant MetaChi18A chitinase
The metachi18A gene was PCR-amplified without the signal peptide and
cloned into the pET28a expression vector. The MetaChi18A protein carrying a
C-terminal 6xHis-tag was expressed in E. coliBL21 (DE3) and
purified by affinity chromatography. Most of the expressed protein was insoluble
(about 70% of total expressed MetaChi18A) but the protein in soluble fraction yielded
180 µg of pure MetaChi18A per liter of E. coli culture. We chose to
repeat the purification to get more chitinase rather than adding components to
solubilize more protein, because they could interfere on further experiments for
MetaChi18A characterization. The MetaChi18A preparation was homogeneous as analyzed
by SDS-PAGE (Figure 1B). Zymographic analysis
using colloidal chitin as substrate showed a clear band around the 97 kDa region
revealing that the purified enzyme was active (Figure
1B) and the molecular mass was as predicted from the translated nucleotide
sequence. Peptide mass fingerprinting by MALDI mass spectrometry confirmed that the
purified enzyme was indeed MetaChi18A (data not shown).Substrates 4-methylumbelliferyl N-acetyl-β-D-glucosamine (MUF-GlcNAc),
4-methylumbelliferyl N,N′-diacetylchitobiose (4-MUF-(GlcNAc)2) and
4-methylumbelliferyl β-D-N,N′,N′′-triacetylchitotriose (4-MUF-(GlcNAc)3)
were used for a preliminary characterization of MetaChi18A specificity. MetaChi18A
did not show detectable activity towards 4-MUF-GlcNAc, but the activity was 0.031 and
0.015 U/mg for 4-MUF-(GlcNAc)2 and 4-MUF-(GlcNAc)3 at 37°C,
respectively. MetaChi18A was also active against colloidal chitin with an activity of
0.018 U/mg at 50°C and 0.008 U/mg at 37°C.MetaChi18A was capable of hydrolyzing chitins and chitosans of different degrees of
solubility and acetylation (Figure 3).
MetaChi18A had higher activity towards more acetylated chitosan and β-chitin, but it
was not able to hydrolyze α-chitin at tested incubation times.
Figure 3
Substrate specificity of MetaChi18A. Activities relative to the highest
activity (135 U/mg on β-chitin) measured through quantification of reducing
ends in a reaction with 1 g/L substrate in sodium acetate buffer, pH 5, 1 ng/µL
of enzyme and incubation at pH 5 and 50°C for 1.5 h. DA: degree of acetylation
of chitosan; CC: colloidal chitin. Data are reported as the average of 3
independent experiments with standard errors. *P<0.05, compared to β-chitin
activity (t-test).
Effect of pH and temperature on MetaChi18A activity
MetaChi18A has a very broad pH optimum on both 4-MUF-(GlcNAc)2 and
colloidal chitin used as substrate, ranging from 4 to 9 (Figure 4A and C). The activity of MetaChi18A on colloidal chitin
was higher than 80% of the maximum activity in the wide pH range from 4 to 9, with a
peak at pH 5. Moreover, incubation in buffers, with pH from 4 to 11 for up to 24 h at
room temperature did not inactivate the enzyme.
Figure 4
Effect of pH and temperature on MetaChi18A activity and stability.
Chitinolytic activity was determined using 0.2 mg/mL of 4-MUF derivatives
(A and B orange slashed line, Y-axis on
the right) and 10 mg/mL of colloidal chitin (A and
B dark blue line, Y-axis on the left) as substrate. Enzyme
concentration was 0.40 and 100 ng/µL, respectively. A, Effect
of pH on the activity for 30 min at 37°C; B, effect of
temperature on the activity for 30 min at pH 5; C, stability
of MetaChi18A incubated at indicated pH for 1 or 24 h without substrate;
D, stability of MetaChi18A incubated at the indicated
temperature for 1, 3, or 24 h without substrate. The remaining activities were
measured for 30 min at 37°C and pH 5 using 10 mg/mL of colloidal chitin. The
reactions were performed in 25 mM buffers: pH 3 sodium citrate; pH 4 and 5
sodium acetate; pH 6 and 7 sodium phosphate; pH 8 and 9 Tris-HCl; pH 10 and 11
sodium carbonate. Error bars represent standard deviation. One unit of
chitinase activity (U) was defined as the release of 1 µmol of reducing sugar
or 4-MUF per minute.
The optimum activity for MetaChi18A in a 30 min reaction was at 50°C using both
4-MUF-(GlcNAc)2 and colloidal chitin. Over 40% of the enzyme was
inactivated at 60°C and had low activity below 40°C (Figure 4B). Incubation at 50°C for 3 h did not cause any decrease in
activity. Even after 24 h of incubation at this temperature, MetaChi18A kept 60% of
its activity. However, incubation at 60°C or higher temperatures led to rapid
inactivation (Figure 4D).
Activity assay in the presence of metal ions, EDTA, SDS, Triton X-100 and
NaCl
The effect of metal ions on MetaChi18A activity was determined at a concentration of
1 mM (Table 1). Sn2+ and
Mg2+ slightly decreased MetaChi18A’s activity. At higher concentrations
(5 and 10 mM) only Al3+ substantially reduced ChiA activity by 50 and 95%,
respectively. MetaChi18A retained 98% of its activity in 0.6 M NaCl and 77% in 30 mM
EDTA. The addition of detergents such as Triton X-100 up to 5% did not affect
MetaChi18A activity, while 0.1% SDS and a urea concentration of over 1 M decreased
the activity by 25% (Table 1). All activities
in Table 1 are relative to the control
reaction, performed under standard conditions without any additive.
Identification of chitin hydrolysis product
A time course TLC analysis of MetaChi18A reaction with different substrates indicated
that MetaChi18A does not hydrolyze GlcNAc dimers (A2) (Figure 5A). Trimers (A3) are poorly cleaved into dimers and the monomer
GlcNAc. MetaChi18A hydrolyzed A5 initially to produce A3 and A2. The even numbered
substrates, A4 and A6, were cleaved into A2, with A6 being first cleaved into A4 and
a small amount into A3 (Figure 5A).
Figure 5
Products of MetaChi18A activity on different substrates: chitooligomers
(A2-A6) and polymers; β-chitin, colloidal chitin (CC) and chitosan 60%
acetylated (Chtn60). MetaChi18A hydrolysis products were separated by
thin-layer chromatography. A, Reaction with 0.76 ng/µL
MetaChi18A, 1.25 g/L oligomers in 100 mM MES buffer, pH 5, at 50°C for 5, 30,
and 60 min. B, reaction with 1 ng/µL MetaChi18A, 1 g/L
β-chitin, CC or Chtn60 in 10 mM ammonium acetate buffer, pH 5, at 50°C for 24
h.
MetaChi18A was not able to cleave deacetylated oligomers (D2-D6; data not shown).
Chitin related polymers with decreasing degree of solubility such as chitosan,
colloidal chitin and β-chitin (Figure 5B)
produced a series of small oligomers. However, the latter two substrates produced
mainly dimers. MALDI-TOF-MS analyses identified only diacetylchitobiose as the
product of colloidal chitin cleaved by MetaChi18A (data not shown).
Kinetic parameters
The kinetic constants of MetaChi18A were determined with colloidal chitin as
substrate at 50°C, or 4-MUF-(GlcNAc)2 at 37°C. High concentrations of both
substrates inhibited MetaChi18A activity (Figure
6). In addition, MetaChi18A exhibited a sigmoidal kinetic with colloidal
chitin (Figure 6A).
Figure 6
Kinetic behavior of MetaChi18A. A, Colloidal chitin as
substrate; B, 4-MUF-(GlcNAc)2 as substrate.
Colloidal chitin (g/L) and V0 (nmol of reducing sugar/min);
4-MUF-(GlcNAc)2 (µM) and V0 (nmol of MUF/min).
Reactions were performed at 25 mM sodium acetate buffer, pH 5, at 50°C
(A) or 37°C (B). The black line is the
model that better fits the data: (A) allosteric
kinetic+substrate inhibition, and (B) substrate inhibition;
Blue dotted line: allosteric kinetic; Orange slashed line: Michaelis-Menten
kinetic.
Different kinetic models accounting for substrate inhibition or for allosteric
behavior were used to determine the kinetic parameters (Table 2) of MetaChi18A. The model used for ChiA from
Serratia marcescens (Equation 1) fit satisfactorily to the
experimental data with colloidal chitin, while for 4-MUF kinetics the
Michaelis-Menten equation for substrate inhibition fit better (Figure 6B). The KM, vmax and KI
or Hill slope values were calculated using non-linear regression analysis available
on GraphPad Prism 5 or using Equation 1, and the values for both substrates are
reported in Table 2.
Discussion
Functional screening of metagenomic libraries for chitinases is still a challenge due to
the heterologous expression and to slow substrate degradation. Until now, metagenomic
libraries were screened for chitinases using sequence-based methods based on PCR or NGS,
or functional screening methods using artificial chitin oligomer derivatives, that are
more easily degraded. In our work, we were able to surmount these difficulties by
screening a metagenomic fosmid library that was produced by indirect DNA extraction,
therefore with high prokaryotic DNA content, and incubating plates of the substrate
(colloidal chitin) and fosmid clones for a longer time (almost 2 months.) Even though we
found 15 active clones, the search resulted in a single fosmid. We managed to save time
and material by screening the pool of cells containing the whole metagenomic library.
Although an estimate of 50,000 clones were checked, the redundancy of chitinase active
clones shows that further screening would probably not lead to a new clone
discovery.Metcalfe et al. (30) showed that the diversity of
the chitinolytic community of an upland pasture soil decreased after treatment with
domestic sludge, although it increased the chitinolytic activity. The readily available
carbon and nitrogen sources did not repress chitinases but stimulated the activity of
specific groups of chitinolytic actinobacteria. As our metagenomic source was the soil
of an industrial waste treatment lagoon, the same effect could result in the
invariability of the chitinolytic clones we found.In spite of the high similarity with other Aeromonaschitinases, MetaChi18A showed
distinguished features when compared with the closest characterized chitinase from
Aeromonas hydrophila (29).
The latter has a pH optimum between 5 and 7.5 and shows higher activity at 42°C. Its
relative activity on chitosan DA 20% is only 7% lower than on colloidal chitin, while
MetaChi18A has low activity on chitosan DA 20%. Its diverse subsite specificities are
also evident in the products of oligomers hydrolysis. A. hydrophilachitinase completely hydrolyzes the trimer into dimer and monomer, while MetaChi18A
poorly hydrolyzes it. This suggests that a few amino acid modifications can lead to
significantly divergent hydrolysis features.The structural model together with sequence analysis support the conclusion that
MetaChi18A acts processively on its substrate generating diacetylchitobiose as the main
product, as reported for ChiA and ChiB from S. marcescens (31). Indeed, TLC and MALDI-TOF analyses identified
chitobiose as the single MetaChi18A product of β-chitin and the main product of
colloidal chitin hydrolysis. Moreover, MetaChi18A presents typical features of
processive enzymes; the insertion domain (α+β) at the catalytic domain, a stretch of
aromatic amino acid residues on its surface, from the N-terminal substrate-binding
domain to the catalytic domain, and the conserved residues Trp166 (corresponding to
Trp167 in ChiA from S. marcescens), Trp274 (corresponding to Trp275 in
ChiA) and Trp395 (corresponding to Phe396 in ChiA) (32).Most chitinases described to date have high activity at acidic or close to neutral pH.
MetaChi18A has more than 80% of activity from pH 4 to 9 and remains active at 50°C for
24 h. The results suggest that MetaChi18A is moderately thermophilic, as it would be
expected since it is similar to Aeromonaschitinases.
Aeromonas sp. can be found inhabiting natural soil, food and
animals, but mostly all kinds of aquatic environments. The mesophilic species have
optimal growth at 35° to 37°C (33).Bacterial chitinases respond differently to the presence of a variety of metal ions and
MetaChi18A was not highly affected by the metal ions tested. It has been reported that
the inhibition of chitinase by certain divalent cations occurs because they are able to
form stable complexes with carboxylic groups of aspartic and glutamic acid residues at
the active site (34), but activity assays with
EDTA and all tested ions showed that MetaChi18A has no necessity of a cofactor for its
activity.Concerning the resilience to higher concentrations of NaCl, MetaChi18A remained active
until 600 mM. We cannot claim that this characteristic is related only to the presence
of high NaCl concentrations in the original environment, as a wastewater treatment
lagoon is a rich medium with high concentration of nutrients and microorganisms.
MetaChi18A showed high stability on different conditions including high activity in a
larger pH range. This may be due to the additional domains at both N- and C-terminals
that keep its structure more stable avoiding its disturbance in these conditions. Such
higher stability was already described for chitinases containing chitin binding domain
and Fn3 domain (35,36) but most chitinases have one or two of these domains in one side
while our MetaChi18A has four additional domains surrounding the catalytic domain, which
might protect even more its integrity.As usual for chitinases of the GH-18 family, MetaChi18A had higher activity towards more
acetylated substrates. Since the enzyme requires an acetylated glucosamine residue
positioned in the -1 catalytic subsite (5), the
higher the degree of acetylation (DA) the higher the abundance of cleavage sites in the
polymeric substrates. MetaChi18A was not able to hydrolyze α-chitin presumably due to
its crystalline structure with highly packed chains making access to the enzyme
difficult. It was described that the lytic polysaccharide monooxygenases facilitate
access into α-chitin chains by producing oxidative cuts along the chain (3).Although Cruys-Bagger et al. (37) described that
processive enzymes such as cellulases also show a hyperbolic relationship between
steady-state rate and substrate concentration, the kinetic parameters are more complex
and may not be calculated directly from the Michaelis-Menten equation. Kinetics of ChiA
from S. marcescens on 4-MUF-(GlcNAc)2 had the same profile
and its parameters were determined using Equation 1 (28). MetaChi18A and ChiA from S. marcescens showed similar
catalytic constants (kcat): 38.9 and 34.9 s-1, respectively. On
colloidal chitin, the kinetic parameters of Aeromonas sp. GJ 18 and
Bacillus licheniformischitinases were determined using
Michaelis-Menten non-linear regression (38,39). The KM for MetaChi18A was similar to
that of Aeromonaschitinase while the kcat value was similar
to that of Bacilluschitinase (Table
2).Many chitinases of family GH-18 exhibit substrate inhibition by substrates of low
molecular weight such as 4-MUF-(GlcNAc)2. The proposed MetaChi18A active
cleft contains multi-subsites where small substrates could bind differently leading to
non-productive inhibitory binding (40). However,
this inhibitory mechanism would not be expected for inhibition caused by high
concentrations of the polymeric colloidal chitin, where inhibition is more probably
caused by impaired diffusion of the enzyme. MetaChi18A showed a Hill slope of 4,
indicating substrate-binding cooperativity. This phenomenon may occur due to hysteresis,
a delay of the enzyme in reaching its fully active form that involves conformational
changes. As MetaChi18A is a multi-domain enzyme, the substrate should interact with
binding domains that could rearrange the conformation to facilitate access of the
catalytic domain to the substrate.Although most kinetic studies on chitinases have used small oligomers as substrates, not
reflecting their native behavior on chitin, our study is one of few (38,39) that
report kinetics on colloidal chitin. The data obtained reflect better the natural
substrate, and help to elucidate how chitinases behave on polymeric substrates.Our study was successful in the identification of a chitinolytic clone by functional
screening of a metagenomic fosmid library. We have succeeded in the MetaChi18A
biochemical and kinetic characterization, using colloidal chitin, which is a more
soluble formulation of polymeric chitin.Current limitations on the use of chitinases for biotechnological applications are their
low stability and the limited range of temperatures and pH values in which the
chitinases described to date are functional. The MetaChi18Achitinase described in this
study is a promising alternative for industrial processing of chitin as judged by its
high stability and activity under a broad range of pH values and temperatures.
Authors: J Stöveken; R Singh; S Kolkenbrock; M Zakrzewski; D Wibberg; F G Eikmeyer; A Pühler; A Schlüter; B M Moerschbacher Journal: J Biotechnol Date: 2014-09-18 Impact factor: 3.307
Authors: Christina M Payne; Jamil Baban; Svein J Horn; Paul H Backe; Andrew S Arvai; Bjørn Dalhus; Magnar Bjørås; Vincent G H Eijsink; Morten Sørlie; Gregg T Beckham; Gustav Vaaje-Kolstad Journal: J Biol Chem Date: 2012-09-05 Impact factor: 5.157
Authors: Arnaldo Glogauer; Viviane P Martini; Helisson Faoro; Gustavo H Couto; Marcelo Müller-Santos; Rose A Monteiro; David A Mitchell; Emanuel M de Souza; Fabio O Pedrosa; Nadia Krieger Journal: Microb Cell Fact Date: 2011-07-15 Impact factor: 5.328
Authors: Thaís Barboni Alves; Pedro Henrique de Oliveira Ornela; Arthur Henrique Cavalcanti de Oliveira; João Atílio Jorge; Luis Henrique Souza Guimarães Journal: 3 Biotech Date: 2018-08-10 Impact factor: 2.406